Monitoring Engraftment Post Hematopoietic Stem Cell Transplantation

Transcription

1 Monitoring Engraftment Post Hematopoietic Stem Cell Transplantation David Senitzer, Ph.D Director, HLA Laboratory City of Hope National Medical Center Duarte, California 2009

2 Outline Chimerism monitoring in hematopoietic cell transplantation (HCT) Overview of methodologies Short Tandem Repeat (STR) loci Multiplex STR analysis Identification of Informative Alleles Chimerism monitoring in HCT Q-PCR a new method for chimerism analysis City of Hope 2

3 Clinical Relevance Engraftment following hematopoietic cell transplantation Detection of relapse/rejection City of Hope 3

4 Goals of Monitoring Chimerism To determine the presence or absence of a recipient cell population post transplantation. To quantitate the relative proportion of the recipient and donor cell populations. If possible, to identify a trend of an increasing proportion of recipient cells. City of Hope 4

5 What is needed for clinically relevant analysis? Panel of genetic loci sufficient to differentiate donors from recipients Quick turn-around-time (<24 hours) Sensitivity - ability to detect low numbers of cells (<=5%) Small sample size City of Hope 5

6 : Assessing quantitative chimerism longitudinally: technical considerations, clinical applications and routine feasibility Method Platform Quantitative HLA matched Sex matched Sensitivity SSP PCR No No Use Low VNTR PCR No/yes a Use Use Moderate b STR PCR Yes Use Use 1 5% c SNP PCR d Yes Use Use??1 5% FISH LM Yes Use No 1 5% Q-PCR PCR Yes Use Use >0.05% a Protocols do exist that enable quantitation but are not widely used. b As a qualitative assay; results are inferior to STRs as a quantitative assay. 36 c 1 5% of donor (or recipient) cells detectable; with lineage fractionation, < d Real-time PCR. City of Hope 6

7 Advantages for STR Markers Small product sizes are generally compatible with degraded DNA and PCR enables recovery of information from small amounts of material Multiplex amplification with fluorescence detection enables high power of discrimination in a single test Commercially available in an easy to use kit format City of Hope 7

8 What are STR Loci? Short tandem repeat (STR) are polymorphic DNA loci that contain a repeated nucleotide sequence. The STR repeat unit can be from 2 to 7 nucleotides in length. The number of nucleotides per repeat unit is the same for a majority of repeats within an STR locus. City of Hope 8

9 What are STR Loci? Number of repeat units at any given STR locus may differ (many alleles). Polymorphic STR loci are therefore useful for human identification. PCR-based tests are rapid and easy to standardize. Informative loci can be used to calculate relative amounts of DNA from donor and recipient in a total of 2ng. City of Hope 9

10 How many STRs in the human genome? The efforts of the Human Genome Project have increased knowledge regarding the human genome, and hence there are many more STR loci available now than there were 10 years ago. More than 20,000 tetranucleotide STR loci have been characterized in the human genome (Collins et al. An exhaustive DNA micro-satellite map of the human genome using high performance computing. Genomics 2003;82:10-19) There may be more than a million STR loci present depending on how they are counted (Ellegren H. Microsatellites: simple sequences with complex evolution. Nature Rev Genet 2004;5: ). STR sequences account for approximately 3% of the total human genome (Lander et al. Initial sequencing and analysis of the human genome. Nature 2001;409: ). City of Hope 10 Butler, J.M. (2006) Genetics and genomics of core STR loci used in human identity testing. J. Forensic Sci..

11 Short Tandem Repeat (STR) Markers An accordion-like DNA sequence that occurs between genes TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGA TAGATAGATATCATTGAAAGACAAAACAGAGATGGATGATAGAT ACATGCTTACAGATGCACAC = 12 GATA repeats ( 12 is all that is reported) 7 repeats 8 repeats 9 repeats 10 repeats 11 repeats 12 repeats 13 repeats The number of consecutive repeat units can vary between people Target region City of Hope (short tandem repeat) 11

12 The polymerase chain reaction (PCR) is used to amplify STR regions and label the amplicons with fluorescent dyes using locus-specific primers 8 repeats Locus 1 10 repeats Locus 2 8 repeats 9 repeats Scanned Gel Image City of Hope 12 Capillary Electropherogram

13 Multiplex PCR (Parallel Sample Processing) Compatible primers are the key to successful multiplex PCR STR kits are commercially available Advantages of Multiplex PCR Challenges to Multiplexing primer design to find compatible primers (no program exists) reaction optimization is highly 15 or more STR loci can be simultaneously amplified empirical often taking months Increases information obtained per unit time (increases power of discrimination) Reduces labor to obtain results Reduces template required (smaller sample consumed) City of Hope 13

14 Multiplex PCR Over 10 Markers Can Be Copied at Once Sensitivities to levels less than 1 ng of DNA Ability to Handle Mixtures and Degraded Samples Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges City of Hope 14

15 An Example Forensic STR Multiplex Kit AmpFlSTR Profiler Plus Kit available from PE Biosystems (Foster City, CA) Color Separation 100 bp 200 bp 300 bp 400 bp D3 vwa Size Separation FGA 5-FAM (blue) A D8 D21 D18 JOE (green) D5 D13 D7 NED (yellow) ROX (red) GS500-internal lane standard City of Hope 15 9 STRs amplified along with sex-typing marker amelogenin in a single PCR reaction

16 Information is tied together with multiplex PCR and data analysis AmpFlSTR Identifiler (Applied Biosystems) D8S1179 D21S11 D7S820 CSF1PO D3S1358 TH01 D13S317 D16S539 D2S1338 D19S433 VWA TPOX D18S51 AMEL D5S818 FGA 1 integrated analysis vs. 16 separate runs City of Hope 16

17 Electrophoresis PCR Product Allelic Ladder Repeats City of Hope 17

18 Goals of Monitoring Chimerism To determine the presence or absence of a recipient cell population post transplantation. To quantitate the relative proportion of the recipient and donor cell populations. If possible, to identify a trend of an increasing proportion of recipient cells. City of Hope 18

19 Identification of Alleles At each locus there are usually two alleles Allele peaks are usually of equal size City of Hope 19

20 Definition of an Informative Allele Allele found in recipient DNA that is ABSENT in DNA from the DONOR

21 Recipient Donor Ladder Recipient-Specific Allele Complete Donor Chimera Mixed Chimera (5% R) Mixed Chimera (50% R) City of Hope 21

22 Quantitation R1 Peak area for recipient allele 1 R2 Peak area for recipient allele 2 D1 Peak area for donor allele 1 D2 Peak area for donor allele 2 City of Hope 22

23 Non-Informative Locus R1 R2 D1 D2 City of Hope 23

24 Non-Informative Locus R1/2 D1/2 City of Hope 24

25 Non-Informative Locus for Recipient R1/2 D1 D2 City of Hope 25

26 Informative Locus R1 R2 D1 D2 % R = (100) R2 R2+D2 City of Hope 26

27 Informative Locus R1 R2 D1 % R = (100) City of Hope 27 D2 R1+R2 R1+R2+D1+D2 (stutter bands possible)

28 Stutter Bands Minor peak usually one repeat smaller than major allele Result from slipped strand mispairing during PCR Peak area less than 10% of major allele (difficult to distinguish from mixed chimerism) Requirement for analysis of multiple loci City of Hope 28

29 Patient Donor 100% donor 65% donor City of Hope 29

30 Informative Locus R1 R2 D1 % R = (100) City of Hope 30 D2 R1+R2 R1+R2+D1+D2 (stutter bands possible)

31 R1 D1 R2 D2 City of Hope 31

32 SAMPLE CALCULATION for FGA [(R1 +R2) / (R1 + D1 + R2 +D2)](100) = %RECIPIENT [( ) / ( )](100) = 30.8% City of Hope 32

33 Donor Post Transplant 100% donor Post Transplant - 65% donor City of Hope 33

34 Monitoring peripheral blood subsets Whole blood CD3 CD4 CD8 CD14 CD15 CD19 CD45 Bone Marrow CD3 City of Hope 34

35 Subset analysis % Donor Signal MS PB Grans CD3 CD4 CD8 Mono 07/ / / / City of Hope 35

36 Kristt, D. et al. Bone Marrow Transplantation (2007) 39(5): City of Hope 36

37 Survival C Huisman et. al Bone Marrow Transplantation (2007) 39, City of Hope 37

38 FIGURE 3. Survival of patients with complete donor and mixed chimerism in the first 6 months after BMT. (CML patients conditioned with DBM/Ara-C/Cy.) Anikó Barta, et al. Hu Immunol, 2000, 61(2): City of Hope 38

39 Cord Blood Transplantation HLA Matching with patient HLA-A and B low resolution DRB1 high resolution 6/6, 5/6, or 4/6 matches are acceptable Total nucleated cell count >2 x 10 7 / kg patient HLA match between cord units same as for cord vs patient City of Hope 39

40 City of Hope 40 Kristt, D et al ASHI Qrtly vol 32(4):98-103

41 To compute the % donor % Donor = (D1a1 + D2a1 + D1a2 + D2a2) X100 (Ra1 + Ra2 + D1a1 + D2a1 + D1a2 + D2a2) To compute the %Recipient use the values for R as the numerator Kristt, D et al ASHI Qrtly vol 32(4): City of Hope 41

42 Conclusions STR analysis is sensitive for analyzing chimerism following nonmyeloablative and myeloablative SCT. 24 hour turn around time allows for inclusion in clinical management of patient Any sample from patient or donor can serve as reference Regular monitoring of chimerism can detect onset of relapse and/or rejection City of Hope 42

43 Sensitivity Real-Time PCR Chimerism Performance Targets Detection of 0.05% of minor component in a mixed DNA sample when starting with 250 ng of DNA Sensitivity is limited only by the amount of input DNA in the reaction Need enough copies of the minor component to avoid stochastic sampling error Ability to detect a 2-fold change Can detect a 2-fold change from 0.05% to 0.1% minor component in a mixture City of Hope 43 43

44 Sensitivity Real-Time PCR Chimerism Detection of 0.05% of minor component in a mixed DNA sample when starting with 250 ng of DNA Sensitivity is limited only by the amount of input DNA in the reaction Need enough copies of the minor component to avoid stochastic sampling error Ability to detect a 2-fold change Can detect a 2-fold change from 0.05% to 0.1% minor component in a mixture City of Hope 44

45 AlleleSEQR Chimerism Real-Time PCR Methodology Screening: pretransplant recipient and donor samples are tested with 34 assay panel to identify recipient specific informative markers based on the presence, or absence of PCR amplification. City of Hope 45

46 Quantitation: AlleleSEQR Chimerism Real-Time PCR Methodology One or more informative markers are selected to test the post-transplant sample using pretransplant recipient as reference. The percentage of the recipient cell population in post-transplant sample is calculated automatically using CT (cycle threshold) relative quantitation method by the software. City of Hope 46

47 Real-Time PCR TaqMan Technology - Gold standard for real-time PCR Uses three oligos Two as primers for PCR amplification Third oligo as probe to bind to the PCR product Contains two fluorescent compounds: a fluor and a quencher It is degraded by the exonuclease activity of Taq Reduces the FRET (fluorescence resonance energy transfer) of signal from the fluor to the quencher City of Hope 47

48 Real-Time PCR Amplification Polymerization Process R Q 5 Probe Forward Primer Reverse Primer Reporter dye fluorescence is quenched by spatial proximity to the Quencher moiety when the probe oligonucleotide is intact City of Hope 48 48

49 Real-Time PCR Amplification Strand Displacement Process R Q Probe 5 Forward Primer Reverse Primer The 5 end of the probe is displaced from the template as AmpliTaq DNA polymerase makes contact with the oligonucleotide City of Hope 49 49

50 Real-Time PCR Amplification Process Probe Cleavage R Q Probe 5 Forward Primer Reverse Primer The reporter dye is no longer quenched upon degradation of the probe by the 5-3 exonuclease activity of AmpliTaq DNA polymerase, resulting in an increase in reporter dye signal City of Hope 50 50

51 Real-Time PCR Amplification Process Polymerization complete R Q 3 5 Forward Primer Reverse Primer 5 Successive rounds of amplification result in an accumulation of reporter dye signal, proportional to the amount of amplicon produced City of Hope 51 51

52 Example: Quantitative PCR Amplification Plots JS/FH7 DNA mixtures (250ng total DNA/well) 100% Calibrator (JS DNA) Rnase P all samples 10% 2% 1% 0.2% 0.1% CA033 City of Hope 52 52

53 Final Comment The major shortcoming of STR or Q- PCR analysis of chimerism is the inability to distinguish DNA from normal cells and DNA from malignant cells City of Hope 53