Reminder. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA.

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Reminder. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA."

Transcription

1 DNA Replication

2 Genes are DNA. Reminder DNA is a double-stranded molecule. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC 101 AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag 201 acagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttaggctgctggtggtctacccttggacccaga When a cell divides, both daughter cells must receive a complete set of genes, so the DNA molecules (chromosomes) must replicate before division.

3 Asexual Reproduction Review from Introductory Biology Prokaryotes 1. The entire genome is on one circular chromosome = DNA molecule. 2. The chromosome replicates once to produce two chromosomes that are identical (except for rare mutations). 3. The two identical daughter chromosomes move toward opposite end of the cell. 4. When the cell divides the daughter chromosomes are partitioned one to each daughter cell.

4 Asexual Reproduction (cont.) Eukaryotes Asexual reproduction by mitosis Cell Cycle Mitosis G2 G1 G1 + S + G2 = interphase S Variable lengths. Total time 15 m inutes --> days Animal cells in culture ca. 1 day DNA replicates during S Gene expression occurs during G1 and G2 (and S?) Nuclear division (mitosis) occurs during Mitosis Cell division (cytokinesis) occurs at the end of Mitosis

5 Mitosis (continued) The genome is divided among a number of chromosomes. 1. Each chromosome replicates once in the S phase to produce two sister chromatids (identical DNA molecules). 2. During mitosis the the kinetochore regions of each pair of sister chromatids are attached by chromosome fibers to opposite poles of the cell. 3. Chromosome fibers contract pulling sister chromatids to opposite ends of the cell. 4. During cytokinesis the sister chromatids are partitioned one to each daughter cell.

6 Asexual Reproduction Note that the end result of asexual reproduction in prokaryotes and eukaryotes is the same genetically: Each daughter cell gets a complete copy of the parental cell genome. The daughter cells are genetically identical, except for new mutations that occur during the cell cycle (mainly during DNA replication). The daughter cells constitute a clone.

7 DNA Replication is Semiconservative 1. The strands separate. 2. A new strand is made using each old strand as a template according to the rules of base pairing. Model proposed by Watson and Crick, verified by Matt Meselson and Frank Stahl

8 DNA Replication: Enzyme Activities Many enzymes are required for DNA replication. We will only consider enzyme activities, not specific enzymes. Enzymes with these activities are also used for DNA manipulation in the lab. Arthur Kornberg 1. Helicase unwinds double-helical DNA. 2. Single-strand binding protein binds single strand to keep DNA unwound. 3. DNA polymerase adds new nucleotides (nucleoside triphosphates) to 3 end of existing DNA strand (or RNA primer). Elongates chains 5 to 3 only.

9 DNA Replication: Enzyme Activities 4. Primase makes a single strand of ca. 20 bp off RNA using a DNA strand as a template. Reminder: RNA is like DNA except single-stranded ribose instead of deoxyribose uracil instead of thymine (U pairs with A just as T does)

10 DNA Replication: Enzyme Activities 5. Exonuclease removes nucleotides from the end of a DNA strand; different enzymes work 5 to 3 or 3 to Ligase joins ends of single DNA strands by making new phosphate bonds.

11 Putting it All Together 1

12 Putting it All Together 2

13 Replicating Linear Chromosomes

14 When Replication Forks Meet

15 Enzyme Activities to Finish the Job 7. Gyrase (a topoisomerase) relaxes supercoils produced when the molecule is twisted during replication. Also facilitates unwinding at beginning of replication. 8. Telomerase uses a short RNA template to add short DNA repeats to the short ends of linear chromosomes when the last primer is removed using RNA template.

16 Enzyme Activities for Biotechnology These enzyme activities, plus a few others, are also used to manipulate DNA, for example: PCR Making recombinant DNA Detecting mutations at the molecular level

17 DNA Replication Details Polymerase

18 DNA Replication Details Lagging and Leading Strands

19 Replicating Circular DNA Molecules θ Bidirectional Replication

20 Replicating Circular DNA Molecules Rolling Circle Replication

21 DNA Replication is Very Fast E. Coli completes replication of its 3.3 Mbp circular genome. Has two growing points so rate is about 690 bp/second. Human chromosome replication rate is ca. 25 bp/second. To complete replication of its 2.9 Gbp genome in a reasonable time it has one origin every 90 kbp.

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini DNA REPLICATION This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. DNA Replication In both

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information

DNA: Structure and Replication

DNA: Structure and Replication 7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Appendix C DNA Replication & Mitosis

Appendix C DNA Replication & Mitosis K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section BCOR 011, Exam 3 Name KEY Section Multiple Choice: Select the best possible answer. 1. A parent cell divides to form two genetically identical daughter cells in the nuclear process of mitosis. For mitosis

More information

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure Chapter 11 DNA replication, repair and recombination Overview Brief introduction DNA replication DNA repair DNA recombination DNA replication is essential for life Introduction Cells divide and make copies

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

List, describe, diagram, and identify the stages of meiosis.

List, describe, diagram, and identify the stages of meiosis. Meiosis and Sexual Life Cycles In this topic we will examine a second type of cell division used by eukaryotic cells: meiosis. In addition, we will see how the 2 types of eukaryotic cell division, mitosis

More information

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why?

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why? Unit 9: DNA, RNA, and Proteins Pig and elephant DNA just don t splice, but why? BONUS - History of DNA Structure of DNA 3.3.1 - Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

4.1 Cell Division and Genetic Material pg The Cell Theory is a central idea to Biology and it evolved in the 1800 s. The Cell Theory States:

4.1 Cell Division and Genetic Material pg The Cell Theory is a central idea to Biology and it evolved in the 1800 s. The Cell Theory States: 4.1 Cell Division and Genetic Material pg. 160 The Cell Theory is a central idea to Biology and it evolved in the 1800 s. The Cell Theory States: 1. All living things are composed of one or more cells.

More information

Asexual Reproduction in Eukaryotes: Mitosis

Asexual Reproduction in Eukaryotes: Mitosis Asexual Reproduction in Eukaryotes: Mitosis The Argentine band The real thing going on inside their cells Nuclear Genomes and Chromosomes Genome size in bp (or kbp or Mbp or Gbp) = C value S. cerevisiae

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair This lecture explores the mechanisms of DNA replication and also the ways in which DNA can repair any replication errors. It also looks at some of the causes of DNA damage and

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

DNA Structure and Replication. Chapter Nine

DNA Structure and Replication. Chapter Nine DNA Structure and Replication Chapter Nine 2005 We know: DNAis the hereditary material DNAhas a double helix structure Made of four bases; A,T,C,G Sugar-Phosphate backbone DNAreplication is semi-conservative

More information

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin.

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

The Process of Cell Division. Lesson Overview. Lesson Overview. Cell Growth and Development

The Process of Cell Division. Lesson Overview. Lesson Overview. Cell Growth and Development Lesson Overview Cell Growth and Development Chromosomes The genetic information that is passed on from one generation of cells to the next is carried by chromosomes. Every cell must copy its genetic information

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information

Mitosis and Cytokinesis

Mitosis and Cytokinesis B-2.6 Summarize the characteristics of the cell cycle: interphase (called G1, S, G2); the phases of mitosis (called prophase, metaphase, anaphase, and telophase); and plant and animal cytokinesis. The

More information

7. 3. replication. Unit 7: Molecular biology and genetics

7. 3. replication. Unit 7: Molecular biology and genetics 7. 3 DN replication he fact that DN is a self-replicating molecule and can make copies of itself is the basis of all life forms. It is the essence of what life is. Indeed, according to Richard Dawkins

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Semiconservative DNA replication. Meselson and Stahl

Semiconservative DNA replication. Meselson and Stahl DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Exercise 1: Q: B.1. Answer Cell A: 2 Q: B.3. Answer (a) Somatic (body). CELL CYCLE, CELL DIVISION AND STRUCTURE OF CHROMOSOME. Cell B: 4 Q: B.

Exercise 1: Q: B.1. Answer Cell A: 2 Q: B.3. Answer (a) Somatic (body). CELL CYCLE, CELL DIVISION AND STRUCTURE OF CHROMOSOME. Cell B: 4 Q: B. CELL CYCLE, CELL DIVISION AND STRUCTURE OF CHROMOSOME Exercise 1: Q: B.1 Cell A: 2 Cell B: 4 Q: B.2 (a) - Metaphase. (b) - Telophase. (c) - Prophase. (d) - Anaphase. Q: B.3 (a) Somatic (body). (b) Four.

More information

Cell Cycle and Mitosis Review

Cell Cycle and Mitosis Review Cell Cycle and Mitosis Review This spot that holds the 2 chromatid copies together is called a The phase of the cell cycle in which cells stop dividing all together. Cell division in bacteria cells is

More information

STUDENT ID NUMBER, LAST NAME,

STUDENT ID NUMBER, LAST NAME, EBIO 1210: General Biology 1 Name Exam 3 June 25, 2013 To receive credit for this exam, you MUST bubble in your STUDENT ID NUMBER, LAST NAME, and FIRST NAME No. 2 pencils only You may keep this exam to

More information

The Structure, Replication, and Chromosomal Organization of DNA

The Structure, Replication, and Chromosomal Organization of DNA Michael Cummings Chapter 8 The Structure, Replication, and Chromosomal Organization of DNA David Reisman University of South Carolina History of DNA Discoveries Friedrich Miescher Isolated nuclein from

More information

Name Date. Meiosis Worksheet

Name Date. Meiosis Worksheet Name Date Meiosis Worksheet Identifying Processes On the lines provided, order the different stages of meiosis I THROUGH meiosis II, including interphase in the proper sequence. 1. homologous chromosome

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Lecture 3 Cell division: mitosis and meiosis

Lecture 3 Cell division: mitosis and meiosis Lecture 3 Cell division: mitosis and meiosis CAMPBELL BIOLOGY Chapter 8 1 The Cell Division Cycle Almost 90% of the cycle is taken up with Interphase during which DNA in the nucleus is replicated Mitosis

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

DNA Structure and Replication

DNA Structure and Replication Why? DNA Structure and Replication How is genetic information stored and copied? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life. For organisms to grow

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

The correct answer is b DNA and protein B. Answer b is correct. When DNA binds with histone proteins it forms chromatin.

The correct answer is b DNA and protein B. Answer b is correct. When DNA binds with histone proteins it forms chromatin. 1. Which of the following is NOT involved in binary fission in prokaryotes? a. Replication of DNA b. Elongation of the cell c. Separation of daughter cells by septum formation d. Assembly of the nuclear

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

growth and tissue repair in multicellular organisms (mitosis)

growth and tissue repair in multicellular organisms (mitosis) Cell division: mitosis and meiosis I. Cell division -- introduction - roles for cell division: reproduction -- unicellular organisms (mitosis) growth and tissue repair in multicellular organisms (mitosis)

More information

Cells, Mitosis-Meiosis, Photosynthesis-Cellular Respiration Notes F

Cells, Mitosis-Meiosis, Photosynthesis-Cellular Respiration Notes F Cells, Mitosis-Meiosis, Photosynthesis-Cellular Respiration Notes F Chromosomes and Mitosis Vocabulary anaphase centromere chromatid chromatin chromosome gene homologous chromosomes metaphase prophase

More information

2. Discrete units of hereditary information consisting of duplicated DNA are called.

2. Discrete units of hereditary information consisting of duplicated DNA are called. LAB TOPIC 7 BSC 2010L (Principles of Biology 1 Laboratory, Professor Chiappone) MITOSIS AND MEIOSIS (Investigating Biology, 7 th edition) PRACTICE QUIZ QUESTIONS 1. DNA is found in structures called. (a)

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Cell cycle & Mitosis. Cellular Organization of the Genetic Material 2016-06- 13

Cell cycle & Mitosis. Cellular Organization of the Genetic Material 2016-06- 13 Cell cycle & Mitosis Review In unicellular organisms, division of one cell reproduces the entire organism Multicellular organisms depend on cell division for Development from a fertilized cell Growth Repair

More information

SELF-PREPARATION FOR THE BIOLOGY ASSESSMENT TEST MODULE 5: MITOSIS AND MEIOSIS

SELF-PREPARATION FOR THE BIOLOGY ASSESSMENT TEST MODULE 5: MITOSIS AND MEIOSIS SELF-PREPARATION FOR THE BIOLOGY ASSESSMENT TEST MODULE 5: MITOSIS AND MEIOSIS Mitosis and meiosis: Two types of eukaryotic cell division According to the Cell Theory, new cells are created by the division

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

This phase of mitosis is? This phase of mitosis is? - This phase of mitosis is? This phase of mitosis is? Graphic source:

This phase of mitosis is? This phase of mitosis is? - This phase of mitosis is? This phase of mitosis is? Graphic source: 1 2 This phase of mitosis is? This phase of mitosis is? - 3 4 This phase of mitosis is? This phase of mitosis is? 5 6 What are the stages of mitosis in chronological order? This phase of mitosis is? -Anaphase,

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Pre-lab Homework Lab 2: Mitosis and the Cell Cycle

Pre-lab Homework Lab 2: Mitosis and the Cell Cycle Pre-lab Homework Lab 2: Mitosis and the Cell Cycle Name: Date/Lab time: 1. Label the figure with the following phases of the cell cycle (note the position of interphase and mitosis): G 1 G 2 S Anaphase

More information

1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes?

1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? Chapter 13: Meiosis and Sexual Life Cycles 1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? 2. Define: gamete zygote meiosis homologous chromosomes diploid haploid

More information

DNA is a double helix with two sugar phosphate backbones and nucleotide bases bridging the two chains.

DNA is a double helix with two sugar phosphate backbones and nucleotide bases bridging the two chains. BENG 100 Frontiers of Biomedical Engineering Professor Mark Saltzman Chapter 3 SUMMARY Nucleic acids are linear polymers made up of monomer units called nucleotides. Each nucleotide is composed of a pentose

More information

K'NEX DNA Models. Developed by Dr. Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine

K'NEX DNA Models. Developed by Dr. Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine KNEX DNA Models Introduction Page 1 of 11 All photos by Kevin Kelliher. To download an Acrobat pdf version of this website Click here. K'NEX DNA Models Developed by Dr. Gary Benson Department of Biomathematical

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Chapter 10 Cell Growth and Division

Chapter 10 Cell Growth and Division Chapter Outline Chapter 10 Cell Growth and Division Section 1: Cell Reproduction KEY IDEAS > Why do cells divide? > How is DNA packaged into the nucleus? > How do cells prepare for division? WHY CELLS

More information

Biology 160 Lab Module 10 Meiosis Activity & Mendelian Genetics

Biology 160 Lab Module 10 Meiosis Activity & Mendelian Genetics Name Biology 160 Lab Module 10 Meiosis Activity & Mendelian Genetics Introduction During your lifetime you have grown from a single celled zygote into an organism made up of trillions of cells. The vast

More information

The Cell Cycle: Interphase, Mitosis and Cytokinesis

The Cell Cycle: Interphase, Mitosis and Cytokinesis The Cell Cycle: Interphase, Mitosis and Cytokinesis Introduction: You should be able to: Define interphase, mitosis and cytokinesis Describe the cell cycle Discuss the events and significance of mitosis.

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes.

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes. Chapter 8 Microbial Genetics Structure and Function of the Genetic Material Chromosomes are cellular structures made up of genes that carry hereditary information. Genetics is the study of how genes carry

More information

Mitosis How do living things grow and repair themselves?

Mitosis How do living things grow and repair themselves? Mitosis How do living things grow and repair themselves? Why? Living things must grow and develop. At times they suffer injuries or damage, or cells simply wear out. New cells must be formed for the living

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

12.1 Identifying the Substance of Genes

12.1 Identifying the Substance of Genes 12.1 Identifying the Substance of Genes Lesson Objectives Summarize the process of bacterial transformation. Describe the role of bacteriophages in identifying genetic material. Identify the role of DNA

More information

Mitosis. How do living things grow and repair themselves? Prophase Metaphase Anaphase Telophase. Centriole

Mitosis. How do living things grow and repair themselves? Prophase Metaphase Anaphase Telophase. Centriole Why? Mitosis How do living things grow and repair themselves? Living things must grow and develop. At times they suffer injuries or damage, or cells simply wear out. New cells must be formed for the organism

More information

LAB EXERCISE: Mitosis and Meiosis

LAB EXERCISE: Mitosis and Meiosis LAB EXERCISE: Mitosis and Meiosis Laboratory Objectives After completing this lab topic, you should be able to: 1. Describe the activities of chromosomes and microtubules in the cell cycle, including all

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

The cell cycle, mitosis and meiosis

The cell cycle, mitosis and meiosis The cell cycle, mitosis and meiosis Learning objective This learning material is about the life cycle of a cell and the series of stages by which genetic materials are duplicated and partitioned to produce

More information

BIOL100 Laboratory Assignment 4: Mitosis and Meiosis. Name:

BIOL100 Laboratory Assignment 4: Mitosis and Meiosis. Name: BIOL100 Laboratory Assignment 4: Mitosis and Meiosis Name: Laboratory Objectives After completing this lab topic, you should be able to: 1. Describe the activities of chromosomes and microtubules in the

More information

A. Homologous chromosomes divide in Meiosis l and sister. B. Homologous chromosomes divide in Meiosis ll and sister

A. Homologous chromosomes divide in Meiosis l and sister. B. Homologous chromosomes divide in Meiosis ll and sister SC.912.L.16.17 1) Somatic cells undergo mitosis whereas gamete cells undergo meiosis. Mitosis takes place throughout the lifetime of an organism. What is the biggest difference between these processes?

More information

Cell Growth and Reproduction Module B, Anchor 1

Cell Growth and Reproduction Module B, Anchor 1 Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients

More information

Chapter 12: The Cell Cycle (Mitosis) Cell division is an integral part of the cell cycle

Chapter 12: The Cell Cycle (Mitosis) Cell division is an integral part of the cell cycle Chapter 12: The Cell Cycle (Mitosis) Cell division is an integral part of the cell cycle Concept 12.1: Cell division results in genetically identical daughter cells Most cell division (mitosis) results

More information

Chapter 12: The Cell Cycle

Chapter 12: The Cell Cycle Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Example 2. What is meant by the cell cycle? Concept 12.1

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle

More information

Workshop: Cellular Reproduction via Mitosis & Meiosis

Workshop: Cellular Reproduction via Mitosis & Meiosis Workshop: Cellular Reproduction via Mitosis & Meiosis Introduction In this workshop you will examine how cells divide, including how they partition their genetic material (DNA) between the two resulting

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

Cell Cycle and Mitosis

Cell Cycle and Mitosis Cell Cycle and Mitosis THE CELL CYCLE The cell cycle, or cell-division cycle, is the series of events that take place in a eukaryotic cell between its formation and the moment it replicates itself. These

More information

Viral Infection: Receptors

Viral Infection: Receptors Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment

More information

Chapter 8 Cell division. Review

Chapter 8 Cell division. Review Chapter 8 Cell division Mitosis/Meiosis Review This spot that holds the 2 chromatid copies together is called a centromere The phase of the cell cycle in which cells stop dividing all together. G 0 Cell

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Mitosis vs. Meiosis. The Somatic Cell Cycle (Mitosis) The somatic cell cycle consists of 3 phases: interphase, m phase, and cytokinesis.

Mitosis vs. Meiosis. The Somatic Cell Cycle (Mitosis) The somatic cell cycle consists of 3 phases: interphase, m phase, and cytokinesis. Mitosis vs. Meiosis In order for organisms to continue growing and/or replace cells that are dead or beyond repair, cells must replicate, or make identical copies of themselves. In order to do this and

More information

Copyright 1999 2003 by Mark Brandt, Ph.D.

Copyright 1999 2003 by Mark Brandt, Ph.D. Central dogma of molecular biology The term central dogma of molecular biology is patterned after religious terminology. owever, it refers to a process that is subject to the changes in understanding that

More information

Guided Notes: Chapter 9 Cellular Reproduction

Guided Notes: Chapter 9 Cellular Reproduction Guided Notes: Cellular Reproduction When do cells divide? Cells grow and function normally until they become too. Cell size is because increases faster than This means that there is not enough area on

More information