Combinatorial CRISPR/Cas9 approaches targeting different steps in the HIV life cycle can prevent the selection of resistance
|
|
- Albert Gibson
- 7 years ago
- Views:
Transcription
1 Combinatorial CRISPR/Cas9 approaches targeting different steps in the HIV life cycle can prevent the selection of resistance Monique Nijhuis, University Medical Center Utrecht, the Netherlands IAS 2016 Towards an HIV Cure Symposium Durban, South Africa
2 Current cart strategies Current cart is designed to efficiently control HIV replication The current arsenal of antiretroviral compounds can neither suppress viral production nor target the viral reservoir Alternative strategies, such as gene editing, are required to permanently disrupt the HIV genome in the cellular reservoir Gene editing tool: RNA-guided CRISPR/Cas9 nuclease
3 grna-guided CRISPR/Cas9 nuclease Repair by the error-prone non-homologous end joining (NHEJ) machinery.
4 Current CRISPR/Cas9 HIV genome editing strategies grnas targeting different regions of the HIV genome have been developed. -inactivate and delete HIV DNA from latently infected cells 1,2,3,4,5 -inhibit short-term HIV replication 2,4 Objective: whether and how HIV might escape from CRISPR/Cas9 targeting single or multiple steps in the viral life cycle. 1 Ebina et al, Sci Rep, 2013; 2Hu et al, PNAS, 2014; 3 Zhu et al, Retrovirology, 2015; 4 Liao et al, Nat Commun, 2015; 5 Kaminski et al, Sci Rep, 2016.
5 grna targeting different HIV genomic regions
6 The effect of single grnas on -Generated T-cells stably expressing single grnas and Cas9 -Infect with HIV and measure protection against infection (day 4) MA3, PR2, IN2 and IN5 provide 97-99% protection against infection RT2 provide 84% protection against infection
7 The effect of single grnas on -Generated T-cells stably expressing single grnas and Cas9 -Long-term infection with HIV reporter virus (luciferase) (n=4) Viral breakthrough/escape variants? -Amplified and deep-sequenced the CRISPR/Cas9 target regions of the viral RNA from the culture supernatants
8 The effect of single grnas on Mutant (indels) Wild type RT2 escape variants Mutant (nucleotide changes) Wild type MA3, PR2, IN5 escape variants
9 The effect of single grnas on -MA3, PR2 and IN5 are very potent inhibitors -Viral escape is very rapid, compare to antiretroviral compounds -Two very recent studies have suggested that NHEJ repair machine may facilitate HIV escape 1,2 -Investigated the nucleotide substitution patterns observed in HIV escape variants
10 The effect of single grnas on Nucleotide substitution patterns in HIV escape variants HIV target gene PR RT IN MA Totaal Samples (n) target sequence ATTAGT AAGGAA GTGCTA GATCGA A-->T A-->C A-->G T-->A 0 0* T-->C 13 0* T-->G 1 0* C-->A 0* 0* C-->T 0* 0* C-->G 0* 0* G-->A G-->T G-->C The cellular error-prone non-homologous end joining (NHEJ) machinery Accelerating viral escape HIV-RT and APOBEC3G * Nucleotide is not present in target site -These observations have questioned the feasibility of the CRISPR/Cas9 based gene-editing approach 1,2 1 Callaway, Nature News, 2016; 2 Liang et al, Retrovirology, 2016.
11 CPE score The effect of two grnas on -Generated T-cells stably expressing two grnas and Cas9 -Long-term infection with HIV reporter virus (luciferase) (n=4) RT2+MA3 RT2+PR2 RT2+IN5 MA3+PR2 MA3-IN5 PR2+IN HIV infection (days)
12 The effect of two grnas on -Generated T-cells stably expressing two grnas and Cas9 -Long-term infection with HIV reporter virus (luciferase) (n=4) -Amplified and deep-sequenced the CRISPR/Cas9 target regions of the viral RNA from the culture supernatants
13 The effect of two grnas on Mutant (indels- nucleotide changes) Wild type RT2 escape variants Mutant (nucleotide changes) Wild type MA3, PR2, IN5 escape variants
14 Concluding remarks -grnas differ in potency to inhibit HIV replication -rapid viral escape is observed to all single grnas -error-prone NHEJ repair mechanism is accelerating viral escape -a combination of two potent grnas can successfully prevent viral replication and escape Gene-editing may provide a future alternative for control of HIV-infection.
15 Acknowledgment Robert Jan Lebbink Emmanuel Wiertz
Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD
Design high specificity CRISPR-Cas9 grnas: principles and tools Heidi Huang, PhD Webinar Agenda 1 2 3 4 Introduction of CRISPR-Cas9 grna Design Resources and Services Q&A 2 What is CRISPR? CRISPR Clustered
More informationNS5B Sequencing and Phenotypic Resistance Assays for HCV Subtypes 1a and 1b
NS5B Sequencing and Phenotypic Resistance Assays for HCV Subtypes 1a and 1b 5th Intl. Workshop on Hepatitis C Resistance & New Compounds Jacqueline Reeves NS5B Resistance Assays for HCV Subtypes 1a and
More informationpcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
More informationSite-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
More informationMATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
More informationTransfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
More informationplaque reduction assay, modified dye uptake assay including formazan test, dye uptake assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
More informationDomain Antivirals tested Test methods for phenotype References. Aciclovir (ACV), Foscarnet (FOS) ACV, FOS ACV,
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
More informationTargets & Tools for anti-hiv Gene Therapy. Paula Cannon, PhD University of Southern California
Targets & Tools for anti-hiv Gene Therapy Paula Cannon, PhD University of Southern California Why is HIV a good candidate for gene therapy It s an incurable, serious, life-long infection It s expensive
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationEngineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram. Project ID: 1 April 2000 to 31 August 2004. Project Duration:
Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram ID: Duration: Coordinator in Switzerland: PS1 1 April 2000 to 31 August 2004 Prof. Thomas Hohn University of Basel Botanisches Institut
More informationGuidance for Industry Role of HIV Resistance Testing in Antiretroviral Drug Development
Guidance for Industry Role of HIV Resistance Testing in Antiretroviral Drug Development U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation and Research
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationAktuell HIV-forskning 2014-05-06
Aktuell HIV-forskning 2014-05-06 Alexey Kashpersky Aktuell HIV-forskning Bot Smittsamhet Nya läkemedel HIV och åldrande Etc HPTN 052 Prevention Conclusion Early ART that suppresses viral replication led
More informationGenetic Engineering in Plants and the New Breeding Techniques (NBTs) Inherent risks and the need to regulate. Dr. Ricarda A.
info@econexus.info www.econexus.info Briefing December 2015 Genetic Engineering in Plants and the New Breeding Techniques (NBTs) Inherent risks and the need to regulate Dr. Ricarda A. Steinbrecher Summary
More informationGenome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS
Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing: Tools to Support CRISPR/Cas9 Applications Genome editing is enabled by the development of tools to make precise, targeted changes
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationJuly 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationRoutine HIV Monitoring
Routine HIV Monitoring Guideline of the HIV/AIDS Division at San Francisco General Hospital Statement of Guideline: Patients will be routinely evaluated and monitored for HIV parameters, antiretroviral
More informationHENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,
More informationSuggested Reporting Language for the HIV Laboratory Diagnostic Testing Algorithm
Suggested Reporting Language for the HIV Laboratory Diagnostic Testing Algorithm November 2013 Introduction In March 2010, the Centers for Disease Control and Prevention (CDC) and the Association of Public
More informationLabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes hi@labgeni.us V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
More informationAllogeneic stem cell transplant in HIV-1-infected individuals
Allogeneic stem cell transplant in HIV-1-infected individuals Javier Martinez-Picado UNIVERSITAT DE VIC Barriers to cure HIV infection Residual Replication Immune activation Inflammation Latent Infection
More informationComparative Drug Ranking for Clinical Decision Support in HIV Treatment
Comparative Drug Ranking for Clinical Decision Support in HIV Treatment Emiliano Mancini University of Amsterdam 1 Prevalence of HIV 2 Global Overview HIV Infection People living with HIV: 34 million (2010
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More informationescience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
More informationSwitch to Dolutegravir plus Rilpivirine dual therapy in cart-experienced Subjects: an Italian cohort
Switch to Dolutegravir plus Rilpivirine dual therapy in cart-experienced Subjects: an Italian cohort Gaetana Sterrantino Azienda Ospedaliero-Universitaria Careggi Infectious diseases, Florence, Italy Background
More informationProspects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS
Prospects for Vaccines against Hepatitis C Viruses T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS HCV Vaccine Prevention strategies Protective immunity Barriers and solutions Vaccine candidates
More informationMeasuring the HIV Reservoir BINGO Review Activity
Measuring the HIV Reservoir BINGO Review Activity Objectives Describe the differences in current technologies available for measuring the HIV reservoir Discuss the risk and benefit of each technology Methods
More informationTOWARDS AN HIV VACCINE
why is it so hard to make an HIV vaccine and where are we now? Neal Nathanson, MD Emeritus Professor Department of Microbiology University of Pennsylvania School of Medicine 1 Estimated number of persons
More informationRobert G. Knodell, M.D. Maryland Chapter, American College of Physicians Fb February 3, 2012
Treatment of Hepatitis C:Present and Future Robert G. Knodell, M.D. Scientific Meeting Maryland Chapter, American College of Physicians Fb February 3, 2012 Presentation Objectives Appreciate the Public
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationCytoreductive Therapy for Autologous Cell Therapy in HIV
Cytoreductive Therapy for Autologous Cell Therapy in HIV Ronald Mitsuyasu, MD Professor of Medicine UCLA Center for Clinical AIDS Research and Education (CARE Center) HSC Transfer from CCR5-delta 32 Donor
More informationThe role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015
The role of IBV proteins in protection: cellular immune responses COST meeting WG2 + WG3 Budapest, Hungary, 2015 1 Presentation include: Laboratory results Literature summary Role of T cells in response
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationProduct: Expression Arrest TM egfp control shrna vector
Product: Expression Arrest TM egfp control vector Catalog #: RHS1702 Product Description The laboratory of Dr. Greg Hannon at Cold Spring Harbor Laboratory (CSHL) has created an RNAi Clone Library comprised
More informationbitter is de pil Linos Vandekerckhove, MD, PhD
4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV
More informationBCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
More informationTranslating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga. Jorge S Reis-Filho, MD PhD FRCPath
Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga Jorge S Reis-Filho, MD PhD FRCPath Summary How do PARP inhibitors work? Synthetic lethality Potential
More informationPoster # 42 Resistance in PBMCs Can Predict Virological Rebound after Therapy Switch in cart- Treated Patients with Undetectable HIV-RNA
Poster # 42 Resistance in PBMCs Can Predict Virological Rebound after Therapy Switch in cart- Treated Patients with Undetectable HIV-RNA D Armenia 1, M Zaccarelli 2, V Borghi 3, W Gennari 3, A Giannetti
More informationGenetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
More informationRapid HCP5 single-nucleotide polymorphism genotyping: a simple allele-specific PCR method for prediction of hypersensitivity reaction to Abacavir.
A simple allele-specific polymerase chain reaction method to detect the Gly143Glu polymorphism in the human carboxylesterase 1 gene: importance of genotyping for pharmacogenetic treatment. Walter Soria
More informationPage 1/.. USA / Canada - South Africa Schedule No. 4 / 2011-Jan-24
USA / Canada South Africa Schedule No. 4 / 2011Jan24 Page 1/.. USA / Canada South Africa Schedule No. 4 / 2011Jan24 Page 2/.. USA / Canada South Africa Schedule No. 4 / 2011Jan24 Page 3/.. USA / Canada
More informationLessons from the Stanford HIV Drug Resistance Database
1 Lessons from the Stanford HIV Drug Resistance Database Bob Shafer, MD Department of Medicine and by Courtesy Pathology (Infectious Diseases) Stanford University Outline 2 Goals and rationale for HIVDB
More informationViral Safety of Plasma-Derived Products
Viral Safety of Plasma-Derived Products SLIDE 1 This presentation will cover viral validation studies for plasma-derived products. FDA requires that the manufacturing process for biopharmaceutical products
More informationChapter 36. Media Directory. Characteristics of Viruses. Primitive Structure of Viruses. Therapy for Viral Infections. Drugs for Viral Infections
Chapter 36 Media Directory Drugs for Viral Infections Slide 23 Slide 27 Slide 29 Zidovudine Animation Saquinavir Mesylate Animation Acyclovir Animation Upper Saddle River, New Jersey 07458 All rights reserved.
More informationHierarchical Bayesian Modeling of the HIV Response to Therapy
Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and
More informationThe Basics of Drug Resistance:
CONTACT: Lisa Rossi +1-412-641-8940 +1-412- 916-3315 (mobile) rossil@upmc.edu The Basics of Drug Resistance: QUESTIONS AND ANSWERS HIV Drug Resistance and ARV-Based Prevention 1. What is drug resistance?
More informationLECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
More informationHIV Drug resistanceimplications
HIV Drug resistanceimplications for therapy Deenan Pillay Africa Centre for Health and Population Studies, UKZN University College London Potential implications of HAART without virological monitoring:
More information(odigie.madeline@gmail.com), Wheaton College, Norton, MA 02766, USA 2
Interaction of HIV and the human innate immune system: Human Apolipoprotein B mrna-editing Enzyme-catalytic Polypeptide-like 3G (APOBEC3G) alteration effect on HIV virus DNA sequence Madeline Odigie 1
More informationOriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More informationViral Infection: Receptors
Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment
More informationVarious Viral Vectors Necessary for Gene Therapy Delivery Systems. Abstract
Patibandla 1 Yamini Patibandla Dr. Rance LeFebvre COSMOS UC Davis Cluster 7 29 July 2013 Various Viral Vectors Necessary for Gene Therapy Delivery Systems Abstract A leading movement in today s times,
More informationMolecular Diagnosis of Hepatitis B and Hepatitis D infections
Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication
More informationWhat is HIV? What is AIDS? The HIV pandemic HIV transmission Window period Stages of HIV infection
Module 1 Overview of HIV Infection Purpose Pre-requisite Modules Learning Objectives To provide you with the basic terms and concepts related to HIV infection. None At the end of this module, you will
More informationGuidance for Industry Antiviral Product Development Conducting and Submitting Virology Studies to the Agency
Guidance for Industry Antiviral Product Development Conducting and Submitting Virology Studies to the Agency U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation
More informationmrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationLiver Disease and Therapy of Hepatitis B Virus Infections
Liver Disease and Therapy of Hepatitis B Virus Infections University of Adelaide Catherine Scougall Arend Grosse Huey-Chi Low Allison Jilbert Fox Chase Cancer Center Chunxiao Xu Carol Aldrich Sam Litwin
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationHow To Understand The Biology Of Hiv 1
Réservoirs VIH : du contrôle à l'éradication Asier Sáez-Cirión, PhD Unité de Régulation des Infections Rétrovirales M. Coiras et al Nat Rev Micro 2009 HIV-1 life cycle and latency HIV-1 life cycle and
More informationCTSHIV: A Knowledge-Based System For the Management of. HIV-infected Patients. Introduction. or Anaerobic, etc.) and recommends a treatment
CTSHIV: A Knowledge-Based System For the Management of HIV-infected Patients Michael Pazzani Ranjit Iyer Darryl See Edison Schroeder Jeremiah Tilles Department of Information & Computer Science Department
More informationViral Replication. Viral Replication: Basic Concepts
Viral Replication Scott M. Hammer, M.D. Viral Replication: Basic Concepts Viruses are obligate intracellular parasites Viruses carry their genome (RNA or DNA) and sometimes functional proteins required
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationBig Data in Drug Discovery
Big Data in Drug Discovery David J. Wild Assistant Professor & Director, Cheminformatics Program Indiana University School of Informatics and Computing djwild@indiana.edu - http://djwild.info Epochs in
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationHow Cancer Begins???????? Chithra Manikandan Nov 2009
Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationPART 3.3: MicroRNA and Cancer
BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway
More informationMicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
More informationUnderstanding West Nile Virus Infection
Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationRecommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010
Recommended Procedures for the Extraction of RNA Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 RNA Extraction Isolates RNA from other cellular components in the
More information4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
More informationUsing HIV Surveillance Data to Calculate Measures for the Continuum of HIV Care
Using HIV Surveillance Data to Calculate Measures for the Continuum of HIV Care Anna Satcher Johnson, MPH Symposium on Measuring the HIV Care Continuum Center for AIDS Research University of Washington
More informationPediatric HIV - The World At It's Best
VIH/SIDA en Pediatría: Epidemiología Mundial, Transmisión Perinatal, Manejo Integral. Juan Carlos Salazar, M.D. Universidad de Connecticut, EE.UU. End-1998 global estimates Children (
More informationHIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2
HIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2 1 Tata Consultancy Services, India derahul@ieee.org 2 Bangalore University, India ABSTRACT
More informationFAQs: Gene drives - - What is a gene drive?
FAQs: Gene drives - - What is a gene drive? During normal sexual reproduction, each of the two versions of a given gene has a 50 percent chance of being inherited by a particular offspring (Fig 1A). Gene
More informationWHO/HIVRESNET HIV DRUG RESISTANCE LABORATORY STRATEGY
WHO/HIVRESNET HIV DRUG RESISTANCE LABORATORY STRATEGY JULY, 2010 1 Table of Contents Abbreviations... 4 1. WHO/HIVResNet Global HIV Drug Resistance Strategy... 5 1.1. NATIONAL HIVDR WORKING GROUP...6 1.2.
More informationExploiting science for engineering: BRCA2 targeted therapies
20.109 MOD1 DNA ENGINEERING Fall 2010 Exploiting science for engineering: BRCA2 targeted therapies Orsi Kiraly Engelward lab Homologous recombination is important No HR chromosomal aberrations cell death
More informationSYMPOSIUM. June 15, 2013. Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Boston University
SYMPOSIUM June 15, 2013 Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Bette Korber Los Alamos National Labs HIV evolution and the neutralizing antibody response We have recently
More informationHIV Cure Scientific Committee: Update and Next Steps. Deborah Persaud, MD (Chair) Ellen G. Chadwick, MD (Vice-Chair) June 19 th, 2014
HIV Cure Scientific Committee: Update and Next Steps Deborah Persaud, MD (Chair) Ellen G. Chadwick, MD (Vice-Chair) June 19 th, 2014 Background Combination antiretroviral treatment does not eradicate HIV
More informationThe autophagy machinery is required to initiate hepatitis C virus infection. Marlène Dreux
The autophagy machinery is required to initiate hepatitis C virus infection Marlène Dreux Hepatitis C virus life cycle HCV particles internalization RNA replication RNA translation ER HCV assembly and
More informationData deluge (and it s applications) Gianluigi Zanetti. Data deluge. (and its applications) Gianluigi Zanetti
Data deluge (and its applications) Prologue Data is becoming cheaper and cheaper to produce and store Driving mechanism is parallelism on sensors, storage, computing Data directly produced are complex
More informationTesting for HIV Drug Resistance
State of the Art Testing for HIV Drug Resistance Victor S.B. Jorden, MD, MPH Sindy M. Paul, MD, MPH Today, many patients with HIV infection are able to live longer and better lives, owing to the use of
More informationChapter 20: Antimicrobial Drugs
Chapter 20: Antimicrobial Drugs 1. Overview of Antimicrobial Drugs 2. Antibacterial Drugs 3. Antiviral Drugs 4. Drugs for Eukaryotic Pathogens 1. Overview of Antimicrobial Drugs Antibiotics An antibiotic
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationCas-Database: Web-based genome-wide guide RNA library design for gene knockout screens using CRISPR-Cas9
Bioinformatics Advance Access published February 24, 2016 Databases and ontologies Cas-Database: Web-based genome-wide guide RNA library design for gene knockout screens using CRISPR-Cas9 Jeongbin Park
More informationCombination Anti-Retroviral Therapy (CART) - Rationale and Recommendation. M Dinaker. Fig.1: Effect of CART on CD4 and viral load
Combination Anti-Retroviral Therapy (CART) - Rationale and Recommendation M Dinaker INTRODUCTION The wide availability of effective, safe and mostly well tolerated combined anti-retroviral therapy (CART)
More informationAntiretroviral Drugs in the Treatment and Prevention of HIV Infection
Antiretroviral Drugs in the Treatment and Prevention of HIV Infection Noga Shalev, MD Uses of Antiretroviral Agents Treatment of chronic HIV infection Prevention of mother-to-child transmission [PMTCT]
More informationHBV screening and management in HIV-infected children and adolescents
HBV screening and management in HIV-infected children and adolescents Linda Aurpibul M.D. Research Institute for Health Sciences, Chiang Mai University 8% HIV and Hepatitis B Co-infection Among Perinatally
More informationGENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
More informationThe Effects of Cycling on Drug Resistance HIV
The Effects of Cycling on Drug Resistance HIV Aaron Abromowitz 1, Andre Robinson 2 Walter Chambliss 3, Emmanuel J. Morales-Butler 4, Anuj Mubayi 5, Xiaohong Wang 5, Abdessemad Tridane 5 1 Department of
More informationHuman Immunodeficiency Virus-1 Infection: Developing Antiretroviral Drugs for Treatment Guidance for Industry
Human Immunodeficiency Virus-1 Infection: Developing Antiretroviral Drugs for Treatment Guidance for Industry U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation
More informationEuropean Recommendations for the Clinical Use of HIV Drug Resistance Testing: 2011 Update
AIDS Rev. 2011;13:77-108 Anne-Mieke Vandamme, et al.: European HIV Drug Resistance Guidelines European Recommendations for the Clinical Use of HIV Drug Resistance Testing: 2011 Update Anne-Mieke Vandamme
More information