Beloit College BIOL Emerging Infectious Diseases

Size: px
Start display at page:

Download "Beloit College BIOL Emerging Infectious Diseases"

Transcription

1 Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning that it absolutely must be inside a cell in order for it to replicate. Without a host cell, the virus cannot make more copies of itself, as it does not have the proteins and enzymes that do the work of copying the genetic material and proteins that make up a virus. All viruses have a minimum structural requirement of a nucleic acid (genetic material) surrounded by a protein coat, called a capsid. Some viruses have an additional lipid layer surrounding the protein coat, called an envelope. The proteins on the outside of the virus bind to the target host cell and allow the virus to enter the cell. Once it has entered the cell, the virus hijacks the host cell s nucleic acid replication and protein synthesis machinery. The host cell turns into a virus-making factory. DNA and RNA are the two types of nucleic acids (genetic information storage molecules). The central dogma states that the genetic information stored in DNA is transcribed into RNA, and the information stored in RNA is translated into an amino acid code to make proteins (DNA -> RNA -> Protein). Unlike prokaryotes and eukaryotes that store their genetic information as DNA (which is then transcribed into RNA and translated into proteins), viruses can carry their genetic information as DNA or RNA. The major differences between DNA and RNA viruses are in how the host cell processes the genetic information. Though there are minor variations based on a virus s biology, most viruses will undergo similar replication processes in the host cell. To complete its life cycle (i.e. to make more copies of itself), a virus must first bind to the cell surface and gain entry. Once inside, the protein coat is removed in a step called uncoating. This releases the nucleic acids that can then be copied and used to make more protein coats using the host cell s DNA and RNA replication and protein synthesis machinery. The new copies of the nucleic acid and the new protein coats are assembled into new viral particles inside the host cell. In the final step of a viral life cycle, the mature virus is released from the host cell, to go on to infect new hosts. You will be given a virus to analyze. You will uncoat your virus and determine which type of virus it is according to the type of nucleic acid present in the capsid. Then, you will construct a flowchart or diagram of how the host cell will process the nucleic acid to make the protein for the capsid and how the host cell will replicate the nucleic acid. The host cell must process the viral genetic information for two purposes related to viral replication: to produce proteins based on the genetic information from the virus, and to replicate the nucleic acid sequence. Because the virus can only use the host cell machinery to make copies of itself, viral nucleic acid replication and viral protein synthesis must abide by the same set of rules as the host cell. 1) To make viral proteins, the viral nucleic acid must be in a form that the host cell can recognize. According to the central dogma, the cell can only translate RNA sequences into protein. 1 of 4

2 2) The cell reads RNA sequences in sets of 3 nucleotides, called codons. The host cell will only start translation when a start codon (the sequence AUG) is present. The viral nucleic acid must use the same codons for the same amino acids as the host cell. 3) Nucleic acid replication requires a template strand. The strand is read by an enzyme in the cell that will match A to T (or A to U) and G to C. The template strand (A) therefore sets the sequence of the new strand, but the new strand does not have the same sequence as the template strand (A). At the same time, the new strand can be used as another template strand (B) to recreate the original template strand (A) sequence. 4) The final viruses are made of proteins that are coded within the viral nucleic acid sequence and new copies of the viral nucleic acids that are in the same form (DNA or RNA, single-stranded or double-stranded) as the original virus. The following viruses are represented in this activity: virus Hepatitis C Measles Parvovirus B19 Rotavirus nucleic acid positive-strand ssrna negative-strand ssrna ssdna dsrna Variola The Genetic Code dsdna 2 of 4

3 Viral Classification Activity - To be turned in by the end of class today 1. Write your virus number here: 2. Does your virus have an envelope? 3. Is this a single-stranded or double-stranded virus? 4. Is this a DNA or RNA virus? DNA sequences are made up of Adenine, Guanine, Cytosine, and Thymine. RNA sequences are made up of Adenine, Guanine, Cytosine, and Uracil. 5. From your nucleic acid sequence and the genetic code table above, identify the RNA coding sequence (i.e. the RNA sequence that will be translated to protein) for the first 5 amino acids of your capsid protein. Write this positive-sense sequence below: 6. If you have an RNA virus, is it positive-sense (the same sequence used for translation to protein) or negative sense (the complimentary sequence)? 7. Based on the nucleic acid present in your virus, which of the 5 viruses did you get? 8. Below, draw a diagram that shows how the sequence of your virus is used to express viral proteins. Remember that proteins can only be synthesized in the host cell using an RNA template, so be sure to explain how your nucleic acid is turned into the correct RNA sequence if necessary. 3 of 4

4 9. Draw a diagram that shows how the viral nucleic acid is used to produce new copies of the viral nucleic acid to be packaged into new virions. Be sure that your final sequence and nucleic acid structure are exactly the same as what you found in your original viral particle. Remember that you can only synthesize new nucleic acid sequences with a template 10. After identifying your virus based on the type of nucleic acid it carries, complete the virus life cycle chart for your virus. On the back of your chart, gather the life cycle information for another virus from another group. Turn this chart in at the beginning of the next class. 4 of 4

5 Variola Virus dsdna ATG CTA CGA GTA CGG ACA CTG CTT ATA CTT TGC ACC TTT GTA GTG ATT TGA TAC GAT GCT CAT GCC TGT GAC GAA TAT GAA ACG TGG CCC CAT CAC TAA ACT M L R V R T L L I L C T F V V I stop Parvovirus B19 ssdna ATG CCG CCG GTC GCC GCC GGT AGG CGG GAC TTC CGG TAC AAG ATG GCG GAC TGA M P P V A A G R R D T R Y K M S D stop Rotavirus dsrna AUG GCG AGU CUG AUA UAC CGG CAG CUA UUA ACA AAC UCG UAC ACU GUG GAU UGA UAC CGC UCA GAC UAU UAG GCC GUC GAU AAU UGU UUG AGC AUG UGA CAC GUA ACU M A S L I Y R Q L L T N S Y T V D stop Hepatitis C virus (+)ssrna AUG AGU ACA AAC CCU AAG CCU CAG CGU AAA ACU AAA CGG AAU ACU AAU CGU UGA M S T N P K P Q R K T K R N T N R stop Measles Virus (-)ssrna AUG AGU CCU CAG AGG GAU AGA AUC AAU GCU UUC UAU AAA GAC AAU CCU CAU UGA UAC UCA GGA GUC UCC CUA UCU UAG UUA CGA AAG AUA UUU CUG UUA GGA GUA ACU M S P Q R D R I N A F Y K D N P H stop

6 Virus 9 ATG CTA CGA GTA CGG ACA CTG CTT ATA CTT TGC ACC TTT GTA GTG ATT TGA TAC GAT GCT CAT GCC TGT GAC GAA TAT GAA ACG TGG CCC CAT CAC TAA ACT M L R V R T L L I L C T F V V I stop Virus 28 ATG CTA CGA GTA CGG ACA CTG CTT ATA CTT TGC ACC TTT GTA GTG ATT TGA TAC GAT GCT CAT GCC TGT GAC GAA TAT GAA ACG TGG CCC CAT CAC TAA ACT M L R V R T L L I L C T F V V I stop Virus 49 ATG CTA CGA GTA CGG ACA CTG CTT ATA CTT TGC ACC TTT GTA GTG ATT TGA TAC GAT GCT CAT GCC TGT GAC GAA TAT GAA ACG TGG CCC CAT CAC TAA ACT M L R V R T L L I L C T F V V I stop Virus 87 ATG CTA CGA GTA CGG ACA CTG CTT ATA CTT TGC ACC TTT GTA GTG ATT TGA TAC GAT GCT CAT GCC TGT GAC GAA TAT GAA ACG TGG CCC CAT CAC TAA ACT M L R V R T L L I L C T F V V I stop Virus 96 ATG CTA CGA GTA CGG ACA CTG CTT ATA CTT TGC ACC TTT GTA GTG ATT TGA TAC GAT GCT CAT GCC TGT GAC GAA TAT GAA ACG TGG CCC CAT CAC TAA ACT M L R V R T L L I L C T F V V I stop

7 Virus 44 ATG CCG CCG GTC GCC GCC GGT AGG CGG GAC TTC CGG TAC AAG ATG GCG GAC TGA M P P V A A G R R D T R Y K M S D stop Virus 51 ATG CCG CCG GTC GCC GCC GGT AGG CGG GAC TTC CGG TAC AAG ATG GCG GAC TGA M P P V A A G R R D T R Y K M S D stop Virus 55 ATG CCG CCG GTC GCC GCC GGT AGG CGG GAC TTC CGG TAC AAG ATG GCG GAC TGA M P P V A A G R R D T R Y K M S D stop Virus 64 ATG CCG CCG GTC GCC GCC GGT AGG CGG GAC TTC CGG TAC AAG ATG GCG GAC TGA M P P V A A G R R D T R Y K M S D stop Virus 91 ATG CCG CCG GTC GCC GCC GGT AGG CGG GAC TTC CGG TAC AAG ATG GCG GAC TGA M P P V A A G R R D T R Y K M S D stop

8 Virus 1 AUG GCG AGU CUG AUA UAC CGG CAG CUA UUA ACA AAC UCG UAC ACU GUG GAU UGA UAC CGC UCA GAC UAU UAG GCC GUC GAU AAU UGU UUG AGC AUG UGA CAC GUA ACU M A S L I Y R Q L L T N S Y T V D stop Virus 5 AUG GCG AGU CUG AUA UAC CGG CAG CUA UUA ACA AAC UCG UAC ACU GUG GAU UGA UAC CGC UCA GAC UAU UAG GCC GUC GAU AAU UGU UUG AGC AUG UGA CAC GUA ACU M A S L I Y R Q L L T N S Y T V D stop Virus 24 AUG GCG AGU CUG AUA UAC CGG CAG CUA UUA ACA AAC UCG UAC ACU GUG GAU UGA UAC CGC UCA GAC UAU UAG GCC GUC GAU AAU UGU UUG AGC AUG UGA CAC GUA ACU M A S L I Y R Q L L T N S Y T V D stop Virus 38 AUG GCG AGU CUG AUA UAC CGG CAG CUA UUA ACA AAC UCG UAC ACU GUG GAU UGA UAC CGC UCA GAC UAU UAG GCC GUC GAU AAU UGU UUG AGC AUG UGA CAC GUA ACU M A S L I Y R Q L L T N S Y T V D stop Virus 66 AUG GCG AGU CUG AUA UAC CGG CAG CUA UUA ACA AAC UCG UAC ACU GUG GAU UGA UAC CGC UCA GAC UAU UAG GCC GUC GAU AAU UGU UUG AGC AUG UGA CAC GUA ACU M A S L I Y R Q L L T N S Y T V D stop

9 Virus 21 AUG AGU ACA AAC CCU AAG CCU CAG CGU AAA ACU AAA CGG AAU ACU AAU CGU UGA M S T N P K P Q R K T K R N T N R stop Virus 22 AUG AGU ACA AAC CCU AAG CCU CAG CGU AAA ACU AAA CGG AAU ACU AAU CGU UGA M S T N P K P Q R K T K R N T N R stop Virus 32 AUG AGU ACA AAC CCU AAG CCU CAG CGU AAA ACU AAA CGG AAU ACU AAU CGU UGA M S T N P K P Q R K T K R N T N R stop Virus 57 AUG AGU ACA AAC CCU AAG CCU CAG CGU AAA ACU AAA CGG AAU ACU AAU CGU UGA M S T N P K P Q R K T K R N T N R stop Virus 77 AUG AGU ACA AAC CCU AAG CCU CAG CGU AAA ACU AAA CGG AAU ACU AAU CGU UGA M S T N P K P Q R K T K R N T N R stop

10 Virus 17 UAC UCA GGA GUC UCC CUA UCU UAG UUA CGA AAG AUA UUU CUG UUA GGA GUA ACU Virus 19 M S P Q R D R I N A F Y K D N P H stop UAC UCA GGA GUC UCC CUA UCU UAG UUA CGA AAG AUA UUU CUG UUA GGA GUA ACU Virus 75 M S P Q R D R I N A F Y K D N P H stop UAC UCA GGA GUC UCC CUA UCU UAG UUA CGA AAG AUA UUU CUG UUA GGA GUA ACU Virus 81 M S P Q R D R I N A F Y K D N P H stop UAC UCA GGA GUC UCC CUA UCU UAG UUA CGA AAG AUA UUU CUG UUA GGA GUA ACU Virus 84 M S P Q R D R I N A F Y K D N P H stop UAC UCA GGA GUC UCC CUA UCU UAG UUA CGA AAG AUA UUU CUG UUA GGA GUA ACU M S P Q R D R I N A F Y K D N P H stop

11 Particle # Virus Type Particle # Virus Type 1 1 rotavirus 21 hepatitis C 2 5 rotavirus 22 hepatitis C 3 9 variola 32 hepatitis C 4 17 measles 57 hepatitis C 5 19 measles 77 hepatitis C 6 21 hepatitis C 17 measles 7 22 hepatitis C 19 measles 8 24 rotavirus 75 measles 9 28 variola 81 measles hepatitis C 84 measles rotavirus 44 parvovirus parvovirus 51 parvovirus variola 55 parvovirus parvovirus 64 parvovirus parvovirus 91 parvovirus hepatitis C 1 rotavirus parvovirus 5 rotavirus rotavirus 24 rotavirus measles 38 rotavirus hepatitis C 66 rotavirus measles 9 variola measles 28 variola variola 49 variola parvovirus 87 variola variola 96 variola

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

der Strukturbiologie

der Strukturbiologie Einführung Aspekte der in Thermodynamik die Bioinformatik in der Strukturbiologie Wintersemester 2012/13 16:00-16:45 Hörsaal N100 B3 Peter Güntert Literatur Jean-Michel Claverie, Cedric Notredame: Bioinformatics

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find

More information

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

1. Overview of Animal Viruses

1. Overview of Animal Viruses Chapter 13B: Animal Viruses 1. Overview of Animal Viruses 2. DNA Viruses 3. RNA Viruses 4. Prions 1. Overview of Animal Viruses Life Cycle of Animal Viruses The basic life cycle stages of animal viruses

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Viral Replication. I. Steps in Viral Replication. Scott M. Hammer

Viral Replication. I. Steps in Viral Replication. Scott M. Hammer Scott M. Hammer Viral Replication I. Steps in Viral Replication A. Attachment. This is the first step in viral replication. Surface proteins of the virus interact with specific receptors on the target

More information

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC ML ENGMAN, MD Vice President and Chief Medical Director BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE UNDERWRITING SLEEP

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT Statistical Analysis of codon usage in extremely halophilic bacterium, Salinibacter ruber DSM 13855 Sanjukta RK 1, Farooqi MS 1*, Sharma N 1, Rai N 2, Mishra DC 1, Rai A 1, Singh DP 3 and Chaturvedi KK

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts

LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts 4 Using Bioinformatics to Analyze Protein Sequences Introduction In this lesson, students perform a paper exercise designed to reinforce the student understanding of the complementary nature of DNA and

More information

GENETIC CODING. A mathematician considers the problem of how genetic information is encoded for transmission from parent to offspring,.

GENETIC CODING. A mathematician considers the problem of how genetic information is encoded for transmission from parent to offspring,. ENGINEERING AND SCIENCE April 1962, Volume XXV, No. 7 GENETIC CODING A mathematician considers the problem of how genetic information is encoded for transmission from parent to offspring,. by Solomon W.

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

CHALLENGES IN THE HUMAN GENOME PROJECT

CHALLENGES IN THE HUMAN GENOME PROJECT REPRINT: originally published as: Robbins, R. J., 1992. Challenges in the human genome project. IEEE Engineering in Biology and Medicine, (March 1992):25 34. CHALLENGES IN THE HUMAN GENOME PROJECT PROGRESS

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

Sean Carroll.

Sean Carroll. Sean Carroll http://www.molbio.wisc.edu/carroll/teaching.html sbcarrol@wisc.edu 1 Suggestions for doing well Come to class! Read the assignment before lecture Stay current with problems Seek help if needed

More information

Codon Usage Bias and Determining Forces in Taenia solium Genome

Codon Usage Bias and Determining Forces in Taenia solium Genome ISSN (Print) 23-41 ISSN (Online) 1738-6 ORIGINAL ARTICLE Korean J Parasitol Vol. 53, No. 6: 689-697, December 215 http://dx.doi.org/1.3347/kjp.215.53.6.689 Codon Usage Bias and Determining Forces in Taenia

More information

2. The term gene is coined by 1) Johanson 2) T H Morgan 3) G.J.Mendel 4) Carl Correns

2. The term gene is coined by 1) Johanson 2) T H Morgan 3) G.J.Mendel 4) Carl Correns MOLECULAR BIOLOGY GENE AND GENE CONCEPT 1. Generally a gene is 1) a part of DNA 2) a protein 3) DNA + protein 4) a part of RNA 2. The term gene is coined by 1) Johanson 2) T H Morgan 3) G.J.Mendel 4) Carl

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT. Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m.

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT. Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m. LIVING ENVIRONMENT The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m., only Student Name School Name Notice...

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Basic Characteristics of Cells. Cell Structure and Function. Each Cell Has Three Primary Regions. Basic Characteristics of Cells. The Plasma Membrane

Basic Characteristics of Cells. Cell Structure and Function. Each Cell Has Three Primary Regions. Basic Characteristics of Cells. The Plasma Membrane Basic Characteristics of Cells Cell Structure and Function Chapter 3 Smallest living subdivision of the human body Diverse in structure and function Small Basic Characteristics of Cells Each Cell Has Three

More information

Math 30-1: Permutations and Combinations PRACTICE EXAM

Math 30-1: Permutations and Combinations PRACTICE EXAM A. B. C. D. Math 30-1: Permutations and Combinations PRACTICE EXAM n! 1. The expression is equivalent to: (n - 2)! 2. A Grade 12 student is taking Biology, English, Math, and Physics in her first term.

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

On the evolution of codon usage bias

On the evolution of codon usage bias University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2011 On the evolution of codon usage bias Premal R. Shah allmaya@gmail.com Recommended

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information