Next Generation Sequencing data Analysis at Genoscope

Size: px
Start display at page:

Download "Next Generation Sequencing data Analysis at Genoscope"

Transcription

1 Next Generation Sequencing data Analysis at Genoscope

2 Genoscope (National Sequencing center) Among the largest sequencing center in Europe Part of the CEA Institut de Génomique since 05/2007 Provide high-throughput sequencing data to the French Academic community, and carry out in-house genomic projects Involved in large genome projects : human genome project, arabidopsis, rice, Coordination of large genome projects : tetraodon, paramecium, vitis, oikopleura, and as well fungal genomes (botrytis, tuber) and prokaryotic genomes

3 Genoscope (National Sequencing center) Sequencing capacity : 4 ABI /Roche Titanium 3 Illumina GAIIx 3 Illumina HiSeq 2000 Linux AMD x86 64 bits 46 serveurs totalisant 348 CPUs : 13 serveurs à 4 coeurs/machine (16Go) 31 serveurs à 8 cœurs:machine (64Go) 1 serveur à 16 cœurs (256Go) 1 serveur à 32 cœurs (1To) Utilisation du CCRT (CEA) : Cluster Hybride Bull cœurs Intel et cœurs nvidia

4 Sequencing technologies 454 / Roche Genome Sequence FLX Gs20 20Mb / run 100bp / read GSFLX Standard 100Mb / run 250bp / read GSFLX Titanium 500Mb / run 500bp / read GSFLX+ Titanium 750Mb / run 700bp / read Actual version (GSFLX Titanium) : Majority of 500bp reads Around reads / run and 500Mbp / run Run duration : 8h High error rate in homopolymer sequences Good assemblies at 20X of coverage No cloning biases

5 Sequencing technologies Illumina / Solexa Genetic Analyzer GA 1 1Gb / run 32bp / read GA II 8Gb / run 50bp / read Paired reads GA IIx 90 Gb / run 150bp / read 14 days / run Paired reads and mate pairs Hi-Seq Gb / run 100bp / read 8 days / run Paired reads and mate pairs Actual version (HiSeq 2000): Reads of 101bp Around 6000M reads / run and 600Gbp / run 8 days / run very low error rate (70% of perfect reads) No indels => good complementarity with the 454 technology No coverage gaps Price

6 A reference genome for NGS tests GC% = % repetitive DNA Manually finished sequence

7 Data quality and sequencers performance 454 / Roche Genome Sequence FLX Test a new sequencing technology on a wellknown bacteria : Acinetobacter baylyi (3,5Mb) Attempt to characterize the cause of the error rate ~ reads ; Cumulative size of 130Mb 99,9% of aligned reads Average error rate : 0,55% 37% deletions, 53% insertions, 10% substitutions Errors accumulated around homopolymers => error rate is not constant

8 Sequencing technologies Illumina / Solexa Genetic Analyzer 1 lane on Acinetobacter baylyi (3,5Mb) 11,4M reads cumulative size of 900Mb 98,5% aligned reads Average error rate : 0,38% 3% deletions, 2% insertions, 95% substitutions.

9 Sequencing technologies GS FLX base calls : initial version GS FLX base calls : upgrade March 2008 Solexa base calls GA I Solexa base calls GA II

10 Sequencing technologies

11 Whole genome shotgun sequencing

12 Whole genome shotgun sequencing

13 Microbial Genome Sequencing Evolution Propose a strategy to sequence prokaryotic genomes, accounting for assembly quality and costs Mixing 454 and illumina technologies to obtain high quality drafts (454 provides long reads and illumina low error rate) (15X) + Sanger (4X) Sanger - 12X ~23 projects ~72 projects 454 (20X) + Sanger (1X) + Solexa (~50X) ~12 projects 454 (20X) + Solexa (~50X) 66 projects Phrap Arachne Newbler Velvet Solexa (~150X) 82 projects

14 Prokaryotic genomes sequencing Sanger unpaired + paired illumina GAI Illumina 76bp + Illumina MP 10Kb 52bp Coverage 7.4X 25X and 50X 100X and 50X Assembler Arachne (Broad Institute) Newbler (454 / Roche) Velvet (EBI) # of contigs Contigs N50 (Kb) # of scaffolds Scaffolds N50 (Kb) 2,200 3,600 3,601 Assembly size 3.417Mb Mb Mb (% of reference) (95%) (98%) 58K N (100%) 11K N Misassemblies # of errors 3,442 <127 1 error / 28Kb error / 17Kb Substitutions 2, Insertions / Deletions

15 Eukaryotic Genome Sequencing Evolution Extend prokaryotic strategy to eukaryotic genomes Sanger sequencing is still used to sequence long DNA fragments : >20Kb, BAC ends, Sanger - 10X - >12 projects tetraodon, paramecium, vitis, meloidogyne, tuber, blastocystis, chondrus, podospora, oikopleura, ectocarpus 454 (~15-20X) + Sanger BAC ends + Solexa (~50X) 9 projects : cocoa, banana, trypanosome, citrus, clytia, adineta, coffee, trout, colza Arachne Newbler

16 Eukaryotic Genome Annotation Automatic Annotation : Definition of exon/intron structures based on genomic sequences provided by the assembly step. The main goal is to produce a reference set of gene models. Data Distribution Genome browser Web site Submission Formatting etc Masking Data Collection Integration Post Annotation Analysis known repeats Ab initio repeats detection cdnas mapping Public protein mapping Public ESTs mapping Ab initio genes prediction Gene models prediction Proteic domains detection Paralogs/Orthologs definition Enzymatic activity detection Metabolic pathway inference

17 Eukaryotic Genome Annotation Mapping of expressed sequences Generic pipeline to align mrnas and proteins to a genome assembly. Genome Sequences Data flow is split to take advantage of our computing cluster Split Data cdnas reads are mapped on the assembly using Blat (all matches with a score within 90% of the best score are retained) and est2genome. Protein sequences (UniProt) are aligned against the assembly using Blat (filtered on the alignment length and score) and genewise. Sequences localization on genome with fast algorithm (BLAT) Filter Spliced alignments (est2genome, genewise, exonerate) Candidate gene models

18 Eukaryotic Genome Annotation Data integration Resources describes previously are intergated using the GAZE (R. Durbin, K. Howe & T. Chothia) software to build a reference set of gene models. Repeats Ab initio models Proteins Individual predictions are broken down into segments : intron, exon, intergenic. Each segment is given a score reflecting our confidence in the data. cdnas Data integration (GAZE) ESTs Whole genome is scanned to find signals : splices sites, start and stop codons An automaton describes the gene structure. Gene models Compute optimal gene structure

19 Annotating genomes using RNA-Seq Goal : annotate eukaryotic genomes using transcriptomic data from ultra-high throughput sequencers : Illumina and Solid Difficulties : Predict complete gene structures with 40 bp reads Align short reads to exon/exon junctions (mapping algorithms allow a limited number of gaps during alignments).!" #$%& ' %((#)

20 Annotating genomes using RNA-Seq Map reads onto the target genome Mapped reads are contiged to build covtigs For each covtig, extract a list of candidates exons 1. covtigs construction genome mapped reads 2. candidate exons covtig 100 nt coverage depth ag gt threshold covtigs Step 1. covtigs construction forward and reverse candidate exons Step 2. extraction of candidate exons

21 Annotating genomes using RNA-Seq unmapped reads word dictionary k-mer 1 X 1 Step 3: Validation of exon/exon junctions Validation of junctions between candidate exons using a word dictionary built from the unmapped reads.. k-mer 2 k-mer n X 2 X n verify words existence in the dictionary candidate exons gt ag validated junction covtig1...ggtgttcactacttacccatgt...agatctacacacttttagaagcctgaaag... covtig2 K-mers TTACCCAT ATCTACACACTTTTAGA CTTACCCAT ATCTACACACTTTTAG ACTTACCCAT ATCTACACACTTTTA TACTTACCCAT ATCTACACACTTTT CTACTTACCCAT ATCTACACACTTT ACTACTTACCCAT ATCTACACACTT CACTACTTACCCAT ATCTACACACT TCACTACTTACCCAT ATCTACACAC TTCACTACTTACCCAT ATCTACACA GTTCACTACTTACCCAT ATCTACAC Junction validation Each unmapped read is split into overlapping k-mers used to create the word dictionary Unmapped reads TGTTCACTACTTACCCATATCTACACACTTTTAGAA TGTTCACTACTTACCCATATCTACA TCACTACTTACCCATATCTACACACTTTTAGAAGCC GTTCACTACTTACCCATATCTACAC GTTCACTACTTACCCATATCTACACACTTTTAGAAG TTCACTACTTACCCATATCTACACA TTCACTACTTACCCATATCTACACACTTTTAGAAGC TCACTACTTACCCATATCTACACAC TGTTCACTACTTACCCATATCTACACACTTTTAGAA CACTACTTACCCATATCTACACACT GTTCACTACTTACCCATATCTACACACTTTTAGAAG... GTGTTCACTACTTACCCATATCTACACACTTTTAGA

22 Annotating genomes using RNA-Seq 4. graph of candidate exons linked by validated junctions Open Reading Frame G-Mo.R-Se models 5. model construction and coding sequence detection M1 M 2 M3 M 4 M5 M 6 M 7 Real transcripts T 1 T 2 T 3 T 4 T 5

23 Annotating genomes using RNA-Seq G-Mo.R-Se (Gene MOdeling using Rna-Seq), is downloadable from Genoscope website : Method set-up to annotate the vitis genome (500Mb) Around 175 million of illumina reads 4 tissues : leaf, root, stem and callus 140 million of uniquely aligned reads (73,5Mb) around covtigs (38,5Mb) transcript models ( loci), and with a plausible CDS ( loci) method used for current and coming projects : banana, colza, trout,

24 Annotating genomes using RNA-Seq

25 Current and future works The Next-gen sequencing brings diversification of applications and projects : de novo sequencing, metagenomic, genome annotation, re-sequencing, functional genomic, identification of mutations and structural variations Increase of number and size of projects : need to set-up new file formats to reduce disk storage. Fastq format is not suitable to avoid redundancy. Because of next-generation sequencing (NGS), the cost of sequencing a base is dropping faster than the cost of storing a byte. Scales are logarithmic and not corrected for inflation or costs of personnel, overheads and depreciation. Image is reprinted from Stein, L.D. Genome Biol. 11, 207 (2010).

Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury

Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic

More information

Application du séquençage génomique et transcriptomique à haut débit au Genoscope. Jean-Marc Aury

Application du séquençage génomique et transcriptomique à haut débit au Genoscope. Jean-Marc Aury Application du séquençage génomique et transcriptomique à haut débit au Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Expression Quantification (I)

Expression Quantification (I) Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

De Novo Assembly Using Illumina Reads

De Novo Assembly Using Illumina Reads De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Microbial Oceanomics using High-Throughput DNA Sequencing

Microbial Oceanomics using High-Throughput DNA Sequencing Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory

Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title: Outline of the Assembly process: JAZZ, the JGI In-House Assembler Author: Shapiro, Harris Publication Date: 07-08-2005

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

CHALLENGES IN NEXT-GENERATION SEQUENCING

CHALLENGES IN NEXT-GENERATION SEQUENCING CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Keeping up with DNA technologies

Keeping up with DNA technologies Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Deep Sequencing Data Analysis

Deep Sequencing Data Analysis Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

How is genome sequencing done?

How is genome sequencing done? How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step

More information

Copy Number Variation: available tools

Copy Number Variation: available tools Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Disease gene identification with exome sequencing

Disease gene identification with exome sequencing Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre c.gilissen@antrg.umcn.nl Contents Infrastructure Exome sequencing

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Alan R. Gingle Andrew H. Paterson Joshua A. Udall Jonathan F. Wendel 1 CEGC project goals set the context

More information

454 Sequencing System Software Manual Version 2.6

454 Sequencing System Software Manual Version 2.6 454 Sequencing System Software Manual Version 2.6 Part C: May 2011 Instrument / Kit GS Junior / Junior GS FL+ / L+ GS FL+ / LR70 GS FL / LR70 For life science research only. Not for use in diagnostic procedures.

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

Overview of Eukaryotic Gene Prediction

Overview of Eukaryotic Gene Prediction Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix

More information

High Performance Compu2ng Facility

High Performance Compu2ng Facility High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012 RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided

More information

An Introduction to Next-Generation Sequencing Technology

An Introduction to Next-Generation Sequencing Technology n Introduction to Next-eneration Sequencing echnology Part II: n overview of DN Sequencing pplications Diverse pplications Next-generation sequencing (NS) platforms enable a wide variety of applications,

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing

More information

mygenomatix - secure cloud for NGS analysis

mygenomatix - secure cloud for NGS analysis mygenomatix Speed. Quality. Results. mygenomatix - secure cloud for NGS analysis background information & contents 2011 Genomatix Software GmbH Bayerstr. 85a 80335 Munich Germany info@genomatix.de www.genomatix.de

More information

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary

More information

escience and Post-Genome Biomedical Research

escience and Post-Genome Biomedical Research escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational

More information

Next Generation Sequencing; Technologies, applications and data analysis

Next Generation Sequencing; Technologies, applications and data analysis ; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

The NGS IT notes. George Magklaras PhD RHCE

The NGS IT notes. George Magklaras PhD RHCE The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information