PEPTIDE PRODUCTION SERVICE

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "PEPTIDE PRODUCTION SERVICE"

Transcription

1

2 ETIDE RODUCTION SERVICE eptide Synthesis Solid-phase eptide Synthesis Figure General Scheme for Solid hase eptide Synthesis (Adapted from biotech.uiuc.edu) R O NH CH C OH rotected amino acid R O R O NH CH C NH CH C O Activation Deprotection R O NH CH C Activated amino acid R O R O NH CH C NH CH C O Deprotected peptide Coupling R O R O NH CH C NH CH C R O NH CH C O rotected peptide chain Linker Solid Support Caption Amino acid side-chain protecting group α-amino acid protecting group Activating group Solid support = resin Highlights newly formed peptide bond 0 Custom s

3 eptide Design Composition of amino acids Length of Sequence Hydrophobic Zones roblematic amino acids Secondary Structure E- TI- DE- DE- SIGN eptide Modification 4 Synthesis of families of peptides for studies of transportation in membranes. eptide synthesis for use in the development of antibodies (olyclonal and Monoclonal). eptide synthesis for in vivo studies. Design and synthesis of peptides for the development of diagnostic kits (IVD). Design and synthesis of families of peptides that transport HIV in established lines. In vitro studies of cell infection. Design, synthesis, modifications and conjugation to carrier proteins for the utilisation of sequences which may be employed as a target for the development of antibodies, both polyclonal in different species (rabbit, chicken, mouse ) and monoclonal (mouse). Design and synthesis of peptides for in vivo studies with animal models, murine, in the development of neurodegenerative diseases. Development of peptides for the study of diseases of great social impact- Studies of Coeliac Disease- Immunogenic sequences in gluten. 0 Custom s

4 ROTEIN SERVICE rotein Expression and urification Expression Expression in mammalian cells. Transient transfection. Optimised expression and detection (9T, CHO and HEK cells). ost-translational modifications. Excellent method for the production of bioactive proteins. Bacterial expression. Optimised expression and detection (E.coli). Rapid expression and easily scalable. Expression in insect cells. Transient transfection and Baculovirus Expression Vector System (BEVS). Optimised expression and detection (Sf9 and Sf cells). roduction and titration of recombinant baculovirus. ost-translational modifications similar to the mammalian system. Suitable for the expression of toxic genes. urification of recombinant proteins Ion exchange chromatography, affinity and molecular exclusion chromatography, or gel filtration chromatography. Tags used: 6xHis, GST, FLAG. Tag removal by means of proteases: Thrombin, rescission, Factor Xa. FLC AtkaExpress IMMUNOSTE facilities Lyophilisation Stable Cell Line Development for the roduction of Antibodies and Recombinant roteins: Vector roduction (5 Weeks) Transfection ( Week) Selection Of Transfected Cells ( Weeks) rotein roduction Assay ( Weeks) Selection Of roducer Clones (0 Weeks) Determination Of Clone roductivity ( Weeks) Sequence design Original vector construction Target vector construction Transfection with FreeStyle Max Stabilization Culture using CD opticho Stable pool Validation Genetic enhancement using MTX Limiting dilution Scaling and screening Bacterial expression and purification. Expression and purification in mammalian cells. Development of a stable cell line. Expression of the enzyme D-xylose-dehydrogenase in E.coli (BL), purification by molecular exclusion chromatography and characterisation of the enzymatic activity. Transfection of CHO and HEK9 cell lines, expression and purification of membrane protein CD9 by affinity with a 6xHis tag. Analysis using WB. Construction of the target vector, transfection of cell line HEK9, validation of the expression of membrane protein CD4, using cytometry. 0 Custom s

5 MONOCLONAL AND OLYCLONAL ANTIBODY DEVELOMENT SERVICE Multidisciplinary programme for the development of customised antibodies Antibody generation GATAATCTGGTCTTATTTCC Antigen design Molecular biology rotein production Immunotechnology Antibody validation Diagnostics or research tools development Flow cytometry rotein Microarray rotein Microarray ELISA Client satisfaction olyclonal Antibodies Rabbit olyclonal Antibodies Antigen Immunisation Development of rabbit polyclonal antibody for use in a kit based on Lateral Flow Immunoassay. for the development of rabbit polyclonal antibodies for use against human protein. No Ag supplied by the client. for the development of rabbit polyclonal antibodies against allergens. Development of tools against different pathogens (micro-organisms) for the fabrication of a rapid diagnosis kit. Application of antigens supplied by the client, whole inactivated cells. Study of antigenicity, antigen development based on the client s needs (WB), peptide synthesis and conjugation with transporting protein. Usual protocol, and testing done by applying the technique requested by the customer. olyclonal antibody development for measuring allergens tested by ELISA. Clonal response of B lymphocytes Varied epitopes of the same antigen recognised by diverse lymphocyte clones B-lymphocyte clone 4 for the development of rabbit polyclonal antibodies against synthetic proteins supplied by clients. olyclonal antibody development for the detection of native proteins in WB/IHC for research purposes. olyclonal antibody preparation 04 Custom s

6 NH Val His Val Treo ro Glu Glu His His His NH Val His Val Treo ro Glu Glu His olyclonal Antibodies Chicken olyclonal Antibodies 4 for the development of chicken polyclonal antibodies against allergens. eptide design and service for the development of chicken polyclonal antibodies for blocking the functional region of resenilin in humans. eptide design based on point mutation CKit mut and chicken polyclonal development. Chicken polyclonal development service against synthetic proteins supplied by clients. Development of polyclonal antibodies for utilisation in measuring allergens by means of ELISA. Functional and antigenicity analysis of protein involved in the study of neurodegenerative diseases. Design of blocking tools for in vitro studies. Design of (mutated) sequence and polyclonal antibody development for the detection of highly conserved proteins, C-Kit. olyclonal antibody development for the detection of native proteins in WB/IHC for research purposes. olyclonal Antibodies hospho-specific Antibodies for the development of chicken phospho-specific polyclonal antibodies against peptide p8α. for the development of phospho-specific monoclonal antibodies against peptide Y4. for the development of rabbit phospho-specific polyclonal antibodies against peptide TAU. Synthesis of phosphorylated peptides (Tyr) and non-phosphorylated peptides, and production of chicken polyclonal antibodies. hospho-specific purification. Development for autoimmune diseases. roduction of monoclonal antibodies against peptide Y4. Differential screening process for phosphorylation and non-phosphorylation. Synthesis of phosphorylated and non- phosphorylated peptides, and development of rabbit polyclonal antibodies. hospho-specific purification. NH Val Val Treo ro Glu Glu NH Val Val Treo ro Glu Glu NH Val His Val Treo ro Glu Glu NH Val Val Treo ro Glu Glu NH Val Val Treo ro Glu Glu Conjugation eptide synthesis NH Val His Val Treo ro Glu Glu NH Val His Val Treo ro Glu Glu urification Affinity urification Immunization Depletion (hospospecific Antibodies) NH Val His Val Treo ro Glu Glu Depletion (hospospecific urification) 05 Custom s

7 Monoclonal Antibodies HIBRIDOMA 4 5 hase : Study and Immunisation rotocol. 6 hase : Cell Fusion, Selection and First Screening. hase : Cloning and Second Screening. hase 4: Stabilisation and Cryopreservation. Characterisation of the selected clones. for the development of specific antibodies against proteins involved in mitochondrial energy metabolism. for the design and development of specific antibodies against new protein tags. for the development of specific antibodies against allergens. Development of antibody pairs to be utilized in the creation of protein arrays. Design and production of antibody pairs within the framework of a project aimed at finding cancer-related mitochondrial energy pathways. Development of new monoclonal antibodies against new tags. After designing a new family of tags to be used as advanced tools in protein functional analysis, the battery of specific antibodies was developed for research purposes. Design and development of antibody pairs against common environmental allergens for the subsequent production of detection kits for such allergens. 06 Custom s

8 DISCOVERY BIOLOGY rotein Microarrays High density protein microarray technology Identification of biomarkers Identification of enzymatic substrates rofiles of antibody specificity Auto-antibody tests harmacological targets Studies of protein-protein interaction For the customised development of protein microarrays, we has a cdna library or gene library, with more than 0,000 clones of different human proteins, amongst which the presence of over 500 kinase clones, a complete representation of the Human Kinome. rotein Selection Array Design rinting rinting Validation Selection of proteins Number of replicas and subarrays control definition Inmobilisation of proteins by microcontact Evaluation of printing quality and efficiency Flow Cytometry Flow Cytometry- From Research to Clinical Analysis - Cell Analysis In vitro drug screening: In vitro evaluation of toxicity and apoptotic pathways induced by drugs Cell Immunophenotyping: Characterisation of different cell populations Activation, proliferation and cell death: Analysis of activation markers Dendritic cell (DC)-based assays: In Vitro comparison of the antigenicity of proteins at cell level Functional assays: ropietary latform: One Step hagocytosys Cell Activation Cell death assay (AD assay) Antibody array Screening and selection of scfv Cell Immunophenotyping Functional assays Cell activation Cell assays of DCs Antibody array for simultaneous determination of 70 different human leukocyte antigens in peripheral blood mononuclear cells. Screening and selection by means of phage microarray (scfv) derived from Tomlinson I+J library, IL8 specific. Multiparametric analysis of cytokines (INFγ, IL-, TNFα) at intracellular level in stimulated T cells. hagocytosis analysis; cell activation and death in the characterisation of superparamagenetic nano-particles in a customised assay to carry out the analysis in a single tube. Evaluation of basophil activation after incubation with a battery of allergens. Evaluation of the antigenicity of proteins derived from Mycobacterium tuberculosis, as potential candidates for vaccine development. 07 Custom s

9 DEVELOMENT OF CUSTOMISED ASSAYS Workflow of the production of an immunoassay Development, characterisation, purification and conjugation of antibodies Development and validation of an immunoassay Fabrication of the assay kit Definition Of The Assay Design Of The Assay IVD Common Technical Specification Customised Development And roduction Commercial resentation Registration Selection of the technology and the marker Selection of development of the assay components Validation of assay Fabrication of the assay ackaging and documentation Registration of the product for its use in IVD Assay Design Concept Development Design Input, Output and Validation Assay Design Validation Design History File, Standart Operations rocedures and Documentation QUALITY MANAGEMENT - ISO900:008 - ISO485:0 - MEDICAL DEVICES Development of a spectrophotometric assay of enzymatic activity. Development of ELISA kits for allergens. Development of multiplex assay for IVD. Design and production of the assay components, including the active enzyme as well as the packaging and registration of the IVD kit. Development and production of the pairs of antibodies and assembly of kit for research purposes. Design of the assay, immobilization and conjugation of antibodies with microparticles and fluorochromes, for the detection of markers in urine. 08 Custom s

10 SECIALIZED ANTIBODY SERVICES Hybridoma Freezing and Storage in Liquid Nitrogen Culture of Hybridomas for the roduction of Monoclonal Antibodies OEM/Bulk roduction Mycoplasma Testing and Decontamination Hybridoma Isotyping Antibody urification Conjugation Lyophilisation and Stabilisation / Desiccation Fragmentation Ab Bispecific Monoclonal Antibodies 09 Custom s

11 CUSTOM SERVICES eptide roduction eptide production eptide production with Modification Reference rotein rotein Expression and urification rotein Characterisation urification of recombinant proteins Lyophilisation s Stable cell line development service for the production of antibodies and recombinant proteins Reference Monoclonal and polyclonal antibody development service Reference Rabbit olyclonal Antibodies Chicken olyclonal Antibodies hospho-specific olyclonal Antibodies Mouse Monoclonal Antibodies remium remium Basic olipeptide remium olipeptide Basic rotein rotein remium rotein eptide remium eptide remium eptide Discovery biology rotein microarrays Massive Screening of hage Display in Array Format Flow Cytometry- From Research to Clinical Analysis Reference Development of customised assays Development of customised assays Reference Specialized antibody service Hybridoma Freezing and Storage in Liquid Nitrogen Reference 4600 Culture of Hybridomas for the roduction of Monoclonal Antibodies OEM/Bulk roduction Mycoplasma Testing and Decontamination Hybridoma Isotyping Antibody urification Antibody Conjugation - Flurochromes Antibody Conjugation - Enzymes Antibody Conjugation - Beads Antibody Lyophilisation and Stabilisation/Desiccation Fragmentation Ab Bispecific Monoclonal Antibodies

12 IMMUNOSTE, Cancer research institute, Miguel de Unamuno campus, Salamanca (Spain)

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.

More information

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production

More information

Advanced BioDesign Outlines Solutions. Antibody Overview. by Advanced BioDesign. Project Start. Immunogenicity. Selecting Your Antigen

Advanced BioDesign Outlines Solutions. Antibody Overview. by Advanced BioDesign. Project Start. Immunogenicity. Selecting Your Antigen Advanced BioDesign Outlines Solutions by Advanced BioDesign Antibody Overview Launching an immunisation programme is an important experimental step that needs care. With Advanced BioDesign, you may develop

More information

Your partner in immunology

Your partner in immunology Your partner in immunology Expertise Expertise Reactivity Reactivity Quality Quality Advice Advice Who are we? Specialist of antibody engineering Covalab is a French biotechnology company, specialised

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

Chapter 18: Applications of Immunology

Chapter 18: Applications of Immunology Chapter 18: Applications of Immunology 1. Vaccinations 2. Monoclonal vs Polyclonal Ab 3. Diagnostic Immunology 1. Vaccinations What is Vaccination? A method of inducing artificial immunity by exposing

More information

Custom Antibodies & Recombinant Proteins

Custom Antibodies & Recombinant Proteins Custom Antibodies & Recombinant Proteins INTRODUCTION Custom services to meet your research and development requirements Improvements in health, medicine and diagnostics over the past century can be largely

More information

Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH

Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies

More information

HuCAL Custom Monoclonal Antibodies

HuCAL Custom Monoclonal Antibodies HuCAL Custom Monoclonal Antibodies Highly Specific Monoclonal Antibodies in just 8 Weeks PROVEN, HIGHLY SPECIFIC, HIGH AFFINITY ANTIBODIES IN 8 WEEKS WITHOUT HuCAL PLATINUM IMMUNIZATION (Human Combinatorial

More information

Antibody Services. Best Guarantees in the Industry! Monoclonal Antibody Services. Polyclonal Antibody Services. Express Antibody TM Services

Antibody Services. Best Guarantees in the Industry! Monoclonal Antibody Services. Polyclonal Antibody Services. Express Antibody TM Services Antibody Services Best Guarantees in the Industry! Monoclonal Antibody Services Polyclonal Antibody Services Express Antibody TM Services Guaranteed Antibody Services Antibody Purification Services Your

More information

1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages

1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages 1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly

More information

Custom Antibody Services

Custom Antibody Services Custom Antibody Services Custom service offerings DNA sequence Plasmid Peptide Structure Protein Peptide Small molecule Cells Spleen Lymphocytes Antigen Preparation Immunization Fusion & Subcloning Expansion

More information

Genes to Proteins to Antibodies

Genes to Proteins to Antibodies Genes to Proteins to Antibodies About Us Fusion Antibodies is a CRO established in 2001 as a spin-out from Queen s University Belfast. The company building is situated in a charming area of Springbank

More information

Elabscience Biotechnology Co.,Ltd

Elabscience Biotechnology Co.,Ltd Biotechnology Co.,Ltd Your one-stop custom antibody service Antibody is a kind of protein that is the most widely used in the fields of biology and medicine. Antibodies, as the preparations for disease

More information

ELITE Custom Antibody Services

ELITE Custom Antibody Services ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

Custom Antibodies Services. GeneCust Europe. GeneCust Europe

Custom Antibodies Services. GeneCust Europe. GeneCust Europe GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 6 rue Dominique Lang L-3505 Dudelange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com

More information

Geniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody

Geniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Custom Antibody Services Serum services Antibody Monoclonal Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Poly Y WE PROVIDE OUR SERVICES TO With Expertise

More information

3 months 1.5 months 1.5 months. 1 month

3 months 1.5 months 1.5 months. 1 month Rabbit monoclonal antibody (Mab) is secreted by the plasma B-cell of the rabbit. Traditional generation of rabbit Mab relies on a rabbit myeloma for B- cell fusion (

More information

GenScript Antibody Services

GenScript Antibody Services GenScript Antibody Services Scientific experts, innovative technologies, proven performance We specialize in custom antibody production to empower your research Custom Polyclonal Antibody Production Custom

More information

HuCAL Custom Monoclonal Antibodies

HuCAL Custom Monoclonal Antibodies HuCAL Custom Monoclonal HuCAL Custom Monoclonal Antibodies Highly Specific, Recombinant Antibodies in 8 Weeks Highly Specific Monoclonal Antibodies in Just 8 Weeks HuCAL PLATINUM (Human Combinatorial Antibody

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein

More information

GenScript Antibody Services

GenScript Antibody Services GenScript Antibody Services Scientific experts, innovative technologies, proven performance We specialize in custom antibody production to empower your research Custom Polyclonal Antibody Production Custom

More information

Bio-manufacturing of antigens, antibodies and bioresearch materials

Bio-manufacturing of antigens, antibodies and bioresearch materials Bio-manufacturing of antigens, antibodies and bioresearch materials Foetal Bovine Serum (FBS) Human AB Serum Chick Embryo Extract (CEE) Custom polyclonal antibody production Custom monoclonal antibody

More information

Antibody Production Price List

Antibody Production Price List Antibody Production Price List Presenting Insight Biotechnology s price list for custom polyclonal and monoclonal antibody production services. We are happy to tailor individual packages towards the specific

More information

Custom Antibodies. Animals Chicken, Goat, Guinea Pig, Mouse, Rat, Rabbit, etc. Antibody Identification Dot blot ELISA IHC Western blot

Custom Antibodies. Animals Chicken, Goat, Guinea Pig, Mouse, Rat, Rabbit, etc. Antibody Identification Dot blot ELISA IHC Western blot Custom Antibodies aapptec provides custom peptides and immunology products with high quality and fast delivery at an affordable price to research scientists worldwide. aapptec has unparalleled experience

More information

Custom Antibody Services

Custom Antibody Services prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

Chapter 3.2» Custom Monoclonal

Chapter 3.2» Custom Monoclonal 198 3 3.2 Custom Monoclonal 199 Mouse monoclonal antibody development Chapter 3.2» Custom Monoclonal 200 In vitro monoclonals expression service 201 Mouse monoclonal antibody additional services 202 Magnetic

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Services and Prices Rabbit Polyclonal Antibody Service Package Number Description Package Contents Time Price Polyclonal package 1 (From protein to antiserum) Polyclonal package 2

More information

Basics of Immunology

Basics of Immunology Basics of Immunology 2 Basics of Immunology What is the immune system? Biological mechanism for identifying and destroying pathogens within a larger organism. Pathogens: agents that cause disease Bacteria,

More information

Outline. Market & Technology Trends. LifeTein Technology Portfolio. LifeTein Services

Outline. Market & Technology Trends. LifeTein Technology Portfolio. LifeTein Services 1 Outline Market & Technology Trends LifeTein Technology Portfolio LifeTein Services 2 Synthetic Therapeutic Peptides More than 60 synthetic therapeutic peptides under 50 amino acids in size have reached

More information

Antibody Services from GenScript

Antibody Services from GenScript Services from GenScript www.genscript.com GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 USA Toll-Free: 1-877-436-7274 Fax: 1-732-210-0262 1-732-885-5878 Academic Services Pharmaceutical

More information

Exclusive customized epigenetic antibodies

Exclusive customized epigenetic antibodies Exclusive customized epigenetic antibodies For many years, Diagenode has acquired a strong and reliable experience in the production of custom epigenetic antibodies, allowing us to become one of the most

More information

Shop! VWRBiosciences,more than just a helping hand

Shop! VWRBiosciences,more than just a helping hand section line 2 BioSciences section line 1 VWRBiosciences,more than just a helping hand Proteomics round-up What can we offer? In today s world of discovery, technology is critical to a better understanding

More information

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins Adaptive Immunity Chapter 17: Adaptive (specific) Immunity Bio 139 Dr. Amy Rogers Host defenses that are specific to a particular infectious agent Can be innate or genetic for humans as a group: most microbes

More information

COMPANY INTRODUCTION. www.cusabio.com

COMPANY INTRODUCTION. www.cusabio.com www.cusabio.com COMPANY INTRODUCTION CUSABIO is a leading biotechnology company specialized in production of high quality products for gene, protein, antibody, ELISA kit, in vitro diagnostic raw material,

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables Abstract Abbreviations List of figures CONTENT I-VI VII-VIII IX-XII List of tables XIII Chapter 1 Review of Literature 1. Vaccination against intracellular pathogens 1-34 1.1 Role of different immune responses

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services

Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production Life Science Products and Services Since 2002, Biomatik has provided worldwide researchers in life science discovery

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

Contact Information Korea Health Industry Development Institute

Contact Information Korea Health Industry Development Institute Introducing SG Cap TM, a unique immobilization method optimized for multiplex diagnostics, with higher sensitivity and specificity than currently available technology PCL,Inc. Contact Information Korea

More information

Name (print) Name (signature) Period. (Total 30 points)

Name (print) Name (signature) Period. (Total 30 points) AP Biology Worksheet Chapter 43 The Immune System Lambdin April 4, 2011 Due Date: Thurs. April 7, 2011 You may use the following: Text Notes Power point Internet One other person in class "On my honor,

More information

ANTIBODY AND CYTOKINE DEVELOPMENTS AND SERVICES. Zsolt Keresztessy, PhD MBA TUDOMÁNYOS HÉTFŐ 2012.04.23.

ANTIBODY AND CYTOKINE DEVELOPMENTS AND SERVICES. Zsolt Keresztessy, PhD MBA TUDOMÁNYOS HÉTFŐ 2012.04.23. ANTIBODY AND CYTOKINE DEVELOPMENTS AND SERVICES AT DEBRECEN CLINICAL GENOMICS CENTER DEPT BIOCHEMISTRY AND MOLECULAR BIOLOGY Zsolt Keresztessy, PhD MBA TUDOMÁNYOS HÉTFŐ 2012.04.23. MISSION CUTTING EDGE

More information

Recombinant Antibody Fragments, Brochure

Recombinant Antibody Fragments, Brochure Recombinant Antibody Fragments, Brochure Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53

More information

Applications of Ab Molecules. Chapter 4 Monoclonal Ab (p.99) Chapter 5 Ab genes and Ab Engineering (p.128)

Applications of Ab Molecules. Chapter 4 Monoclonal Ab (p.99) Chapter 5 Ab genes and Ab Engineering (p.128) Applications of Ab Molecules Chapter 4 Monoclonal Ab (p.99) Chapter 5 Ab genes and Ab Engineering (p.128) Monoclonal Antibodies Clonal Selection of B Lymphocytes Hybridoma Köhler and Milsten (1975) - continuous

More information

From Biology to Discovery

From Biology to Discovery POLYCLONAL ANTIBODY PRODUCTION SERVICES Abbiotec offers custom polyclonal antibody production services to the scientific community to accelerate a project From Biology to Discovery. When the antibody for

More information

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism.

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism. Central Dogma Final Review Section Week 10 DNA RNA Protein DNA DNA replication DNA RNA transcription RNA Protein translation **RNA DNA reverse transcription http://bass.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_1.html

More information

Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09

Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09 Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159 Investigator: Institution: Carol Wyatt Kansas State University Date Submitted: 12-11-09 Industry summary: Effective circovirus vaccines

More information

Making the switch to a safer CAR-T cell therapy

Making the switch to a safer CAR-T cell therapy Making the switch to a safer CAR-T cell therapy HaemaLogiX 2015 Technical Journal Club May 24 th 2016 Christina Müller - chimeric antigen receptor = CAR - CAR T cells are generated by lentiviral transduction

More information

Antibody Services from GenScript, Brochure

Antibody Services from GenScript, Brochure Services from GenScript, Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26

More information

Contents. Prefacce xi List of Contributors xiii

Contents. Prefacce xi List of Contributors xiii V Contents Prefacce xi List of Contributors xiii 1 Peptides as Drugs: Discovery and Development 1 Bernd Groner 1.1 Discovery of New Potential Drug Targets and the Limitations of Druggability 1 1.2 Protein

More information

PperCHIP. High-Content Peptide Microarrays. Epitope Mapping & Serum Profiling Services

PperCHIP. High-Content Peptide Microarrays. Epitope Mapping & Serum Profiling Services PepperChip High-Content Peptide Microarrays PepperMap Epitope Mapping & Serum Profiling Services PperCHIP access to custom and dard peptide microarrays up to 9,000 features per in a uniquely flexible and

More information

Interim Progress Report R&D Project 348. Development of a Field Test Kit for Detection of Blue-Green Algal Toxins

Interim Progress Report R&D Project 348. Development of a Field Test Kit for Detection of Blue-Green Algal Toxins Interim Progress Report R&D Project 348 Development of a Field Test Kit for Detection of Blue-Green Algal Toxins Biocode Limited November 1992 R&D 348/04/A ENVIRONMENT AGENCY 135357 CONTENTS SUMMARY KEYWORDS

More information

Antigens & Antibodies II. Polyclonal antibodies vs Monoclonal antibodies

Antigens & Antibodies II. Polyclonal antibodies vs Monoclonal antibodies A Brief Review of Antibody Structure A Brief Review of Antibody Structure The basic antibody is a dimer of dimer (2 heavy chain-light chain pairs) composed of repeats of a single structural unit known

More information

PX Therapeutics : the partner for early stage biotherapeutics development Biotuesday, May 5 2009

PX Therapeutics : the partner for early stage biotherapeutics development Biotuesday, May 5 2009 PX Therapeutics : the partner for early stage biotherapeutics development Biotuesday, May 5 2009 Christelle Dagoneau, PhD Business Development Director Company Profile Protein expert incorporated in 2000

More information

Bispecific antibodies with native chain structure

Bispecific antibodies with native chain structure Bispecific antibodies with native chain structure 11.03.2014 Kristin Fritsch Natural function of antibodies I. Spasevska, Biosciences Master Reviews, 2014 IgG Antibody http://www.ebioscience.com/knowledge-center/antigen/immunoglobulin/structure.htm

More information

Catalogue 2009/2010. Immunological and biochemical services

Catalogue 2009/2010. Immunological and biochemical services Catalogue 2009/2010 Immunological and biochemical services 1 Customised Services Page Antisera and Polyclonal Antibodies 4 Guarantee offer - Rabbit antibodies with guaranteed quality 5 Inclusive offers

More information

The Use of Antibodies in Immunoassays

The Use of Antibodies in Immunoassays TECHNICAL NOTE The Use of Antibodies in Immunoassays Introduction Structure of an IgG Antibody Immunological reagents are the backbone of every immunoassay system. Immunoassays can be utilized to quantitatively

More information

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression

More information

ABBOMAX, INC. Custom Services Polyclonal antibody production. www.abbomax.com. Monoclonal antibody production. Phosphospecific antibody production

ABBOMAX, INC. Custom Services Polyclonal antibody production. www.abbomax.com. Monoclonal antibody production. Phosphospecific antibody production ABBOMAX, INC Custom Services Polyclonal antibody production Monoclonal antibody production Phosphospecific antibody production Antibody purification and labeling Custom assay development Recombinant protein

More information

Why use passive immunity?

Why use passive immunity? Vaccines Active vs Passive Immunization Active is longer acting and makes memory and effector cells Passive is shorter acting, no memory and no effector cells Both can be obtained through natural processes:

More information

Chapter 3. Protein Structure and Function

Chapter 3. Protein Structure and Function Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER

More information

B cell activation and Humoral Immunity

B cell activation and Humoral Immunity B cell activation and Humoral Immunity Humoral immunity is mediated by secreted antibodies and its physiological function is defense against extracellular microbes (including viruses) and microbial exotoxins.

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Types, production of antibodies and Antibody/antigen interaction

Types, production of antibodies and Antibody/antigen interaction Types, production of antibodies and Antibody/antigen interaction Antibodies Secreted by B lymphocytes Great diversity and specificity: >109 different antibodies; can distinguish between very similar molecules

More information

Analysis of the adaptive immune response to West Nile virus

Analysis of the adaptive immune response to West Nile virus Analysis of the adaptive immune response to West Nile virus Jonathan Bramson (PI) Robin Parsons Alina Lelic Galina Denisova Lesley Latham Carole Evelegh Dmitri Denisov Strategy for characterizing T cell

More information

The Leading Gene Through Screen CRO

The Leading Gene Through Screen CRO The Leading Gene Through Screen CRO Molecular Biology Services Molecular Biology drives modern drug discovery. Drug screening, target validation and structural biology processes frequently require recombinant

More information

Guidance for Industry

Guidance for Industry Guidance for Industry Interpreting Sameness of Monoclonal Antibody Products Under the Orphan Drug Regulations U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation

More information

SCANTIBODIES Laboratory, Inc. Contract Monoclonal Antibody Production

SCANTIBODIES Laboratory, Inc. Contract Monoclonal Antibody Production A Technical Publication of SCANTIBODIES Laboratory, Inc. Volume 1 Number 4 9336 Abraham Way Santee, CA 92071 USA (619) 258-9300 fax (619) 258-9366 www.scantibodies.com SCANTIBODIES Laboratory, Inc. Contract

More information

Next generation sequencing and proteomics. to study the antibody repertoire. and generate monoclonal antibodies

Next generation sequencing and proteomics. to study the antibody repertoire. and generate monoclonal antibodies Next generation sequencing and proteomics to study the antibody repertoire and generate monoclonal antibodies Mario Nuvolone Technical Journal Club 7 th May 2013 Antibodies Weiner Nat Rev Cancer 2007 Genomic

More information

Analyzing antibody sequence for recombinant antibody expression. Hangxing Yu, Ph.D Senior Scientist, GenScript May 20, 2015

Analyzing antibody sequence for recombinant antibody expression. Hangxing Yu, Ph.D Senior Scientist, GenScript May 20, 2015 Analyzing antibody sequence for recombinant antibody expression Hangxing Yu, Ph.D Senior Scientist, GenScript May 20, 2015 Presentation Outline 1 2 3 4 Antibody basics, structure and function Antibody

More information

MONOCLONAL ANTIBODY PRODUCTION

MONOCLONAL ANTIBODY PRODUCTION MONOCLONAL ANTIBODY PRODUCTION Antibodies having single specificity produced from a single clone of B cell are referred as Mono clonal antibodies (MAbs). In 1975, Georges Köhler and Cesar Milstein devised

More information

Monash Antibody Technologies Facility

Monash Antibody Technologies Facility Monash Antibody Technologies Facility The Monash Antibody Technologies Facility: A high throughput monoclonal antibody production platform for phospho-kinomics Tecan Symposium Zürich September 2007 What

More information

SCIENCE WHERE YOU ARE

SCIENCE WHERE YOU ARE Newsletter. November 2013 SCIENCE WHERE YOU ARE Dealing with BioNordika includes a number of first class benefits: Next day delivery.... and some times even faster! Free delivery. Focus on your application.

More information

Chapter 43: The Immune System

Chapter 43: The Immune System Name Period Our students consider this chapter to be a particularly challenging and important one. Expect to work your way slowly through the first three concepts. Take particular care with Concepts 43.2

More information

Luca Romagnoli, Ph.D. Business Development Manager

Luca Romagnoli, Ph.D. Business Development Manager Modelli innovativi di produzione per lo sviluppo di un processo altamente qualitativo di farmaci biologici Luca Romagnoli, Ph.D. Business Development Manager BIOLOGICAL DRUGS - SOURCES Monoclonal antibodies

More information

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%)

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Activation and effector functions of HMI

Activation and effector functions of HMI Activation and effector functions of HMI Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 25 August 2015 ว ตถ ประสงค หล งจากช วโมงบรรยายน แล วน กศ กษาสามารถ

More information

Common Course Topics Biology 1414: Introduction to Biotechnology I

Common Course Topics Biology 1414: Introduction to Biotechnology I Common Course Topics Biology 1414: Introduction to Biotechnology I Assumptions Students may be enrolled in this course for several reasons; they are enrolled in the Biotechnology Program, they need a science

More information

Methodological considerations: Potency tests for recombinant adjuvanted RTS,S vaccine

Methodological considerations: Potency tests for recombinant adjuvanted RTS,S vaccine Methodological considerations: Potency tests for recombinant adjuvanted RTS,S vaccine Background Adjuvanted recombinant RTS,S-based vaccines have been in clinical evaluation since the late 1980s and various

More information

Microbiology 532 Immunology Examination KEY October 30, 2003

Microbiology 532 Immunology Examination KEY October 30, 2003 KEY October 30, 2003 All questions have equal point value. You may keep the test questions. Multiple Choice (choose the best answer) 1. Receptors associated with innate immunity recognize microbes by detecting:

More information

B Cells and Antibodies

B Cells and Antibodies B Cells and Antibodies Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School Lecture outline Functions of antibodies B cell activation; the role of helper T cells in antibody production

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein

More information

Microbiology AN INTRODUCTION EIGHTH EDITION

Microbiology AN INTRODUCTION EIGHTH EDITION TORTORA FUNKE CASE Microbiology AN INTRODUCTION EIGHTH EDITION Differentiate between innate and acquired immunity. Chapter 17 Specific Defenses of the Host: The Immune Response B.E Pruitt & Jane J. Stein

More information

B Cell Generation, Activation & Differentiation. B cell maturation

B Cell Generation, Activation & Differentiation. B cell maturation B Cell Generation, Activation & Differentiation Naïve B cells- have not encountered Ag. Have IgM and IgD on cell surface : have same binding VDJ regions but different constant region leaves bone marrow

More information

Questions related to peptide antibodies

Questions related to peptide antibodies www.lifetechindia.com Some Commonly Asked Questions about custom antibody production (Click over the Q# to see details) Questions related to protein antigens and general information Q1 How much antigen

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

Isogenica Ltd. Biologics discovery overview

Isogenica Ltd. Biologics discovery overview Isogenica Ltd Biologics discovery overview 1 Isogenica Specialist antibody and peptide display company Based in Cambridge at the heart of UK Biotech Expertise in protein and peptide engineering since 2001

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,

More information

MODERN PERSPECTIVES ON PEPTIDE SYNTHESIS INTRODUCTION WHITEPAPER. www.almacgroup.com

MODERN PERSPECTIVES ON PEPTIDE SYNTHESIS INTRODUCTION WHITEPAPER. www.almacgroup.com MODERN PERSPECTIVES ON PEPTIDE SYNTHESIS INTRODUCTION WHITEPAPER www.almacgroup.com The complexity of synthetic peptide products, whether as reagents used in research or as therapeutic APIs, is increasing.

More information

Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues,

Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues, Kinexus Bioinformatics Corporation is seeking to map and monitor the molecular communications networks of living cells for biomedical research into the diagnosis, prognosis and treatment of human diseases.

More information

Chapter 17A: Adaptive Immunity Part I

Chapter 17A: Adaptive Immunity Part I Chapter 17A: Adaptive Immunity Part I 1. Overview of Adaptive Immunity 2. T and B Cell Production 3. Antigens & Antigen Presentation 4. Helper T cells 1. Overview of Adaptive Immunity The Nature of Adaptive

More information

Cell Line: HD-BIOP3 Suspension adapted GS null CHO K1 cells

Cell Line: HD-BIOP3 Suspension adapted GS null CHO K1 cells Cell Line Data Pack Cell Line: HD-BIOP3 Suspension adapted GS null CHO K1 cells t + 44 ()1223 65558 f + 44 ()1223 655581 e info@horizondiscovery.com w www.horizondiscovery.com Horizon Discovery, 71 Cambridge

More information

Human hybridoma technology for the production of monoclonal antibodies

Human hybridoma technology for the production of monoclonal antibodies Human hybridoma technology for the production of monoclonal antibodies A new method of creating cell lines has been developed for the production of "totally human" monoclonal antibodies. Professor Hans

More information

PRODUCTION AND QUALITY CONTROL OF MONOCLONAL ANTIBODIES

PRODUCTION AND QUALITY CONTROL OF MONOCLONAL ANTIBODIES PRODUCTION AND QUALITY CONTROL OF MONOCLONAL ANTIBODIES Guideline Title Production And Quality Control Of Monoclonal Antibodies Legislative basis Directive 75/318/EEC as amended Date of first adoption

More information