Genetic Engineering. Genetically-modified animals. Goals: Be able to. How did scientists get bacteria to produce BGH? What do you know about DNA?

Size: px
Start display at page:

Download "Genetic Engineering. Genetically-modified animals. Goals: Be able to. How did scientists get bacteria to produce BGH? What do you know about DNA?"

Transcription

1 Genetic Engineering Genetically-modified animals Bovine Growth Hormone (BGH) Protein that increases milk production when injected How did scientists get bacteria to produce BGH? Goals: Be able to Describe the structure of DNA Translate DNA into protein Explain the process of gene expression Historical source: Ground up cows New source: Bacteria The structure of Deoxyribonucleic acid What do you know about DNA? Fig

2 The structure of DNA Nucleotide contains: Nitrogenous base Each DNA subunit: nucleotide Phosphate Sugar Fig 2.13 Fig 2.13 Nitrogenous bases Sugarphosphate backbone Fig 2.13 Fig 2.13 N-bases on one side base pair with partner on the other Fig 2.13 Fig

3 Why is it important for DNA to have matching base pairing? GENE: DNA sequence that encodes a protein How do DNA instructions result in proteins? Gene expression!! DNA vs. RNA U instead of T Transcription Translation DNA RNA Protein Fig 8.3 DNA nucleotide Functional differences RNA nucleotide Fig 8.2 mrna is transcribed from DNA Nucleotides Why is it important that RNA make proteins, not DNA itself? RNA polymerase Transcription: Creating RNA from DNA template mrna = messenger RNA Fig 8.4 3

4 Gene expression Keratin DNA Transcription Translation RNA Protein Fig 8.3 Fibroin Lactase The genetic code translates between RNA language and protein language trna is the translator molecule Protein 3 mrna nucleotides = codon = 1 amino acid RNA Fig 8.6 4

5 mrna and trna meet in the Ribosome Ribosome assembles protein: trna brings in amino acid that matches mrna codon Attaches amino acids in a string Fig 8.5 Fig 8.7 String of amino acids = protein Enzyme, etc Real-time translation Fig 8.7 Genetic mutation: Altered DNA nucleotide Gene mutations different amino acid different protein Why could a genetic mutation lead to a nonfunctional protein? Fig 8.8 Cystic fibrosis movie Fig 8.8 5

6 What protein would this DNA sequence make? TACCCGGGGAAGAAATTCACT TACCCGGGGAAGAAATTCACT What protein would this DNA sequence make? TACCCGGGGAAGAAATTCACT AUGGGCCCCUUCUUUAAGUGA mrna AUG GGC CCC UUC UUU AAG UGA met -gly-pro -phe-phe-lys-stop Which of the following plays a role first during gene expression? A. RNA polymerase B. Ribosome C. trna D. mrna transcript A DNA strand that has the nucleotides A C G A G would produce an RNA strand that read A. T G C T C B. A C G A G C. U G C U C D. G T A G A 6

7 Bovine Growth Hormone (BGH) How did scientists get bacteria to produce BGH? What would YOU do? Goals: Be able to Define genetic engineering Describe the basic steps involved in genetic engineering List some applications of genetic engineering Explain how to engineer an animal Explain how the Ti plasmid works Support a position on genetic engineering using scientific arguments 1. Isolate gene of interest Genetic engineering: Using technology to change genes in an organism 1. Isolate gene of interest 2. Put gene into vehicle 3. Vehicle puts new gene into organism 2. Put gene into vehicle 3. Vehicle puts new gene into organism Fig Isolate gene of interest: Remove gene from cow chromosome Use biological scissors: restriction enzymes Fig 8.12 Restriction enzymes cut DNA only at specific sequences 7

8 2. Put gene into vehicle: Bacterial plasmid Fig 8.12 Use SAME restriction enzymes to cut plasmid Sticky ends base pair Plasmid is recombinant: contains DNA from >1 source rbgh 3. Vehicle puts gene into new organism: Bacteria uptakes plasmid Bacteria are promiscuous TRANSFORMATION Bacteria are now transgenic Free DNA Fig 8.12 Bacterial DNA Plasmid Bacteria produce large amounts of cheap rbgh Design your own multiple choice question about the process of genetic engineering. Test it on your friend. Farmers inject the protein into cows Fig

9 Human insulin produced in E. coli bacteria Is this genetically engineering humans? If not, what was engineered? How do you feel about genetically engineering bacteria? Socioeconomic Implications rbgh Are farmers benefiting from using rbgh? Monsanto vs. Oakhurst Humans were not the first genetic engineers Fig 10.1 Gene Therapy Viruses inject their own genes Viral genes make new viruses What is being genetically engineered here? Viruses inject non-mutant (normal) gene Fig

10 What are some reasons people want to genetically engineer foods? More production (bigger) Genetically-engineered foods and crops What are some reasons people want to genetically engineer foods? More production (bigger) Healthier foods Golden rice What are some reasons people want to genetically engineer foods? More production (bigger) Healthier foods Herbicide-resistant plants Insect-resistant plants What are some reasons people want to genetically engineer foods? More production (bigger) Healthier foods Herbicide-resistant plants Insect-resistant plants Pharm aceutical organisms PHARM ANIMALS Cystic fibrosis proteins Multiple sclerosis proteins 10

11 Creating completely transgenic animals Insert genes into animal embryos, then transplant into surrogate mother. egg Inject genes GM sheep Should we allow genetic engineering of humans in order to prevent incurable diseases? Genetic engineering of humans? Plant genetic engineering Use a gene gun Engineering plants Fig 8.16 Genetic engineering by bacteria Ti (tumor-inducing) plasmid Ti plasmid of Agrobacterium tumefaciens food synthesis Plant hormones T-DNA: transferred to plant Fig 8.15 opbs.okstate.edu/ ~petracek/chapter%

12 T-DNA on plasmid Ti plasmid Agrobacterium tumefaciens Bacteria cuts T-DNA from its plasmid Agrobacterium T-DNA inserted into plant chromosome Movie New gene Ti plasmid with new gene instead of T-DNA Recombine engineered Ti plasmid with Agrobacterium Why are plants able to read genetic instructions from bacteria? Agrobacterium infects plant and inserts new gene into plant chromosome Humans have been modifying organisms for thousands of years What s different now? 12

13 Genetic engineering: What s different from breeding? Shorter time period than traditional breeding. Exchange of genes between organisms that cannot mate in nature. GM foods and human health What happens to the DNA that we eat? GM foods and human health DNA is not an allergen Some proteins are allergens GM crops and the environment Risks to nontarget organisms GM crops and the environment GM crops and the environment Risks to nontarget organisms Bacillus thuringiensis (Bt) makes toxic protein Bt gene engineered into corn so it produces toxic protein Fig 8.19 Problem: toxin kills ALL caterpillars 13

14 GM crops and the environment Risks to nontarget organisms Evolution of resistant pests and weeds Round-up Ready plants are herbicideresistant Encourages farmers to spray more herbicide Herbicide resistance can also spread in weeds GM crops and the environment Risks to nontarget organisms Evolution of resistant pests and weeds Threats to native diversity Roundup-Ready canola Escape and competition Biological systems are more unpredictable than physical systems Human safety and human error. StarLink corn (Marvier and VanAcker 2005) 14

15 Do you think that genetically-engineered products should be labeled? Why or why not? How do genetic engineers get genes into bacteria? A. They shoot them with a gene gun. B. They inject the DNA into an egg nucleus. C. They cut open the bacteria using restriction enzymes. D. They incorporate genes into plasmids, which bacteria take up from their surroundings. E. Bacteria cannot be genetically engineered. Which of the following is a true statement? A. A farmer injects rbgh into cows. She is genetically engineering the cows. B. A doctor injects recombinant human insulin into a child. He is engineering the child. C. A doctor injects engineered viruses into a patient in order to modify her DNA. He is engineering the patient. Why does Agrobacterium tumefaciens engineer plants? A. To make the plant produce toxic Bt proteins. B. To make the plant produce food and a home for it. C. To make the plant produce rbgh. D. Agrobacterium does not engineer plants. Humans use its Ti plasmid. Which of the following is NOT a valid argument against genetic engineering? A. It is unnatural. B. Genes may escape into wild relatives. C. Proteins produced may have affects on nontarget organisms. D. Insect pests and weeds may become resistant due to overuse of engineered products. 15

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

GENE CLONING AND RECOMBINANT DNA TECHNOLOGY

GENE CLONING AND RECOMBINANT DNA TECHNOLOGY GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2 Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Lesson 13 Genetic modification

Lesson 13 Genetic modification 77 Lesson 13 modification 78 modification Suitable for: 14 16 years Curriculum and learning links: modification Learning objectives: Describe the process of genetic modification. Explain some of the ethical

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

GCSE BITESIZE Examinations

GCSE BITESIZE Examinations GCSE BITESIZE Examinations General Certificate of Secondary Education AQA SCIENCE A BLY1B Unit Biology B1b (Evolution and Environment) AQA BIOLOGY Unit Biology B1b (Evolution and Environment) HIGHER TIER

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

RNA: Transcription and Processing

RNA: Transcription and Processing 8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

HUMAN PROTEINS FROM GENETIC ENGINEERING OF ORGANISMS

HUMAN PROTEINS FROM GENETIC ENGINEERING OF ORGANISMS HUMAN PROTEINS FROM GM BACTERIA Injecting insulin is an everyday event for many people with diabetes. GENETIC ENGINEERING OF ORGANISMS involves transferring genes from one species into another. Genetic

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle

More information

a mutation that occurs during meiosis results in a chromosomal abnormality B.

a mutation that occurs during meiosis results in a chromosomal abnormality B. Biotechnology 1. Which of the following is an example of gene splicing? a segment of human DNA is inserted into the DNA sequence of a bacterium a mutation that occurs during meiosis results in a chromosomal

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

FAQs: Gene drives - - What is a gene drive?

FAQs: Gene drives - - What is a gene drive? FAQs: Gene drives - - What is a gene drive? During normal sexual reproduction, each of the two versions of a given gene has a 50 percent chance of being inherited by a particular offspring (Fig 1A). Gene

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Section 16.1 Producing DNA fragments

Section 16.1 Producing DNA fragments Section 16.1 Producing DNA fragments Recombinant DNA combined DNA of two different organisms The process of using DNA technology to make certain proteins is as follows: 1.) Isolation of the DNA fragments

More information

Gene Switches Teacher Information

Gene Switches Teacher Information STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

How Cancer Begins???????? Chithra Manikandan Nov 2009

How Cancer Begins???????? Chithra Manikandan Nov 2009 Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell

More information

Biotechnology. Biology. Grade 10-12 LEARNING OUTCOMES DESCRIPTION READINESS ACTIVITIES MATERIALS. Science

Biotechnology. Biology. Grade 10-12 LEARNING OUTCOMES DESCRIPTION READINESS ACTIVITIES MATERIALS. Science Biotechnology Science Grade 10-12 Classroom Individual reading DESCRIPTION Biotechnology is a relatively new science with direct applications to the Agriculture industry. This article describes some of

More information

Respiration occurs in the mitochondria in cells.

Respiration occurs in the mitochondria in cells. B3 Question Which process occurs in the mitochondria in cells? Why do the liver and muscle cells have large number of mitochondria? What is the function of the ribosomes? Answer Respiration occurs in the

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Milestones of bacterial genetic research:

Milestones of bacterial genetic research: Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Blue Print III Biology. Class XII. Genetics and Evolution 2 (2) 4 (2) 9 (3) 5 (1) 20 (8) Types of Questions VSA SA II SA I LA Total

Blue Print III Biology. Class XII. Genetics and Evolution 2 (2) 4 (2) 9 (3) 5 (1) 20 (8) Types of Questions VSA SA II SA I LA Total Blue Print III Biology Class XII Types of Questions VSA SA II SA I LA Total Units (1 mark) ( marks) (3 marks) (5 marks) - Sexual Reproduction () 4 () 6 () _ 1 (6) Genetics and Evolution () 4 () 9 (3) 5

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

The E. coli Insulin Factory

The E. coli Insulin Factory The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria

More information

Review Packet- Modern Genetics

Review Packet- Modern Genetics Review Packet- Modern Genetics Name 1. Base your answer to the following question on The type of molecule represented below is found in organisms. 3. The diagram below represents a structure found in most

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Organelle Speed Dating Game Instructions and answers for teachers

Organelle Speed Dating Game Instructions and answers for teachers Organelle Speed Dating Game Instructions and answers for teachers These instructions should accompany the OCR resources GCSE (9 1) Combined Science 21 st Century Science B Organelle Speed Dating Game learner

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

Animal Pharming: The Industrialization of Transgenic Animals December 1999

Animal Pharming: The Industrialization of Transgenic Animals December 1999 Animal Pharming: The Industrialization of Transgenic Animals December 1999 Animal pharming, the process of using transgenic animals to produce human drugs, is staking its claim in a lucrative world market.

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

GCSE BITESIZE Examinations

GCSE BITESIZE Examinations GCSE BITESIZE Examinations General Certificate of Secondary Education AQA SCIENCE A BLY1B Unit Biology B1b (Evolution and Environment) AQA BIOLOGY Unit Biology B1b (Evolution and Environment) FOUNDATION

More information

Biotechnology and its Applications

Biotechnology and its Applications Chapter 12 Biotechnology and its Applications IMPORTANT TERMS 1. Biotechnology: It is a branch of science that deals with industrial scale production of biopharmaceuticals and biological using genetically

More information