Genetic Engineering. Genetically-modified animals. Goals: Be able to. How did scientists get bacteria to produce BGH? What do you know about DNA?
|
|
- Jonas Collins
- 7 years ago
- Views:
Transcription
1 Genetic Engineering Genetically-modified animals Bovine Growth Hormone (BGH) Protein that increases milk production when injected How did scientists get bacteria to produce BGH? Goals: Be able to Describe the structure of DNA Translate DNA into protein Explain the process of gene expression Historical source: Ground up cows New source: Bacteria The structure of Deoxyribonucleic acid What do you know about DNA? Fig
2 The structure of DNA Nucleotide contains: Nitrogenous base Each DNA subunit: nucleotide Phosphate Sugar Fig 2.13 Fig 2.13 Nitrogenous bases Sugarphosphate backbone Fig 2.13 Fig 2.13 N-bases on one side base pair with partner on the other Fig 2.13 Fig
3 Why is it important for DNA to have matching base pairing? GENE: DNA sequence that encodes a protein How do DNA instructions result in proteins? Gene expression!! DNA vs. RNA U instead of T Transcription Translation DNA RNA Protein Fig 8.3 DNA nucleotide Functional differences RNA nucleotide Fig 8.2 mrna is transcribed from DNA Nucleotides Why is it important that RNA make proteins, not DNA itself? RNA polymerase Transcription: Creating RNA from DNA template mrna = messenger RNA Fig 8.4 3
4 Gene expression Keratin DNA Transcription Translation RNA Protein Fig 8.3 Fibroin Lactase The genetic code translates between RNA language and protein language trna is the translator molecule Protein 3 mrna nucleotides = codon = 1 amino acid RNA Fig 8.6 4
5 mrna and trna meet in the Ribosome Ribosome assembles protein: trna brings in amino acid that matches mrna codon Attaches amino acids in a string Fig 8.5 Fig 8.7 String of amino acids = protein Enzyme, etc Real-time translation Fig 8.7 Genetic mutation: Altered DNA nucleotide Gene mutations different amino acid different protein Why could a genetic mutation lead to a nonfunctional protein? Fig 8.8 Cystic fibrosis movie Fig 8.8 5
6 What protein would this DNA sequence make? TACCCGGGGAAGAAATTCACT TACCCGGGGAAGAAATTCACT What protein would this DNA sequence make? TACCCGGGGAAGAAATTCACT AUGGGCCCCUUCUUUAAGUGA mrna AUG GGC CCC UUC UUU AAG UGA met -gly-pro -phe-phe-lys-stop Which of the following plays a role first during gene expression? A. RNA polymerase B. Ribosome C. trna D. mrna transcript A DNA strand that has the nucleotides A C G A G would produce an RNA strand that read A. T G C T C B. A C G A G C. U G C U C D. G T A G A 6
7 Bovine Growth Hormone (BGH) How did scientists get bacteria to produce BGH? What would YOU do? Goals: Be able to Define genetic engineering Describe the basic steps involved in genetic engineering List some applications of genetic engineering Explain how to engineer an animal Explain how the Ti plasmid works Support a position on genetic engineering using scientific arguments 1. Isolate gene of interest Genetic engineering: Using technology to change genes in an organism 1. Isolate gene of interest 2. Put gene into vehicle 3. Vehicle puts new gene into organism 2. Put gene into vehicle 3. Vehicle puts new gene into organism Fig Isolate gene of interest: Remove gene from cow chromosome Use biological scissors: restriction enzymes Fig 8.12 Restriction enzymes cut DNA only at specific sequences 7
8 2. Put gene into vehicle: Bacterial plasmid Fig 8.12 Use SAME restriction enzymes to cut plasmid Sticky ends base pair Plasmid is recombinant: contains DNA from >1 source rbgh 3. Vehicle puts gene into new organism: Bacteria uptakes plasmid Bacteria are promiscuous TRANSFORMATION Bacteria are now transgenic Free DNA Fig 8.12 Bacterial DNA Plasmid Bacteria produce large amounts of cheap rbgh Design your own multiple choice question about the process of genetic engineering. Test it on your friend. Farmers inject the protein into cows Fig
9 Human insulin produced in E. coli bacteria Is this genetically engineering humans? If not, what was engineered? How do you feel about genetically engineering bacteria? Socioeconomic Implications rbgh Are farmers benefiting from using rbgh? Monsanto vs. Oakhurst Humans were not the first genetic engineers Fig 10.1 Gene Therapy Viruses inject their own genes Viral genes make new viruses What is being genetically engineered here? Viruses inject non-mutant (normal) gene Fig
10 What are some reasons people want to genetically engineer foods? More production (bigger) Genetically-engineered foods and crops What are some reasons people want to genetically engineer foods? More production (bigger) Healthier foods Golden rice What are some reasons people want to genetically engineer foods? More production (bigger) Healthier foods Herbicide-resistant plants Insect-resistant plants What are some reasons people want to genetically engineer foods? More production (bigger) Healthier foods Herbicide-resistant plants Insect-resistant plants Pharm aceutical organisms PHARM ANIMALS Cystic fibrosis proteins Multiple sclerosis proteins 10
11 Creating completely transgenic animals Insert genes into animal embryos, then transplant into surrogate mother. egg Inject genes GM sheep Should we allow genetic engineering of humans in order to prevent incurable diseases? Genetic engineering of humans? Plant genetic engineering Use a gene gun Engineering plants Fig 8.16 Genetic engineering by bacteria Ti (tumor-inducing) plasmid Ti plasmid of Agrobacterium tumefaciens food synthesis Plant hormones T-DNA: transferred to plant Fig 8.15 opbs.okstate.edu/ ~petracek/chapter%
12 T-DNA on plasmid Ti plasmid Agrobacterium tumefaciens Bacteria cuts T-DNA from its plasmid Agrobacterium T-DNA inserted into plant chromosome Movie New gene Ti plasmid with new gene instead of T-DNA Recombine engineered Ti plasmid with Agrobacterium Why are plants able to read genetic instructions from bacteria? Agrobacterium infects plant and inserts new gene into plant chromosome Humans have been modifying organisms for thousands of years What s different now? 12
13 Genetic engineering: What s different from breeding? Shorter time period than traditional breeding. Exchange of genes between organisms that cannot mate in nature. GM foods and human health What happens to the DNA that we eat? GM foods and human health DNA is not an allergen Some proteins are allergens GM crops and the environment Risks to nontarget organisms GM crops and the environment GM crops and the environment Risks to nontarget organisms Bacillus thuringiensis (Bt) makes toxic protein Bt gene engineered into corn so it produces toxic protein Fig 8.19 Problem: toxin kills ALL caterpillars 13
14 GM crops and the environment Risks to nontarget organisms Evolution of resistant pests and weeds Round-up Ready plants are herbicideresistant Encourages farmers to spray more herbicide Herbicide resistance can also spread in weeds GM crops and the environment Risks to nontarget organisms Evolution of resistant pests and weeds Threats to native diversity Roundup-Ready canola Escape and competition Biological systems are more unpredictable than physical systems Human safety and human error. StarLink corn (Marvier and VanAcker 2005) 14
15 Do you think that genetically-engineered products should be labeled? Why or why not? How do genetic engineers get genes into bacteria? A. They shoot them with a gene gun. B. They inject the DNA into an egg nucleus. C. They cut open the bacteria using restriction enzymes. D. They incorporate genes into plasmids, which bacteria take up from their surroundings. E. Bacteria cannot be genetically engineered. Which of the following is a true statement? A. A farmer injects rbgh into cows. She is genetically engineering the cows. B. A doctor injects recombinant human insulin into a child. He is engineering the child. C. A doctor injects engineered viruses into a patient in order to modify her DNA. He is engineering the patient. Why does Agrobacterium tumefaciens engineer plants? A. To make the plant produce toxic Bt proteins. B. To make the plant produce food and a home for it. C. To make the plant produce rbgh. D. Agrobacterium does not engineer plants. Humans use its Ti plasmid. Which of the following is NOT a valid argument against genetic engineering? A. It is unnatural. B. Genes may escape into wild relatives. C. Proteins produced may have affects on nontarget organisms. D. Insect pests and weeds may become resistant due to overuse of engineered products. 15
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationGenetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
More informationa. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationGENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
More informationName: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
More informationThymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationProvincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationBasic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More information12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
More informationProtein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
More informationDNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
More informationLesson 13 Genetic modification
77 Lesson 13 modification 78 modification Suitable for: 14 16 years Curriculum and learning links: modification Learning objectives: Describe the process of genetic modification. Explain some of the ethical
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationPRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationGenetic Engineering and Biotechnology
1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationFrom DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationCCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationRNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
More informationGCSE BITESIZE Examinations
GCSE BITESIZE Examinations General Certificate of Secondary Education AQA SCIENCE A BLY1B Unit Biology B1b (Evolution and Environment) AQA BIOLOGY Unit Biology B1b (Evolution and Environment) HIGHER TIER
More informationAcademic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
More informationBiology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
More informationRNA: Transcription and Processing
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
More informationTransfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
More informationLab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
More informationBio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
More informationBCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
More informationRegents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationHUMAN PROTEINS FROM GENETIC ENGINEERING OF ORGANISMS
HUMAN PROTEINS FROM GM BACTERIA Injecting insulin is an everyday event for many people with diabetes. GENETIC ENGINEERING OF ORGANISMS involves transferring genes from one species into another. Genetic
More informationISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationToday you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
More informationa mutation that occurs during meiosis results in a chromosomal abnormality B.
Biotechnology 1. Which of the following is an example of gene splicing? a segment of human DNA is inserted into the DNA sequence of a bacterium a mutation that occurs during meiosis results in a chromosomal
More informationNucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
More informationReplication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationFAQs: Gene drives - - What is a gene drive?
FAQs: Gene drives - - What is a gene drive? During normal sexual reproduction, each of the two versions of a given gene has a 50 percent chance of being inherited by a particular offspring (Fig 1A). Gene
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationSection 16.1 Producing DNA fragments
Section 16.1 Producing DNA fragments Recombinant DNA combined DNA of two different organisms The process of using DNA technology to make certain proteins is as follows: 1.) Isolation of the DNA fragments
More informationGene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More informationHow Cancer Begins???????? Chithra Manikandan Nov 2009
Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer
More informationThe Molecules of Cells
The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates
More informationControl of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationPRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
More informationBiotechnology. Biology. Grade 10-12 LEARNING OUTCOMES DESCRIPTION READINESS ACTIVITIES MATERIALS. Science
Biotechnology Science Grade 10-12 Classroom Individual reading DESCRIPTION Biotechnology is a relatively new science with direct applications to the Agriculture industry. This article describes some of
More informationRespiration occurs in the mitochondria in cells.
B3 Question Which process occurs in the mitochondria in cells? Why do the liver and muscle cells have large number of mitochondria? What is the function of the ribosomes? Answer Respiration occurs in the
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationMilestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
More informationCoding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
More informationBlue Print III Biology. Class XII. Genetics and Evolution 2 (2) 4 (2) 9 (3) 5 (1) 20 (8) Types of Questions VSA SA II SA I LA Total
Blue Print III Biology Class XII Types of Questions VSA SA II SA I LA Total Units (1 mark) ( marks) (3 marks) (5 marks) - Sexual Reproduction () 4 () 6 () _ 1 (6) Genetics and Evolution () 4 () 9 (3) 5
More informationComplex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More informationThe E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
More informationReview Packet- Modern Genetics
Review Packet- Modern Genetics Name 1. Base your answer to the following question on The type of molecule represented below is found in organisms. 3. The diagram below represents a structure found in most
More informationAP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
More informationOrganelle Speed Dating Game Instructions and answers for teachers
Organelle Speed Dating Game Instructions and answers for teachers These instructions should accompany the OCR resources GCSE (9 1) Combined Science 21 st Century Science B Organelle Speed Dating Game learner
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationMultiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationViruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope
Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron
More informationBob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
More informationDNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
More informationAnimal Pharming: The Industrialization of Transgenic Animals December 1999
Animal Pharming: The Industrialization of Transgenic Animals December 1999 Animal pharming, the process of using transgenic animals to produce human drugs, is staking its claim in a lucrative world market.
More information2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
More informationGCSE BITESIZE Examinations
GCSE BITESIZE Examinations General Certificate of Secondary Education AQA SCIENCE A BLY1B Unit Biology B1b (Evolution and Environment) AQA BIOLOGY Unit Biology B1b (Evolution and Environment) FOUNDATION
More informationBiotechnology and its Applications
Chapter 12 Biotechnology and its Applications IMPORTANT TERMS 1. Biotechnology: It is a branch of science that deals with industrial scale production of biopharmaceuticals and biological using genetically
More information