BOR-Papers in Press. Published as DOI: /biolreprod

Transcription

1 Lorenzon-Ojea et al., Supplemental Figure S1: Diagram of human placenta. The illustration indicates in black squares the placental regions dissected for this study: villi, decidua/basal plate, chorionic plate and smooth chorionic membrane.

2 Lorenzon-Ojea et al., Supplemental Figure 2S: SDF2 protein expression mapping. Part 1) Western blotting analysis. V: villi; M: chorionic membrane; D: decidua; BP: Basal Plate; SC: smooth chorionic membrane; CP: chorionic plate. (A) First trimester placenta shows SDF2 expression increased in

3 decidua. (B) No statistical difference is seen in second trimester placental compartments. (C) At term, smooth chorionic membrane shows an increase in SDF2 increased compared to chorionic plate. (D) Smooth chorionic membrane at term shows higher SDF2 levels than in other gestational phases and compared to chorionic plate. Beta-actin was used for loading control. Values are plotted as mean with SD. *p 0.05, **p 0.01 and ***p Part 2) Immunofluorescence weeks placenta. SDF2 in red, cytokeratin (CTK) in green, and nuclei in blue (DAPI). (A-F) Smooth chorionic membrane. SDF2 is expressed in chorionic and amniotic epithelium and stroma. Negative controls (no primary antibody incubation) are on the right of each column Bar in A-C = 100 µm and in D-F = 50 µm.

4 Lorenzon-Ojea et al., Supplemental Figure S3: Positive control for Caspase 3 antibody in detection of cleaved isoforms. BeWo cells were treated with 0.5 µm staurosporine for 24 h and submitted to Western Blot for Caspase 3 detection. All cleaved isoforms (20, 17 and 11 kda) and full lenght pro-caspase (32 kda) were detected, which confirms antibody specificity.

5 Lorenzon-Ojea et al., Supplemental Figure S4: Caspase 3/7 activity, ATP production and caspase/atp ratio with staurosporine (positive control for cell death). BeWo cells showed increase in caspase 3/7 activity and decrease in ATP production when treated with staurosporine (0.5 µm for 24 h). The caspase/atp ratio is increased (cell death) with staurosporine treatment. Values are plotted as mean with SD. ANOVA, ***p

6 BOR-Papers in Press. Published as DOI: /biolreprod Lorenzon-Ojea et al., Supplemental Figure S5: Double-staining of SDF-2 in different cell types using immunofluorescence. (A-D) late first trimester villi: SDF2 in red, CD68 in green (Hofbauer cells); (E-H) primary human umbilical vein endothelial cells (HUVEC): SDF2 in red, von Willebrand Factor in green. Negative controls on the right of each column were not incubated with primary antibodies. Bar in A-B; E-F = 100 µm; in C-D; G-H = 50 µm.

7 Lorenzon-Ojea et al., Supplemental Figure S6: Caspase 3/7 activity quantification in BeWo cells silenced and treated with tunicamycin 5.0 µg/ml (black bars), not silenced and treated with tunicamycin (grey bars) and controls (white bars). Activity of caspase is decreased after 3 and 6 hours of tunicamycin treatment in SDF2 silenced cells when compared with silenced cells that received only DMSO. Values are plotted as mean with SD. One- way ANOVA, *p 0.05.

8 Lorenzon-Ojea et al., Supplemental Figure S7: ATP production quantification in BeWo cells silenced and treated with tunicamycin 5.0 µg/ml (black bars), not silenced and treated with tunicamycin (grey bars) and controls (white bars). Cells treated with tunicamycin but not silenced for SDF2 after 24 h shows decrease in ATP production when compared to cells also treated with tunicamycin after 3 h. Values are plotted as mean with SD. ANOVA, **p 0.01.

9 Lorenzon-Ojea et al., Supplemental Table S1. Antibodies and concentrations for Immunofluorescence Assays. Protein Antibody Concentration SDF2 Human anti-sdf2 polyclonal produced in rabbit (Sigma) 1:50 Cytokeratin Cytokeratin-7 Vimentin Integrin alpha 6 (CD49f) Human anti-cytokeratin from CTB (7D3) monoclonal produced in rat (Damsky et al., 1992) Human anti-cytokeratin-7 (clone OV-TH 12/30) monoclonal produced in mouse (Dako) Human anti-vimentin (SP20) monoclonal produced in rabbit (Abcam) Human anti-integrin alpha6 [CD49f] monoclonal antibody produced in rat (Chemicon) 1:100 1:100 1:50 1:50 E-Cadherin Von Willebrand Human anti-e-cadherin polyclonal produced in rabbit (Abcam) Human anti-von Willebrand Factor (F8/86) monoclonal produced in mouse (Dako) 1:50 1:100 HIF 1α Human anti-hif1α polyclonal produced in rabbit (Cell Signalling) 1:50 CD68 Human anti-cd68 (clone KP1) monoclonal produced in mouse (Invitrogen, Life Technologies) 1:100 2 nd anti-rabbit Donkey anti-rabbit IgG (H + L) Rhodamine (TRITC) Jackson ImmoResearch 2 nd anti-rabbit Donkey anti-rabbit IgG (H + L) Fluorescein (FITC) Jackson ImmoResearch 2 nd anti-rat Donkey anti-rat IgG(H + L) Rhodamine (TRITC) Jackson ImmoResearch 2 nd anti-rat Donkey anti-rat IgG(H + L) Fluorescein (FITC) Jackson ImmoResearch 1:1000 1:1000 1:1000 1: nd anti-mouse Donkey anti-mouse IgG(H + L) Fluorescein (FITC) Jackson ImmoResearch 1: nd anti-mouse Donkey anti-mouse IgG(H + L) Rhodamine (TRITC) Jackson ImmoResearch 1:1000 Reference: Damsky CH, Fitzgerald ML, Fisher SJ. Distribution patterns of extracellular matrix components and adhesion receptors are intricately modulated during first trimester cytotrophoblast differentiation along the invasive pathway, in vivo. J Clin Invest Jan;89(1):

10 Lorenzon-Ojea et al., Supplemental Table S2. Primers and amplification conditions for ER Stress Assays. Gene Primers Amplification temperature SDF2 F: 5`- AGCTTCAGCCCTGCACATTTGAAC-3` 60 C R: 5`- TCCATGATGCCAAGCTCCTGAAGA-3` sxbp1 F: 5`-TGCTGAGTCCGCAGCAGGTG-3` 62 C R: 5`-GCTGGCAGGCTCTGGGGAAG-3` CHOP F: 5` -TTAAGTCTAAGGCACTGAGCGTATC -3` 56 C R: 5` -TGCTTTCAGGTGTGGTGATG -3` YWHAZ F: 5`- GCCACAATGTTCTTGGCCCATCAT -3` 60 C R: 5`- TGGTTGGTGACAAGACAGAAGGCT-3`

11 Lorenzon-Ojea et al., Supplemental Table S3. Maternal-fetal clinical data from AGA (Appropriate for Gestational Age) and SGA (Small for Gestational Age) neonates AGA a (n=5) SGA b (n=6) p c Maternal Age (years) (± 4.75) (± 2.84) n.s Gestational Age (weeks) 38.8 (± 0.4) 38.1 (± 1.8) n.s Fetal Weight (g) (± ) (± ) p 0.05 Placental Weight (g) (± ) (± ) p 0.05 a Appropriate for Gestational Age: Neonates birth weight between the 10 th and 90 th percentile. b Small for Gestational Age: Neonates birth weight below the 10th percentile. c Two-tailed Student s t-test and non-parametric Mann-Whitney-U-post test