BINF 5445/4445. Welcome! Please let me know if you would like to discuss a particular topic. If so, I will probably be able to schedule it

Size: px
Start display at page:

Download "BINF 5445/4445. Welcome! Please let me know if you would like to discuss a particular topic. If so, I will probably be able to schedule it"

Transcription

1 BINF 5445/4445 Welcome! Please let me know if you would like to discuss a particular topic If so, I will probably be able to schedule it

2 BINF 5445/4445 This week s material: Course info and syllabus Overview of the field

3 Defining Bioinformatics (A1) To begin write down your best guess!

4 Defining Bioinformatics II We might define 3 components: Making databases of biological data Manipulation of biological data(bases) with statistics and algorithms Using software to work with biological databases using statistics and algorithms This does not mean other characterizations are incorrect

5 Defining Bioinformatics III Let s distinguish bioinformatics from Computational Biology Biology Biotechnology Databases Information Technology Computer/Information Science

6 Defining Bioinformatics IV What is a bioinformatician? a bioinformaticist? biostar.stackexchange.com/questions/1184/ bioinformaticist-vs-bioinformatician says: -ist:...member of a profession... -ician:...person skilled with a field... What do you think?

7 Defining Bioinformatics V What is a bioinformatician? a bioinformaticist? Google has the following #s of hits: Bioinformaticist 9,700 (5/28/10); 43,700 but later in the day 182,000 (8/22/11); 26,400 (8/20/13) Bioinformatician 49,500 (5/28/10); 436,000 (8/22/11); 299,000 (8/20/13)

8 The Web and Bioinformatics (A2) Without the Web, bioinformatics would truly be a shadow of what it is! There are lots of network architectures The internet one is the winning WAN (WAN?) The internet communicates by the TCP/IP protocol What s a protocol? The Web is built on the internet Like Understanding Bioinformatics is built on English The Web s protocol is http (http?) http is built using TCP/IP Analogy: you and telephones

9 The Web: Infrastructure for Bioinformatics The Web is full of name servers They are on-line databases (of what?) They contain lists of names and their IP addresses IP addresses are numerical: Names are, for example, Names are only a convenience! The Web is full of Web browsers These are the clients we know and love A Web browser uses http to get hypermedia files

10 Search Engines (A3) Early Web did not have search engines There were jump pages I used to use Then there were keyword-based engines Then linkage-based (crowd sourced) engines Customizing engines There are now also specialized engines For biological literature, sequences, etc. Can you name one? Any on-line database is a search engine!

11 The Sequencing Problem (B1) Sequence, v., to determine the order of the elementary units of a protein, or a nucleic acid You can sequence DNA, RNA, & protein Let s start with DNA

12 DNA Sequencing Principles Vocabulary Approach is called chain termination sequencing Why chain? Termination? Sequencing? Also called dideoxy sequencing Dideoxy? Also called Sanger method Sanger?

13 Dideoxy Sequencing II Key terms are Single-stranded DNA template Primer Deoxyribonucleoside triphosphates datp, dctp, dgtp, dttp Dideoxyribonucleoside triphosphates ddatp, ddctp, ddgtp, ddttp Electrophoresis

14 A Question to Consider See Figure 1, p. 11, Westhead et al. How it works: Given a 800-bp or less single DNA strand Make lots and lots of copies of it Try to build complementary strands. Use datp, dctp, dgtp, & DNA polymerase Halt the building at random places < 800 Use ddatp, ddctp,, &

15 A Question to Consider Given a 800-bp or less single DNA strand Make lots and lots of copies of it Try to build complementary strands. Use datp, dctp, dgtp, & DNA polymerase Halt the building at random places < 800 Do it in 4 batches Batch one: use ddatp, tag it with fluorescent A Batch two: use ddctp, tag it with fluorescent C Batch three and four: use, tag it with Mix batches together, read order via PAGE PAGE: polyacrylamide gel electrophoresis See Figure 1 again

16 A Question to Consider See Figures 1 and 2, p. 11, Westhead et al. Is Figure 2 the result of the rectangle part of Figure 1? Is Fig. 2 the template sequence? Example of a real demo of Figure 1.

17 Combine the 800-bp pieces Not necessarily 800 bp Shotgun sequencing: Break up long DNAs into pieces Pieces from DNA molecule 1 overlap with pieces from DNA molecule 2 Sequence the pieces Look for overlaps String it all together

18 Cost and Future Trends Source: The Singularity is Near, by Ray Kurzweil, p. 73 NIH wants Human genome for $100k by 2009: (http://www.wired.com/wiredscience/2008/07/british-institu/). So when will it be $100?

19 How to Sequence a Genome Shotgun sequencing Break DNA molecule randomly into pieces Sequence the pieces Look for overlaps to assemble the full sequence Why are there overlaps? Clone contig sequencing

20 Clone Contig Sequencing Subclones DNA fragments Does it in a rational manner, systematically - Westhead et al., p. 12 Builds up the full sequence result Is shotgun sequencing irrational? Unsystematic? Explain

21 (Supplementary Slides)

22 RNA Sequencing More variations in the base pairs than for DNA This makes sequencing more challenging than for DNA

23 Protein Sequencing Proteins are not built of nucleotides They are made from? Like with RNA, the elementary units can have various modifications modified residues or other types of modification such as cleavage [and] disulfide bonds Uses mass spectroscopy (MS) What is the basic idea of MS?

24 Quality control What would be the result of poor quality? Some vocabulary you might like to find out about: clone, contigs, repeats enjoy the HW!

25 Single Pass Sequencing Quality is a problem

26 Kinds of DNA Genomic DNA mtdna Coding DNA Noncoding DNA cdna Recombinant DNA Which is found in the chromosomes? Which is not found in the cell of interest? Which has more junk? Less junk?

eculab MolecuLab 45 DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA

eculab MolecuLab 45 DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA Mo eculab DNA Sequencing - A Classroom Exercise Student Manual 950 Walnut Ridge Drive Hartland, WI 53029-9388 USA Revision 11/2011 Student Manual BACKGROUND DNA sequencing technology was developed in the

More information

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides. DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin.

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing DNA sequencing Dideoxy-terminating sequencing or Sanger dideoxy sequencing Tools DNA template (single stranded) Specific primer (usually 17-23 mer, free 3 -OH) dntps DNA polymerase capacity of polymerizing

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Site-directed mutagenesis

Site-directed mutagenesis Site-directed mutagenesis Adrian Suarez Covarrubias Modified from Sherry Mowbray s 1 Content DNA, PCR, oligonucleotides Reverse PCR mutagenesis Quick change mutagenesis Multi-change mutagenesis Oligonucleotide

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Polyacrylamide gels have a pore size of only a few nm

Polyacrylamide gels have a pore size of only a few nm Gel electrophoresis Gel electrophoresis Separates - DNA fragments (single nucleotide resolution) - proteins - Protein-DNA complexes can be analyzed by gel electrophoresis native - denatured gel-electrophoresis

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

DNA Sequence Analysis Tutorial Genetics Laboratory

DNA Sequence Analysis Tutorial Genetics Laboratory DNA Sequence Analysis Tutorial Genetics Laboratory By Jason Evans, Luke Sheneman and Celeste Brown 1 What is VectorNTI? From the Informax website: VectorNTI equips laboratories with an extensive range

More information

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure Chapter 11 DNA replication, repair and recombination Overview Brief introduction DNA replication DNA repair DNA recombination DNA replication is essential for life Introduction Cells divide and make copies

More information

Primer on Molecular Genetics

Primer on Molecular Genetics Primer on Molecular Genetics 1 DOE Human Genome Program Primer on Molecular Genetics Date Published: June 1992 U.S. Department of Energy Office of Energy Research Office of Health and Environmental Research

More information

Biotechnology Explorer. Planning Guide

Biotechnology Explorer. Planning Guide Biotechnology Explorer Cloning and Sequencing Explorer Series Catalog #166-5000EDU Planning Guide explorer.bio-rad.com Note: This document is for planning purposes only and may vary from the final product

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145

Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 Bioinformatics I, WS 09-10, D. Huson, January 27, 2010 145 10 DNA sequencing This exposition is very closely based on the following sources, which are all recommended reading: 1. Clyde A. Hutchison, DNA

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives

LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives 9 Analyzing DNA Sequences and DNA Barcoding Introduction DNA sequencing is performed by scientists in many different fields of biology. Many bioinformatics programs are used during the process of analyzing

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

Modified Genetic Algorithm for DNA Sequence Assembly by Shotgun and Hybridization Sequencing Techniques

Modified Genetic Algorithm for DNA Sequence Assembly by Shotgun and Hybridization Sequencing Techniques International Journal of Electronics and Computer Science Engineering 2000 Available Online at www.ijecse.org ISSN- 2277-1956 Modified Genetic Algorithm for DNA Sequence Assembly by Shotgun and Hybridization

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Lecture 18: Protein Sequencing

Lecture 18: Protein Sequencing Lecture 18: Protein Sequencing Frederic Sanger first time achieved complete sequence of protein (bovine insulin) in 1953. For his work, he was awarded the Nobel Prize of Chemistry in (1958). Protein sequencing

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?

4.2.1. What is a contig? 4.2.2. What are the contig assembly programs? Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files

More information

Gene Cloning and DNA Analysis: An Introduction

Gene Cloning and DNA Analysis: An Introduction Gene Cloning and DNA Analysis: An Introduction Brown, Terry A. ISBN-13: 9781405111218 Table of Contents PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Department of Biology Sample

Department of Biology Sample Syllabus BIOTECHNOLOGY Spring 2013 Instructor: Atanu Duttaroy, Professor Tel: 202-806-5362 Email: aduttaroy@howard.edu Office: Room 336, Just Hall Teaching Assistant: Mr. Subhas Mukherjee Lecture: Room

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Genome Sequence Quality. When looking at sequence: Caveat emptor

Genome Sequence Quality. When looking at sequence: Caveat emptor When looking at sequence: Caveat emptor Caveat emptor A phrase in Latin. It is a commonly cited axiom or principle in commerce that the buyer alone is responsible for assessing the quality of a purchase

More information

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)? 1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Nucleic Acids Research

Nucleic Acids Research Volume 5 Number 12 December 1978 Nucleic Acids Research A method for sequencing restriction fragments with dideoxynucleoside triphosphates Jan Maat* and Andrew J.H.Smith+ *Department of Physiological Chemistry,

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

Contig Assembly. DNA Sequencing

Contig Assembly. DNA Sequencing Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.. TAGCTACGCATCGT ATCGATGCGTAGC TAGCAGACTACCGTT GTTACGATGCCTT David Wishart, Ath 3-41 david.wishart@ualberta.ca DNA

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

next two week lectures: sequence alignment and genome assembly

next two week lectures: sequence alignment and genome assembly BASICS ON MOLECULAR BIOLOGY Cell DNA RNA protein Sequencing methods arising questions for handling the data, making sense of it next two week lectures: sequence alignment and genome assembly Cells Fundamental

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Reading DNA Sequences:

Reading DNA Sequences: Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19 Health and Life Sciences Faculty Course Title: Biological and Forensic Science Module code: 216 BMS Module Title: Molecular Genetics Overview of the Recombinant DNA technology- the process of subcloning

More information

Human Leukocyte Antigens - HLA

Human Leukocyte Antigens - HLA Human Leukocyte Antigens - HLA Human Leukocyte Antigens (HLA) are cell surface proteins involved in immune function. HLA molecules present antigenic peptides to generate immune defense reactions. HLA-class

More information