Irish Genes and Ancestry
|
|
|
- Eric Mills
- 7 years ago
- Views:
Transcription
1 Irish Genes and Ancestry Dr. Gianpiero Cavalleri Eneclann Summer Lunchtime Series 2012 Detailed genetic ancestry information through state of the art gene analysis
2 Overview.. Introduction to DNA, Y chromosome, mtdna How DNA has informed us about global population history Patterns of Y chromosome types we see in Ireland How genetics can inform on genealogy Sources for more information
3 3 billion letter archive written in ACGT Only small portion of our DNA (the genes) encodes instructions to build a human Changes (mutations) occur in our DNA with each generation These chages are inherited down through generations ~99.9% of our DNA is identical
4
5 Single nucleotide polymorphism (SNP) CGTACTATGACCCGAGCTAGCCCTA CGTACGATGACCCAAGCTAGCCCTA Pat Jack M269 M182 Microsatellite/short tandem repeat (STR) CCGTGCATGCATGCATGCATGCACC CCGTGCATGCATGCATGCATGCATGCACC Pat (5 copies) Jack (6 copies) DYS19 T at M269 + G at M copies at DYS19 = haplotype i.e. combination = haplotype
6 Groups and types found at different frequencies in different populations Isolation (i.e. within population marriage) and fact that some people have more (grand)children than others % Isolation! Distance between spouse birthplaces for all marriages ? distance (miles) Basis of all genetic history work
7 mtda mtdna tree Y chromosome tree
8 The evolution of modern humans.. Homo erectus Approx mya Radiated from Africa to Europe & Asia
9 Homo sapiens spread and diversified, moving out of Africa approx 100 kya Early migration towards South East Asia approx kya Later migration towards Eurasia kya As a consequence we expect to observe in non-africans, a subset of genetic variation present in modern African populations
10 ~150k years ago ~80k years ago R1b across Europe.. ~60k years ago ~40k years ago ~25k years ago LGM ~18k years ago
11 Data courtesy of JF Wilson
12 Discovered in November 2008 Subtype of R1b Found in 73% Irish, 50% Scots, 40% English Very rare in continent Proof of commonality among original inhabitants of the islands Probably palaeolithic origins (>10,000 years)
13 Ui Neill type.. Very common in Ireland, virtually absent elsewhere Origin around years ago Data courtesy of JF Wilson
14 Appears specific to Munster & associated with Eoghanacht surnames Data courtesy of JF Wilson
15 Found at high frequency around Holland,N. Germany, Denmark Probably arrived in Britain recently Iron age? Anglo- Saxon invasions? Data courtesy of JF Wilson
16 M17 and the Sea Road.but not to Dublin Data courtesy of JF Wilson
17 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19:
18 38,000 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19:
19 60,000 66,000 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19:
20 What about the rest of our DNA? (chromosomes 1 22) PCA using GWAS data Novembre J. Genes mirror geography within Europe. Nature Nov 6;456(7218): Cluster resolved above reflect ancient fissions in demographic history
21
22 IrelandsDNA.com - highest resolution for markers of Irish and British ancestry FTDNA.com Good for surname projects 23&me.com Combined health & history results DNA Atlas Ireland: See: Contact details: Dr. Gianpiero Cavalleri gcavalleri@rcsi.ie
23
Y Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo.
Section 3: Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo. K What I Know W What I Want to Find Out L What I Learned Essential
Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine.
Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. The past two decades have witnessed an explosion of human genetic data. Innumerable
From Africa to Aotearoa Part 1: Out of Africa
From Africa to Aotearoa Part 1: Out of Africa The spread of modern humans out of Africa started around 65,000 years ago, and ended with the settlement of New Zealand 750 years ago. These PowerPoint presentations
Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft
Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Manuscript Number: Title: A comment on the Paper: A comparison of Y-chromosomal lineage dating using either resequencing
Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the
Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has
The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample.
DNA testing Thanks for your enquiry about DNA testing. I oversee the Scottish DNA Project on behalf of the University of Strathclyde, Glasgow and act as representative for Family Tree DNA who host our
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Directions: Arabian Peninsula Croatia India Asia Indonesia Papua New Guinea
In this activity, students will use a variety of skills to complete the tasks, including close reading and comprehension abilities, researching, and mapping. The reading part of this activity requires
SNP Essentials The same SNP story
HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than
The Story of Human Evolution Part 1: From ape-like ancestors to modern humans
The Story of Human Evolution Part 1: From ape-like ancestors to modern humans Slide 1 The Story of Human Evolution This powerpoint presentation tells the story of who we are and where we came from - how
Rethinking Polynesian Origins: Human Settlement of the Pacific
LENScience Senior Biology Seminar Series Rethinking Polynesian Origins: Human Settlement of the Pacific Michal Denny, and Lisa Matisoo-Smith Our Polynesian ancestors are renowned as some of the world s
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
I Have the Results of My Genetic Genealogy Test, Now What?
I Have the Results of My Genetic Genealogy Test, Now What? Version 2.1 1 I Have the Results of My Genetic Genealogy Test, Now What? Chapter 1: What Is (And Isn t) Genetic Genealogy? Chapter 2: How Do I
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Level 3 Biology, 2012
90719 907190 3SUPERVISOR S Level 3 Biology, 2012 90719 Describe trends in human evolution 2.00 pm Tuesday 13 November 2012 Credits: Three Check that the National Student Number (NSN) on your admission
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Phillips DNA News. Project News. www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser
2011 The Phillips DNA Project Phillips DNA News www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser Please submit news articles or ideas for articles to the editor. Questio ns about
Geographic Patterns of Haplogroup R1b in the British Isles
Geographic Patterns of Haplogroup R1b in the British Isles Journal of Genetic Genealogy 3:1-13, 2007 Kevin D. Campbell Abstract The recent availability of Y-STR databases has provided the opportunity to
( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years.
Frequently asked questions about A Genetic Atlas of Human Admixture History G. Hellenthal, G.B.J. Busby, G. Band, J.F. Wilson, C. Capelli, D. Falush, S. Myers, Science (2014) SUMMARY What is your work
NORSE VIKING HERITAGE
NORSE VIKING HERITAGE My mother's maiden name is WILLIAMSON. Her ancestors in the paternal line came from the Shetland Islands. The Shetland Islands were settled by Norse Vikings beginning before 800 AD.
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008)
What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008) The most common question I receive from people whose DNA results are returned to them is what do I do now? I ve put together
Biomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona
Matthew Kaplan and Taylor Edwards University of Arizona Tucson, Arizona Unresolved paternity Consent for testing Ownership of Samples Uncovering genetic disorders SRY Reversal / Klinefelter s Syndrome
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
RACE. By Michael J. Bamshad and Steve E. Olson
DOES RACE EXIST By Michael J. Bamshad and Steve E. Olson IF RACES ARE DEFINED AS GENETICALLY DISCRETE GROUPS, NO. BUT RESEARCHERS CAN USE SOME GENETIC INFORMATION TO GROUP INDIVIDUALS INTO CLUSTERS WITH
Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait
TWINS AND GENETICS TWINS Heritability: Twin Studies Twin studies are often used to assess genetic effects on variation in a trait Comparing MZ/DZ twins can give evidence for genetic and/or environmental
Introduction to Physical Anthropology - Study Guide - Focus Topics
Introduction to Physical Anthropology - Study Guide - Focus Topics Chapter 1 Species: Recognize all definitions. Evolution: Describe all processes. Culture: Define and describe importance. Biocultural:
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
DNA Testing for Genealogy - What Can It Do For You??
DNA Testing for Genealogy - What Can It Do For You?? Paper courtesy of Roberta Estes, www.dnaexplain.com, e-mail Roberta at Roberta@dnaexplain.com. Graphics courtesy of Family Tree DNA, www.familytreedna.com.
GENETIC GENEALOGY AND DNA TESTING
GENETIC GENEALOGY AND DNA TESTING by Ted Steele This publication may be ordered from: St. Louis Genealogical Society P. O. Box 432010 St. Louis, MO 63143 Copyright 2013 St. Louis Genealogical Society All
Evolution (18%) 11 Items Sample Test Prep Questions
Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science
Family Tree FAMILY TREE GUIDE TEACHER S THE HISTORY CHANNEL PRESENTS: A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT.
1 THE HISTORY CHANNEL CLASSROOM PRESENTS TEACHER S GUIDE THE HISTORY CHANNEL PRESENTS: Family Tree A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT. Birth certificates. Death notices.
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population
PRINCIPLES OF POPULATION GENETICS
PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Outline 22: Hominid Fossil Record
Outline 22: Hominid Fossil Record Human ancestors A.=Australopithicus Assumed direct lineage to modern humans Babcock textbook Collecting hominid fossils in East Africa Using Stratigraphy and Radiometric
PREHISTORIC IBERIA. Genetics, Anthropology, and Linguistics
PREHISTORIC IBERIA Genetics, Anthropology, and Linguistics PREHISTORIC IBERIA Genetics, Anthropology, and Linguistics Edited by Antonio Arnaiz-Villena Hospital "12 de Octubre" Universidad Complutense Madrid,
Geological Timeline Challenge
Geological Timeline Challenge Suggested Grade Levels: 8-12 Description: Students will create a timeline of Earth history in the classroom and learn about major changes to the Earth and life through time.
DNA Tribes is on Facebook. Find us at http://facebook.com/dnatribes. DNA Tribes Digest February 1, 2013 Page 1 of 10
Copyright 2013 DNA Tribes. All rights reserved. DNA Tribes Digest February 1, 2013 To request an email subscription to DNA Tribes Digest, email digest@dnatribes.com with the subject heading Subscribe.
Tutorial on gplink. http://pngu.mgh.harvard.edu/~purcell/plink/gplink.shtml. PLINK tutorial, December 2006; Shaun Purcell, shaun@pngu.mgh.harvard.
Tutorial on gplink http://pngu.mgh.harvard.edu/~purcell/plink/gplink.shtml Basic gplink analyses Data management Summary statistics Association analysis Population stratification IBD-based analysis gplink
HEALTHCARE PROFESSIONALS: NEW CHALLENGES, NEW SKILLS.
HEALTHCARE PROFESSIONALS: NEW CHALLENGES, NEW SKILLS. J.M. WEERTS, MD, FRCS ENG UEMS SECTION OF SURGERY 4000 LIEGE BELGIUM. BERLIN. March 28, 2015 CHALLENGES. PEOPLE MIGRATION and MOVEMENTS THEATER MANPOWER
SECOND INTERNATIONAL CONFERENCE ON THE GREAT MIGRATIONS ASIA TO AMERICA
The Permanent Delegation of Kazakhstan to the UNESCO The Embassy of the Republic of Kazakhstan to the United States of America The Harriman Institute, Columbia University East Central European Center,
All your base(s) are belong to us
All your base(s) are belong to us The dawn of the high-throughput DNA sequencing era 25C3 Magnus Manske The place Sanger Center, Cambridge, UK Basic biology Level of complexity Genome Single (all chromosomes
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem
Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem impregnable. In other cases, documentation that would shed
SNPbrowser Software v3.5
Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Early modern human dispersal from Africa: genomic evidence for multiple waves of migration
Tassi et al. Investigative Genetics (2015) 6:13 DOI 10.1186/s13323-015-0030-2 RESEARCH Early modern human dispersal from Africa: genomic evidence for multiple waves of migration Francesca Tassi 1, Silvia
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
Population Genetics and Multifactorial Inheritance 2002
Population Genetics and Multifactorial Inheritance 2002 Consanguinity Genetic drift Founder effect Selection Mutation rate Polymorphism Balanced polymorphism Hardy-Weinberg Equilibrium Hardy-Weinberg Equilibrium
Table of Contents: Introduction. DNA Tribes Digest July 30, 2010
DNA Tribes Digest July 30, 2010 Copyright 2010 DNA Tribes. All rights reserved. To request an email subscription to DNA Tribes Digest, email digest@dnatribes.com with the subject heading Subscribe. To
BIG Biomedicine and the Foundations of BIG Data Analysis
BIG Biomedicine and the Foundations of BIG Data Analysis Insider s vs outsider s views (1 of 2) Ques: Genetics vs molecular biology vs biochemistry vs biophysics: What s the difference? Insider s vs outsider
Genetic approaches for mobilizing gene bank variation. Prashant Vikram CRP Wheat Representative CIMMYT
Genetic approaches for mobilizing gene bank variation Prashant Vikram CRP Wheat Representative CIMMYT Why we need gene bank? Rht1 & 2: Japanese dwarf landrace wheat Daruma Rht 8 : Japanese landrace Akakomugi
Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing
Short Communication Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing T.C. Vieira 1,2,3,4, M.A.D. Gigonzac 2,3,4, D.M. Silva
CCR Biology - Chapter 10 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 10 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What is the term for a feature
MCB41: Second Midterm Spring 2009
MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for
Evolutionary implications of variation in the calling song of the cricket Gryllus bimaculatus De Geer (Orthoptera: Gryllidae)
Evolutionary implications of variation in the calling song of the cricket Gryllus bimaculatus De Geer (Orthoptera: Gryllidae) By Marna Ferreira Submitted in partial fulfilment of the requirements for the
Paternity Testing. Chapter 23
Paternity Testing Chapter 23 Kinship and Paternity DNA analysis can also be used for: Kinship testing determining whether individuals are related Paternity testing determining the father of a child Missing
Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
Lecture 10 Friday, March 20, 2009
Lecture 10 Friday, March 20, 2009 Reproductive isolating mechanisms Prezygotic barriers: Anything that prevents mating and fertilization is a prezygotic mechanism. Habitat isolation, behavioral isolation,
DAUGHERTY / DOUGHERTY NATIVE AMERICAN DNA
PiquaShawnee Project DAUGHERTY / DOUGHERTY NATIVE AMERICAN DNA Gayland Eugene Daugherty joined this project to seek additional informaton about his Cherokee Native American ancestry. PiquaShawnee was initiated
Biology 274: Genetics Syllabus
Biology 274: Genetics Syllabus Description: An examination of the basic principles of genetics in eukaryotes and prokaryotes at the level of molecules, cells, and multicelluar organisms, including humans.
Practice Questions 1: Evolution
Practice Questions 1: Evolution 1. Which concept is best illustrated in the flowchart below? A. natural selection B. genetic manipulation C. dynamic equilibrium D. material cycles 2. The diagram below
DNA as a Biometric. Biometric Consortium Conference 2011 Tampa, FL
DNA as a Biometric Biometric Consortium Conference 2011 Tampa, FL September 27, 2011 Dr. Peter M. Vallone Biochemical Science Division National Institute of Standards and Technology Gaithersburg, MD 20899
CHAPTER 2: UNDERSTANDING CANCER
CHAPTER 2: UNDERSTANDING CANCER INTRODUCTION We are witnessing an era of great discovery in the field of cancer research. New insights into the causes and development of cancer are emerging. These discoveries
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
Introducing a Capacity Management Maturity Model
Introducing a Capacity Management Maturity Model Business units are demanding more services and greater reliability from IT, while also trying to constrain, or even reduce, budgets. In those rare cases
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
CCR Biology - Chapter 5 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 5 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. If a cell cannot move enough material
Chapter 11: The Origins and Evolution of Early Homo
Chapter 11: The Origins and Evolution of Early Homo 1. Homo habilis: The First Species of the Genus Homo a. The Path to Humanness: Bigger Brains, Tool Use, and Adaptive Flexibility i. First discovered
Enlarged Wind Power Statistics 2010 including Denmark, Germany, Ireland and Great Britain
1 Enlarged Wind Power Statistics 2010 including Denmark, Germany, Ireland and Great Britain Background This work is based on hourly time series for wind power output in Denmark, Germany, Ireland and Great
TOP TEN COMPANIES IN FORENSICS TECHNOLOGY SAS020A. David Christofides Project Analyst ISBN:
TOP TEN COMPANIES IN FORENSICS TECHNOLOGY SAS020A David Christofides Project Analyst ISBN: BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 866-285-7215, 781-489-7301 www.bccresearch.com Custom
UK application rates by country, region, constituency, sex, age and background. (2015 cycle, January deadline)
UK application rates by country, region, constituency, sex, age and background () UCAS Analysis and Research 30 January 2015 Key findings JANUARY DEADLINE APPLICATION RATES PROVIDE THE FIRST RELIABLE INDICATION
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
The Value of Intelligent Capture in Accounts Payable Automation. White Paper
The Value of Intelligent Capture in Accounts Payable Automation White Paper Contents Executive Summary... 2 Evolution of Capture in AP... 2 Intelligent Capture for AP... 3 Any Source or Format... 3 Integration
Chapter 25: The History of Life on Earth
Overview Name Period 1. In the last chapter, you were asked about macroevolution. To begin this chapter, give some examples of macroevolution. Include at least one novel example not in your text. Concept
Factors for success in big data science
Factors for success in big data science Damjan Vukcevic Data Science Murdoch Childrens Research Institute 16 October 2014 Big Data Reading Group (Department of Mathematics & Statistics, University of Melbourne)
The Making of the Fittest: Evolving Switches, Evolving Bodies
OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic
Continuous and discontinuous variation
Continuous and discontinuous variation Variation, the small differences that exist between individuals, can be described as being either discontinuous or continuous. Discontinuous variation This is where
Reduced-Median-Network Analysis of Complete Mitochondrial DNA Coding-Region Sequences for the Major African, Asian, and European Haplogroups
Am. J. Hum. Genet. 70:1152 1171, 2002 Reduced-Median-Network Analysis of Complete Mitochondrial DNA Coding-Region Sequences for the Major African, Asian, and European Haplogroups Corinna Herrnstadt, 1
Mr. Murray, You Lose the Bet
June 30, 2014 // from the upcoming issue (Volume 27, No. 2) Mr. Murray, You Lose the Bet Nicholas Wade's newest book, A Troublesome Inheritance, suggests a biological basis for the existence of five distinct
Lessons from the Stanford HIV Drug Resistance Database
1 Lessons from the Stanford HIV Drug Resistance Database Bob Shafer, MD Department of Medicine and by Courtesy Pathology (Infectious Diseases) Stanford University Outline 2 Goals and rationale for HIVDB
ICFT: An Assault On Biblical Creation (Genesis 1)
Introduction. ICFT: An Assault On Biblical Creation (Genesis 1) A) In Colleges and Universities around the world, young men and women from Christians homes are challenged with questions by liberal professors