Irish Genes and Ancestry

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Irish Genes and Ancestry"

Transcription

1 Irish Genes and Ancestry Dr. Gianpiero Cavalleri Eneclann Summer Lunchtime Series 2012 Detailed genetic ancestry information through state of the art gene analysis

2 Overview.. Introduction to DNA, Y chromosome, mtdna How DNA has informed us about global population history Patterns of Y chromosome types we see in Ireland How genetics can inform on genealogy Sources for more information

3 3 billion letter archive written in ACGT Only small portion of our DNA (the genes) encodes instructions to build a human Changes (mutations) occur in our DNA with each generation These chages are inherited down through generations ~99.9% of our DNA is identical

4

5 Single nucleotide polymorphism (SNP) CGTACTATGACCCGAGCTAGCCCTA CGTACGATGACCCAAGCTAGCCCTA Pat Jack M269 M182 Microsatellite/short tandem repeat (STR) CCGTGCATGCATGCATGCATGCACC CCGTGCATGCATGCATGCATGCATGCACC Pat (5 copies) Jack (6 copies) DYS19 T at M269 + G at M copies at DYS19 = haplotype i.e. combination = haplotype

6 Groups and types found at different frequencies in different populations Isolation (i.e. within population marriage) and fact that some people have more (grand)children than others % Isolation! Distance between spouse birthplaces for all marriages ? distance (miles) Basis of all genetic history work

7 mtda mtdna tree Y chromosome tree

8 The evolution of modern humans.. Homo erectus Approx mya Radiated from Africa to Europe & Asia

9 Homo sapiens spread and diversified, moving out of Africa approx 100 kya Early migration towards South East Asia approx kya Later migration towards Eurasia kya As a consequence we expect to observe in non-africans, a subset of genetic variation present in modern African populations

10 ~150k years ago ~80k years ago R1b across Europe.. ~60k years ago ~40k years ago ~25k years ago LGM ~18k years ago

11 Data courtesy of JF Wilson

12 Discovered in November 2008 Subtype of R1b Found in 73% Irish, 50% Scots, 40% English Very rare in continent Proof of commonality among original inhabitants of the islands Probably palaeolithic origins (>10,000 years)

13 Ui Neill type.. Very common in Ireland, virtually absent elsewhere Origin around years ago Data courtesy of JF Wilson

14 Appears specific to Munster & associated with Eoghanacht surnames Data courtesy of JF Wilson

15 Found at high frequency around Holland,N. Germany, Denmark Probably arrived in Britain recently Iron age? Anglo- Saxon invasions? Data courtesy of JF Wilson

16 M17 and the Sea Road.but not to Dublin Data courtesy of JF Wilson

17 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19:

18 38,000 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19:

19 60,000 66,000 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19:

20 What about the rest of our DNA? (chromosomes 1 22) PCA using GWAS data Novembre J. Genes mirror geography within Europe. Nature Nov 6;456(7218): Cluster resolved above reflect ancient fissions in demographic history

21

22 IrelandsDNA.com - highest resolution for markers of Irish and British ancestry FTDNA.com Good for surname projects 23&me.com Combined health & history results DNA Atlas Ireland: See: Contact details: Dr. Gianpiero Cavalleri

23

The Genetic Genealogy of Eldridge: Haplogroup R1b - Sample

The Genetic Genealogy of Eldridge: Haplogroup R1b - Sample The Genetic Genealogy of Eldridge: Haplogroup R1b - Sample Michael Maglio Surname Variations, Meaning and Origin Eldridge, Eldredge, Eldred, Aldred, Aldridge, Aldrich Anglo-Saxon in origin, the name has

More information

Humans - Origin and Dispersion

Humans - Origin and Dispersion Humans - Origin and Dispersion Human-chimp. Last common ancestor (LCA) Presumed origin in central Africa Hominin species evolved in Africa, some spread to Asia and Europe Homo sapiens evolved in Africa,

More information

Y Chromosome Markers

Y Chromosome Markers Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except

More information

Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo.

Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo. Section 3: Tracing the evolution of the genus Homo is important for understanding the ancestry of humans; the only living species of Homo. K What I Know W What I Want to Find Out L What I Learned Essential

More information

Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine.

Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. The past two decades have witnessed an explosion of human genetic data. Innumerable

More information

From Africa to Aotearoa Part 1: Out of Africa

From Africa to Aotearoa Part 1: Out of Africa From Africa to Aotearoa Part 1: Out of Africa The spread of modern humans out of Africa started around 65,000 years ago, and ended with the settlement of New Zealand 750 years ago. These PowerPoint presentations

More information

Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft

Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Manuscript Number: Title: A comment on the Paper: A comparison of Y-chromosomal lineage dating using either resequencing

More information

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has

More information

Genetic Genealogy: What Can DNA Testing Tell Me About My Ancestry?

Genetic Genealogy: What Can DNA Testing Tell Me About My Ancestry? Family History Conference (Charlottesville, VA) Genetic Genealogy: What Can DNA Testing Tell Me About My Ancestry? John M. Butler, PhD November 7, 2015 Top Ten Reasons You May Have Decided to Attend This

More information

The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample.

The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample. DNA testing Thanks for your enquiry about DNA testing. I oversee the Scottish DNA Project on behalf of the University of Strathclyde, Glasgow and act as representative for Family Tree DNA who host our

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Directions: Arabian Peninsula Croatia India Asia Indonesia Papua New Guinea

Directions: Arabian Peninsula Croatia India Asia Indonesia Papua New Guinea In this activity, students will use a variety of skills to complete the tasks, including close reading and comprehension abilities, researching, and mapping. The reading part of this activity requires

More information

II B. Gene Flow. II C. Assortative Mating. II D. Genetic Drift. II E. Natural Selection. Northern Elephant Seal: Example of Bottleneck

II B. Gene Flow. II C. Assortative Mating. II D. Genetic Drift. II E. Natural Selection. Northern Elephant Seal: Example of Bottleneck I. What is Evolution? Agents of Evolutionary Change The Five Forces of Evolution and How We Measure Them A. First, remember that Evolution is a two-stage process: 1. Production and redistribution of variation

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans The Story of Human Evolution Part 1: From ape-like ancestors to modern humans Slide 1 The Story of Human Evolution This powerpoint presentation tells the story of who we are and where we came from - how

More information

Rethinking Polynesian Origins: Human Settlement of the Pacific

Rethinking Polynesian Origins: Human Settlement of the Pacific LENScience Senior Biology Seminar Series Rethinking Polynesian Origins: Human Settlement of the Pacific Michal Denny, and Lisa Matisoo-Smith Our Polynesian ancestors are renowned as some of the world s

More information

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders Human genetics: Why? Human Genetics Introduction Determine genotypic basis of variant phenotypes to facilitate: Understanding biological basis of human genetic diversity Prenatal diagnosis Predictive testing

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

SNP and destroy - a discussion of a weighted distance-based SNP selection algorithm

SNP and destroy - a discussion of a weighted distance-based SNP selection algorithm SNP and destroy - a discussion of a weighted distance-based SNP selection algorithm David A. Hall Rodney A. Lea November 14, 2005 Abstract Recent developments in bioinformatics have introduced a number

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

I Have the Results of My Genetic Genealogy Test, Now What?

I Have the Results of My Genetic Genealogy Test, Now What? I Have the Results of My Genetic Genealogy Test, Now What? Version 2.1 1 I Have the Results of My Genetic Genealogy Test, Now What? Chapter 1: What Is (And Isn t) Genetic Genealogy? Chapter 2: How Do I

More information

Level 3 Biology, 2012

Level 3 Biology, 2012 90719 907190 3SUPERVISOR S Level 3 Biology, 2012 90719 Describe trends in human evolution 2.00 pm Tuesday 13 November 2012 Credits: Three Check that the National Student Number (NSN) on your admission

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Geographic Patterns of Haplogroup R1b in the British Isles

Geographic Patterns of Haplogroup R1b in the British Isles Geographic Patterns of Haplogroup R1b in the British Isles Journal of Genetic Genealogy 3:1-13, 2007 Kevin D. Campbell Abstract The recent availability of Y-STR databases has provided the opportunity to

More information

Phillips DNA News. Project News. www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser

Phillips DNA News. Project News. www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser 2011 The Phillips DNA Project Phillips DNA News www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser Please submit news articles or ideas for articles to the editor. Questio ns about

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years.

( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years. Frequently asked questions about A Genetic Atlas of Human Admixture History G. Hellenthal, G.B.J. Busby, G. Band, J.F. Wilson, C. Capelli, D. Falush, S. Myers, Science (2014) SUMMARY What is your work

More information

NORSE VIKING HERITAGE

NORSE VIKING HERITAGE NORSE VIKING HERITAGE My mother's maiden name is WILLIAMSON. Her ancestors in the paternal line came from the Shetland Islands. The Shetland Islands were settled by Norse Vikings beginning before 800 AD.

More information

What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008)

What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008) What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008) The most common question I receive from people whose DNA results are returned to them is what do I do now? I ve put together

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

Evolution and Darwin

Evolution and Darwin Evolution and Darwin Evolution The processes that have transformed life on earth from it s earliest forms to the vast diversity that characterizes it today. A change in the genes!!!!!!!! Old Theories of

More information

What two Assumptions did Darwin have to arrive at BEFORE he could form his theories of evolution?

What two Assumptions did Darwin have to arrive at BEFORE he could form his theories of evolution? Influences on Darwin s Thinking: What ideas did each of the listed names below contribute to Darwin s thinking about evolution? (very brief) Georges Buffon: Jean Baptiste Lamarck: Charles Lyell: Thomas

More information

Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona

Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona Matthew Kaplan and Taylor Edwards University of Arizona Tucson, Arizona Unresolved paternity Consent for testing Ownership of Samples Uncovering genetic disorders SRY Reversal / Klinefelter s Syndrome

More information

Biomedical Big Data and Precision Medicine

Biomedical Big Data and Precision Medicine Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Introduction to Physical Anthropology - Study Guide - Focus Topics

Introduction to Physical Anthropology - Study Guide - Focus Topics Introduction to Physical Anthropology - Study Guide - Focus Topics Chapter 1 Species: Recognize all definitions. Evolution: Describe all processes. Culture: Define and describe importance. Biocultural:

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

DNA Testing for Genealogy - What Can It Do For You??

DNA Testing for Genealogy - What Can It Do For You?? DNA Testing for Genealogy - What Can It Do For You?? Paper courtesy of Roberta Estes, www.dnaexplain.com, e-mail Roberta at Roberta@dnaexplain.com. Graphics courtesy of Family Tree DNA, www.familytreedna.com.

More information

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait TWINS AND GENETICS TWINS Heritability: Twin Studies Twin studies are often used to assess genetic effects on variation in a trait Comparing MZ/DZ twins can give evidence for genetic and/or environmental

More information

How Human Migration Works

How Human Migration Works How Human Migration Works by Ed Grabianowski Browse the article How Human Migration Works An African migrant is seen at the CETI, Short Stay Immigrant Center, on Oct. 20, 2005 in the Spanish Enclave of

More information

Family Tree FAMILY TREE GUIDE TEACHER S THE HISTORY CHANNEL PRESENTS: A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT.

Family Tree FAMILY TREE GUIDE TEACHER S THE HISTORY CHANNEL PRESENTS: A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT. 1 THE HISTORY CHANNEL CLASSROOM PRESENTS TEACHER S GUIDE THE HISTORY CHANNEL PRESENTS: Family Tree A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT. Birth certificates. Death notices.

More information

GENETIC GENEALOGY AND DNA TESTING

GENETIC GENEALOGY AND DNA TESTING GENETIC GENEALOGY AND DNA TESTING by Ted Steele This publication may be ordered from: St. Louis Genealogical Society P. O. Box 432010 St. Louis, MO 63143 Copyright 2013 St. Louis Genealogical Society All

More information

Genetics Disorder Grading Rubric

Genetics Disorder Grading Rubric Your Name: Disorder: Genetics Disorder Grading Rubric Introduction Name the What part of the body does it generally affect? List all of the possible effects on the body What happens in the body to cause

More information

Evolution (18%) 11 Items Sample Test Prep Questions

Evolution (18%) 11 Items Sample Test Prep Questions Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15

Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

The more varied population is older because the mtdna has had more time to accumulate mutations.

The more varied population is older because the mtdna has had more time to accumulate mutations. Practice problems (with answers) This is the degree of difficulty of the questions that will be on the test. This is not a practice test because I did not consider how long it would take to finish these

More information

PRINCIPLES OF POPULATION GENETICS

PRINCIPLES OF POPULATION GENETICS PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,

More information

Name: Worksheet 1: British Isles and Scandinavia Map

Name: Worksheet 1: British Isles and Scandinavia Map Worksheet 1: British Isles and Scandinavia Map Directions: Label the following countries and bodies of water. Create borders between countries where necessary. Norway, Sweden, Finland, Denmark, United

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

common_genetic_variants_to_predict_risk_of_nonfamilial_breast_cancer 3/2011 8/2015 8/2016 8/2015

common_genetic_variants_to_predict_risk_of_nonfamilial_breast_cancer 3/2011 8/2015 8/2016 8/2015 Corporate Medical Policy Common Genetic Variants to Predict Risk of Nonfamilial Breast File Name: Origination: Last CAP Review: Next CAP Review: Last Review: common_genetic_variants_to_predict_risk_of_nonfamilial_breast_cancer

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Outline 22: Hominid Fossil Record

Outline 22: Hominid Fossil Record Outline 22: Hominid Fossil Record Human ancestors A.=Australopithicus Assumed direct lineage to modern humans Babcock textbook Collecting hominid fossils in East Africa Using Stratigraphy and Radiometric

More information

How Populations Evolve

How Populations Evolve How Populations Evolve Darwin and the Origin of the Species Charles Darwin published On the Origin of Species by Means of Natural Selection, November 24, 1859. Darwin presented two main concepts: Life

More information

RACE. By Michael J. Bamshad and Steve E. Olson

RACE. By Michael J. Bamshad and Steve E. Olson DOES RACE EXIST By Michael J. Bamshad and Steve E. Olson IF RACES ARE DEFINED AS GENETICALLY DISCRETE GROUPS, NO. BUT RESEARCHERS CAN USE SOME GENETIC INFORMATION TO GROUP INDIVIDUALS INTO CLUSTERS WITH

More information

Ch. 13 How Populations Evolve Period. 4. Describe Lamarck s proposed theory of evolution, The Theory of Acquired Traits.

Ch. 13 How Populations Evolve Period. 4. Describe Lamarck s proposed theory of evolution, The Theory of Acquired Traits. Ch. 13 How Populations Evolve Name Period California State Standards covered by this chapter: Evolution 7. The frequency of an allele in a gene pool of a population depends on many factors and may be stable

More information

Geological Timeline Challenge

Geological Timeline Challenge Geological Timeline Challenge Suggested Grade Levels: 8-12 Description: Students will create a timeline of Earth history in the classroom and learn about major changes to the Earth and life through time.

More information

PREHISTORIC IBERIA. Genetics, Anthropology, and Linguistics

PREHISTORIC IBERIA. Genetics, Anthropology, and Linguistics PREHISTORIC IBERIA Genetics, Anthropology, and Linguistics PREHISTORIC IBERIA Genetics, Anthropology, and Linguistics Edited by Antonio Arnaiz-Villena Hospital "12 de Octubre" Universidad Complutense Madrid,

More information

DNA Tribes is on Facebook. Find us at http://facebook.com/dnatribes. DNA Tribes Digest February 1, 2013 Page 1 of 10

DNA Tribes is on Facebook. Find us at http://facebook.com/dnatribes. DNA Tribes Digest February 1, 2013 Page 1 of 10 Copyright 2013 DNA Tribes. All rights reserved. DNA Tribes Digest February 1, 2013 To request an email subscription to DNA Tribes Digest, email digest@dnatribes.com with the subject heading Subscribe.

More information

Microevolution: The mechanism of evolution

Microevolution: The mechanism of evolution Microevolution: The mechanism of evolution What is it that evolves? Not individual organisms Populations are the smallest units that evolve Population: members of a species (interbreeding individuals and

More information

Tutorial on gplink. http://pngu.mgh.harvard.edu/~purcell/plink/gplink.shtml. PLINK tutorial, December 2006; Shaun Purcell, shaun@pngu.mgh.harvard.

Tutorial on gplink. http://pngu.mgh.harvard.edu/~purcell/plink/gplink.shtml. PLINK tutorial, December 2006; Shaun Purcell, shaun@pngu.mgh.harvard. Tutorial on gplink http://pngu.mgh.harvard.edu/~purcell/plink/gplink.shtml Basic gplink analyses Data management Summary statistics Association analysis Population stratification IBD-based analysis gplink

More information

HEALTHCARE PROFESSIONALS: NEW CHALLENGES, NEW SKILLS.

HEALTHCARE PROFESSIONALS: NEW CHALLENGES, NEW SKILLS. HEALTHCARE PROFESSIONALS: NEW CHALLENGES, NEW SKILLS. J.M. WEERTS, MD, FRCS ENG UEMS SECTION OF SURGERY 4000 LIEGE BELGIUM. BERLIN. March 28, 2015 CHALLENGES. PEOPLE MIGRATION and MOVEMENTS THEATER MANPOWER

More information

SECOND INTERNATIONAL CONFERENCE ON THE GREAT MIGRATIONS ASIA TO AMERICA

SECOND INTERNATIONAL CONFERENCE ON THE GREAT MIGRATIONS ASIA TO AMERICA The Permanent Delegation of Kazakhstan to the UNESCO The Embassy of the Republic of Kazakhstan to the United States of America The Harriman Institute, Columbia University East Central European Center,

More information

James Madison High School. Social Studies Department. World History and Geography 1 Power Standards

James Madison High School. Social Studies Department. World History and Geography 1 Power Standards James Madison High School Social Studies Department World History and Geography 1 Power Standards Human Beginnings Students will be able to explain that Homo Sapiens emerged from Africa between 100,000

More information

Chapter 16 Evolution of Populations. 16.1 Genes and Variation Biology Mr. Hines

Chapter 16 Evolution of Populations. 16.1 Genes and Variation Biology Mr. Hines Chapter 16 Evolution of Populations 16.1 Genes and Variation Biology Mr. Hines Figure 1-21 Levels of Organization Section 1-3 Levels of organization Biosphere Ecosystem The part of Earth that contains

More information

What do we know about the possible causes of brain tumors? Jill Barnholtz-Sloan, PhD Associate Professor

What do we know about the possible causes of brain tumors? Jill Barnholtz-Sloan, PhD Associate Professor What do we know about the possible causes of brain tumors? Jill Barnholtz-Sloan, PhD Associate Professor jsb42@case.edu 2014 Patient and Family Conference Providing and Pursuing Answers: Advances in Brain

More information

All your base(s) are belong to us

All your base(s) are belong to us All your base(s) are belong to us The dawn of the high-throughput DNA sequencing era 25C3 Magnus Manske The place Sanger Center, Cambridge, UK Basic biology Level of complexity Genome Single (all chromosomes

More information

Unit 3 Human Migrations

Unit 3 Human Migrations Unit 3 Human Migrations Section 1 Unit Materials Questions To Consider Question 1. How and why did early humans migrate out of Africa and across the earth s varied landscapes? Question 2. What kinds of

More information

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between

More information

Evolution of Homo and related hominins

Evolution of Homo and related hominins Evolution of Homo and related hominins Subfamily Homininae = monophyletic group consisting of humans, chimpanzees & gorillas and species now extinct within each of these lineages. The fossil record provides

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Table of Contents: Introduction. DNA Tribes Digest July 30, 2010

Table of Contents: Introduction. DNA Tribes Digest July 30, 2010 DNA Tribes Digest July 30, 2010 Copyright 2010 DNA Tribes. All rights reserved. To request an email subscription to DNA Tribes Digest, email digest@dnatribes.com with the subject heading Subscribe. To

More information

Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem

Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem impregnable. In other cases, documentation that would shed

More information

Hominines. The Origin of Anatomically Modern Humans (AMH) Pliocene. Hominine Taxonomy. Late Pliocene. Late Pliocene Climates. Arguments and Evidence

Hominines. The Origin of Anatomically Modern Humans (AMH) Pliocene. Hominine Taxonomy. Late Pliocene. Late Pliocene Climates. Arguments and Evidence Hominines The Origin of Anatomically Modern Humans (AMH) erectus heidelbergensis Modern Homo sapiens neandertalensis Arguments and Evidence ergaster rudolfensis Homo habilis 2.5 2 1.5 1 0.5 0 Millions

More information

Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program

Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and

More information

Population Genetics and Multifactorial Inheritance 2002

Population Genetics and Multifactorial Inheritance 2002 Population Genetics and Multifactorial Inheritance 2002 Consanguinity Genetic drift Founder effect Selection Mutation rate Polymorphism Balanced polymorphism Hardy-Weinberg Equilibrium Hardy-Weinberg Equilibrium

More information

Early modern human dispersal from Africa: genomic evidence for multiple waves of migration

Early modern human dispersal from Africa: genomic evidence for multiple waves of migration Tassi et al. Investigative Genetics (2015) 6:13 DOI 10.1186/s13323-015-0030-2 RESEARCH Early modern human dispersal from Africa: genomic evidence for multiple waves of migration Francesca Tassi 1, Silvia

More information

Various genotypes of Mycobacterium leprae from Mexico reveal distinct geographic distribution

Various genotypes of Mycobacterium leprae from Mexico reveal distinct geographic distribution Lepr Rev (2009) 80, 322 326 Various genotypes of Mycobacterium leprae from Mexico reveal distinct geographic distribution MASANORI MATSUOKA*, ALBERTO VARGAS GONZALEZ**, IRIS ESTRADA***, CRISTINA CARREÑO-MARTINEZ****

More information

SNPbrowser Software v3.5

SNPbrowser Software v3.5 Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium

More information

BIG Biomedicine and the Foundations of BIG Data Analysis

BIG Biomedicine and the Foundations of BIG Data Analysis BIG Biomedicine and the Foundations of BIG Data Analysis Insider s vs outsider s views (1 of 2) Ques: Genetics vs molecular biology vs biochemistry vs biophysics: What s the difference? Insider s vs outsider

More information

Genetic approaches for mobilizing gene bank variation. Prashant Vikram CRP Wheat Representative CIMMYT

Genetic approaches for mobilizing gene bank variation. Prashant Vikram CRP Wheat Representative CIMMYT Genetic approaches for mobilizing gene bank variation Prashant Vikram CRP Wheat Representative CIMMYT Why we need gene bank? Rht1 & 2: Japanese dwarf landrace wheat Daruma Rht 8 : Japanese landrace Akakomugi

More information

Allele Frequencies: Changing. Chapter 15

Allele Frequencies: Changing. Chapter 15 Allele Frequencies: Changing Chapter 15 Changing Allele Frequencies 1. Mutation introduces new alleles into population 2. Natural Selection specific alleles are more likely to be passed down because they

More information

CCR Biology - Chapter 10 Practice Test - Summer 2012

CCR Biology - Chapter 10 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 10 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What is the term for a feature

More information

PCA, Clustering and Classification. By H. Bjørn Nielsen strongly inspired by Agnieszka S. Juncker

PCA, Clustering and Classification. By H. Bjørn Nielsen strongly inspired by Agnieszka S. Juncker PCA, Clustering and Classification By H. Bjørn Nielsen strongly inspired by Agnieszka S. Juncker Motivation: Multidimensional data Pat1 Pat2 Pat3 Pat4 Pat5 Pat6 Pat7 Pat8 Pat9 209619_at 7758 4705 5342

More information

3-6: Uranium Thorium dating

3-6: Uranium Thorium dating 3-6: Uranium Thorium dating While radiocarbon dating is limited to about

More information

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by

More information

9.1: Mechanisms of Evolution and Their Effect on Populations pg. 350-359

9.1: Mechanisms of Evolution and Their Effect on Populations pg. 350-359 9.1: Mechanisms of Evolution and Their Effect on Populations pg. 350-359 Key Terms: gene flow, non-random mating, genetic drift, founder effect, bottleneck effect, stabilizing selection, directional selection

More information

GENETIC ANALYSIS OF AFRICAN POPULATIONS: HUMAN EVOLUTION AND COMPLEX DISEASE

GENETIC ANALYSIS OF AFRICAN POPULATIONS: HUMAN EVOLUTION AND COMPLEX DISEASE GENETIC ANALYSIS OF AFRICAN POPULATIONS: HUMAN EVOLUTION AND COMPLEX DISEASE Sarah A. Tishkoff * and Scott M. Williams Africa is one of the most ethnically and genetically diverse regions of the world.

More information

Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing

Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing Short Communication Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing T.C. Vieira 1,2,3,4, M.A.D. Gigonzac 2,3,4, D.M. Silva

More information

Evolutionary implications of variation in the calling song of the cricket Gryllus bimaculatus De Geer (Orthoptera: Gryllidae)

Evolutionary implications of variation in the calling song of the cricket Gryllus bimaculatus De Geer (Orthoptera: Gryllidae) Evolutionary implications of variation in the calling song of the cricket Gryllus bimaculatus De Geer (Orthoptera: Gryllidae) By Marna Ferreira Submitted in partial fulfilment of the requirements for the

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

Genomics and Human Identity

Genomics and Human Identity Genomics and Human Identity Grades 7-12 Lesson 1 Inspired by the museum exhibit Genome: Unlocking Life s Code unlockinglifescode.org Smithsonian National Museum of Natural History Table of Contents Table

More information