Chapter 1: Bio Primer

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Chapter 1: Bio Primer"

Transcription

1 Chapter 1: Bio Primer 1.1 Cell Structure; DNA; RNA; transcription; translation; proteins Prof. Yechiam Yemini (YY) Computer Science Department Columbia University COMS Overview Cell structure and mechanisms DNA; RNA; Transcription; Regulation Translation; protein; sequence & structure References: B. Alberts et al, Molecular Biology of The Cell, 4 th edition, Garland Science. R. Horton et al, Principles of Biochemistry, 3 rd Edition, Prentice Hall. J.D. Watson et al, Molecular Biology of The Gene, 5 th edition, Pearson Benjamin Cummings. NCBI Introductory overview: Animation sites: o o COMS

2 Organisms Are Made of Cells COMS Prokaryotes & Eukaryotes Have Different Cells Prokaryotes: single cell organisms without nucleus E.g., Bacteria: E-coli, H-Pylori Eukaryotes: single/multi-cell organisms with nucleus E.g., Yeast, plants, drosophila, humans Earth formed -4.5B yrs Prokaryotic bacteria -3.5B yrs Nucleated cells Multi-cellular eukaryotes -1.5B yrs -0.5B yrs Pearson; Benjamin COMS Cummings

3 Single cell; size 0.2-2µm Single or multi cell; cell size µm No nucleus Nucleus Structure One membrane at cell boundarymultiple membranes/compartments No organelles Organelles: mitochondria, Golgi, chloroplasts No cytoskeleton Cytoskeleton DNA Proteins Prokaryotes Eukaryotes Single circular DNA Two or more chromosomes Genes code proteins Genes have large non-coding regions (introns) 90% of DNA encodes proteins 95-97% non-coding DNA ~ base pairs ~ base pairs DNA is loosely organized DNA is tightly packed (chromatin + histones) Cell division through fission Mitosis 1-2k protein species 5-20k protein species ~10 6 proteins per cell ~10 9 proteins per cell COMS Cells Are Made of Macromolecules Small molecules: 3% Macromolecules: 26% Sugars Fatty Acids Amino Acids Nucleotides Polysaccharides Fats, Lipids, Membranes Proteins Nucleic Acids (DNA, RNA) Molecules % weight Water 70% Inorganic ions 1% Sugars 1% Amino acids 0.4% Nucleotides 0.4% Fatty acids 1% Other small molecules 0.2% Macromolecules (proteins, DNA, RNA, polysaccharides) 26% COMS

4 DNA Structure COMS The Central Dogma of Biology DNA Transcription RNA Translation Protein DNA stores hereditary information DNA is transcribed into RNA RNA is translated into proteins Proteins perform the key functions of cells COMS

5 DNA Consists of Sequences of Nucleotides DNA strands are sequences of nucleotides Backbone + Sugar Phosphate T T Base Nucleotide A C T T A C G C Bases: Adenine, Guanine, Thymine, Cytosine DNA is organized in complementary double strands Hydrogen bonds hybridize complementary pairs: A T, C G 5 -end Hydrogen bonds 3 -end T G A T T G A C T A A C G C C G COMS DNA Forms A Double Helix Helix full turn: 10.5bp Vertical hydrogen bonds support the structure Major and minor grooves provide access by proteins (e.g., transcription factors) COMS

6 DNA is 2m long; needs to fold into 10-6 m nucleus Chromatin beads fold around 4 histones Transcription needs to unpack the DNA to copy it DNA Is Tightly Packed COMS Sample Bioinformatics Challenges Sequencing the genome Discovering sequence similarity Discovering genes Analyzing evolutionary relationships Discovering other important structures Distinguishing exons from introns Regulatory structures: (promoters & transcription factors) Regions expressing micro RNA. COMS

7 Transcription COMS Schematics DNA Transcription mrna Translation Protein COMS

8 Overview A. Assembling transcription complex B. Transcribing DNA to mrna C. Removing introns COMS Animation The Transcription Process COMS

9 Transcription Details From PDB COMS Transcription Factors TFs bind to promoters regions and to RNA polymerases TFs regulate the rate of transcription (up/down) Regulation is yet to be well understood COMS

10 Transcription Is Regulated COMS Example The Lac Operon Lac consists of 3 genes; commonly transcribed Used by bacteria to transport and metabolize lactose camp activates transcription to initiate transport & metabolism of lactose COMS

11 Lac Activation Low-level sugar generate camp camp binds with CRP; adjusts its alpha helix to fit the DNA grooves and binds with it CRP-cAMP accelerates polymerase binding Lac Lac COMS Splicing The Introns COMS

12 From Genes To Networks Regulation is organized in networks Top: gene network regulating the body development of sea urchin Middle: a promoter region Bottom: interaction of two modules COMS Regulatory Networks Can Be Complex Genetic regulatory network controlling the development of the body plan of the sea urchin embryo Davidson et al., Science, 295(5560): COMS

13 Sample Bioinformatics Challenges Discovering and analyzing transcription factors Evolutionary analysis; motifs finding Discovering the structure of regulatory networks Analyzing the operations of regulatory networks Designing synthetic regulatory networks COMS Translation COMS

14 RNA Encodes Protein Sequences DNA Transcription RNA Translation Protein Proteins are sequences of amino-acids (AA) Translation uses RNA sequence as a template to construct AA sequence The coding problem: Code sequence of 20 amino-acids using 4 nucleic acids 2 nucleic acids can code only 4 2 =16 amino-acids Codon: sequence of 3 nucleic acids; encodes amino acid Translation: translate mrna codons to amino acids Start/Stop codons define an open reading frame(orf) Translation requires reading/identifying codons and forming a respective protein sequence COMS The Genetic Code U C A G U UUU Phenylalanine UUC Phe UUA Leucine UUG Leu UCU Serine UCC Ser UCA Ser UCG Ser UAU Tyrosine UAC Ty UAA Stop UAG Stop UGU Cysteine UGC Cys UGA Stop UGG Tryptophan C CUU Leu CUC Leu CUA Leu CUG Leu CCU Proline CCC Pro CCA Pro CCG Pro CAU Histidine CAC His CAA Glutamine CAG Gln CGU Arginine CGC Arg CGA Arg CGG Arg A AUU Isoleucine AUC Ile AUA Ile AUG Methionine ACU Threonine ACC Thr ACA Thr ACG Thr AAU Asparagine AAC Asn AAA Lysine AAG Lys AGU Serine AGC Ser AGA Arg AGG Arg G GUU Valine GUC Val GUA Val GUG Val GCU Alanine GCC Ala GCA Ala GCG Ala GAU Aspartate GAC Asp GAA Glutamate GAG Glu GGU Glycine GGC Gly GGA Gly GGG Gly COMS

15 trna Provides Translation Units Anticodon 3 CGA 5 binds to codon 5 GCU 3 of mrna It translates GCU to Alanine COMS Translation Basics Initiation: Ribosome binds to mrna; moves in 5 3 until it finds Start codon AUG Elongation Ribosome recruits trna to match next codon trna binds its AA into peptide bond with protein Ribosome releases trna and moves to next codob Termination Until a Stop codon is reached Release factor releases polypeptide from ribosome COMS

16 Animation Translation of RNA into proteins COMS Proteins Are Sequences of Amino Acids Proteins are constructed through peptide bonds Proteins are folded into complex conformations Proteins perform functions by binding Transcription factors and polymerase bind to DNA Enzymes bind to molecules to accelerate their reactions Globins bind to oxygen to transport it Antibodies bind to pathogens COMS

17 Example: Hemoglobin COMS Sickle-Cell Anemia: A Single Nucleotide Change Codon 6 in β-globin Sickle structure COMS

18 Evolution of β-globin (α-globin cluster is coded by chromosome 16 ) COMS The Evolution of α-globin Across Species COMS

19 Protein Structures COMS Protein Structure Is Of Central Importance Structure is found through complex crystallography X-ray diffraction; NMR The holy-grail: compute structure from sequence Ab-initio: compute structure directly from sequence Homology techniques: use similarity to known proteins Structure is conserved across wide variations Small number of fold families (α-helix, β-sheets ) There are rules (e.g., hydrophobic AA are packed inside) Nature folds proteins very fast So why is it so difficult to predict structure? COMS

20 SwissProt vs. PDB Statistics PDB ~30k structures COMS Proteins Interact Via Active Sites Protein interactions are defined by active sites E.g., antibody with pathogen E.g., drug design Proteins use geometry: ligands latch with holes Proteins use physics: electrical fields How can protein-protein interactions be computed? COMS

21 Sample Bioinformatics Challenges Analyzing protein sequence similarity Evolutionary conservation/changes Computing structure from sequences Analyzing structure homologies Analyzing protein-2-protein interactions Inferring function from structure COMS The Cell Cycle COMS

22 Cells Operate In Cycles G0 Phase cell is at rest G1 Phase (4hrs) Cell either progresses into synthesis or leaves cell cycle to differentiate S Phase (10hrs) DNA Synthesis Checkpoint determines integrity of DNA G2 Phase (4hrs) Cell prepares for Mitosis Checkpoint determines integrity of DNA DNA is repaired or cell dies (Apoptosis) Mitosis (2hrs) Chromosomes are separated Cell divides COMS The Cell Cycle is Regulated Transition among phases is controlled by a regulatory network Checkpoints are used to assure quality COMS

23 Evolution COMS Optimizing Functionality DNA is substantially conserved through evolution Evolution = mutation + selection Mutation = single nucleotide polymorphism (SNP); duplication of entire DNA segments mating; recombination Selection = optimize fitness of species Examples Metabolic nets learn to optimize energy budget (Alon 05) Functional similarity Sequence similarity COMS

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Prep Time: 1 hour. Class Time: 45 minutes

Prep Time: 1 hour. Class Time: 45 minutes ACTIVITY OVERVIEW Abstract: Students use edible models of the DNA molecule to transcribe an mrna sequence, then translate it into a protein. Module: The Basics and Beyond Prior Knowledge Needed: A basic

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

The vast majority of RNA functions are concerned with protein synthesis.

The vast majority of RNA functions are concerned with protein synthesis. RNA Structure, Function, and Synthesis RNA RNA differs from DNA in both structural and functional respects. RNA has two major structural differences: each of the ribose rings contains a 2 -hydroxyl, and

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

How to Use this Practice Exam:

How to Use this Practice Exam: How to Use this Practice Exam: I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows. 1. Do NOT answer the questions

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC ML ENGMAN, MD Vice President and Chief Medical Director BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE UNDERWRITING SLEEP

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction

More information

Ribosomal Protein Synthesis

Ribosomal Protein Synthesis 1 1 Ribosomal Protein Synthesis Prof. Dr. Wolfgang Wintermeyer 1, Prof. Dr. Marina V. Rodnina 2 1 Institut f r Molekularbiologie, Universit t Witten/Herdecke, Stockumer Stra e 10, 58448 Witten, Germany;

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Basic Characteristics of Cells. Cell Structure and Function. Each Cell Has Three Primary Regions. Basic Characteristics of Cells. The Plasma Membrane

Basic Characteristics of Cells. Cell Structure and Function. Each Cell Has Three Primary Regions. Basic Characteristics of Cells. The Plasma Membrane Basic Characteristics of Cells Cell Structure and Function Chapter 3 Smallest living subdivision of the human body Diverse in structure and function Small Basic Characteristics of Cells Each Cell Has Three

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find

More information

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH Introduction: The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH In the Puzzle of Life activity, students will demonstrate how the

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section BCOR 011, Exam 3 Name KEY Section Multiple Choice: Select the best possible answer. 1. A parent cell divides to form two genetically identical daughter cells in the nuclear process of mitosis. For mitosis

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why?

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why? Unit 9: DNA, RNA, and Proteins Pig and elephant DNA just don t splice, but why? BONUS - History of DNA Structure of DNA 3.3.1 - Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and

More information

CHALLENGES IN THE HUMAN GENOME PROJECT

CHALLENGES IN THE HUMAN GENOME PROJECT REPRINT: originally published as: Robbins, R. J., 1992. Challenges in the human genome project. IEEE Engineering in Biology and Medicine, (March 1992):25 34. CHALLENGES IN THE HUMAN GENOME PROJECT PROGRESS

More information

Solutions for Biochemistry Unit Exam

Solutions for Biochemistry Unit Exam Solutions for Biochemistry Unit Exam Question 1 a) An example of a structural representation is shown in the adjacent box. Draw a structural representation of the amino acid, Aspartic acid, which has the

More information

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Sean Carroll.

Sean Carroll. Sean Carroll http://www.molbio.wisc.edu/carroll/teaching.html sbcarrol@wisc.edu 1 Suggestions for doing well Come to class! Read the assignment before lecture Stay current with problems Seek help if needed

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

2.1 Nucleic acids the molecules of life

2.1 Nucleic acids the molecules of life 1 2.1 Nucleic acids the molecules of life Nucleic acids information molecules of the cells form new cells stored in chromosomes in nucleus of the cell in the form of a code in DNA / parts of the code are

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Mutation, Repair, and Recombination

Mutation, Repair, and Recombination 16 Mutation, Repair, and Recombination WORKING WITH THE FIGURES 1. In Figure 16-3a, what is the consequence of the new 5 splice site on the open reading frame? In 16-3b, how big could the intron be to

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information