Transcription, Translation & Protein Synthesis

Size: px
Start display at page:

Download "Transcription, Translation & Protein Synthesis"

Transcription

1 Transcription, Translation & Protein Synthesis

2 Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make, and some we can t There are infinite combinations of amino acids Can be hundreds or thousands monomers long These long chains are called polypeptide chains

3 Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus in the cytoplasm. Houston, we have a problem.

4 Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA RNA is used to carry these messages.

5 Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mrna carries a message from the DNA to the cytoplasm 2. trna transports amino acids to the mrna to make a protein 3. rrna make up ribosomes, which make protein.

6 Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name ) Contains uracil instead of thymine. RNA is single-stranded, not double-stranded (usually )

7 Ribonucleic Acids (RNA)

8 Protein Synthesis Occurs in TWO steps: 1.Transcription the genetic information from a strand of DNA is copied into a strand of mrna 2.Translation the mrna, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mrna.

9 The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N

10 Step One: Transcription 1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? 3. New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

11 Step One: Transcription Watch this simplified animation: mat/molgenetics/transcription.swf Watch the more complex animation! ion/gene/gene_a2.html

12 Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

13 Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

14 Step 1½: RNA Editing An mrna molecule has to be edited in order to be useful. There s a lot of unnecessary information that needs to be removed. An mrna sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.

15 Step 1½: RNA Editing DNA pre-rna (in nucleus) transcription exon 1 interon exon 2 interon exon 3 RNA editing interon interon RNA (in cytoplasm) exon 1 exon 2 exon 3

16 Step Two: Translation to decode or decipher the meaning of Now that our mrna molecule has been made, it s time for its message to be made into a protein sequence. How does the mrna sequence translate into an amino acid sequence?

17 Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. A T C G phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly

18 Step Two: Translation Watch this simplified animation: mat/molgenetics/translation.swf Watch the more complex animation! ion/gene/gene_a3.html

19 Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mrna sequence into codons. As you just saw and heard, codons are three-base sections of mrna: AUG CGU ACU GAU CGU UCA GAU UGA

20 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA?

21 The Genetic Code

22 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met?

23 The Genetic Code

24 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met arg thr asp arg ser asp???

25 The Genetic Code

26 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met met thr asp arg ser asp STOP

27 RECAP: 1. DNA is transcribed into mrna in the nucleus. 2. The mrna leaves the nucleus and enters the cytoplasm. 3. The protein is translated from the mrna sequence using trna and amino acids.

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

v vi vii viii ix 1 2 for high school students. For this, research needed to be done to to find a popular and engaging style of animation for this age group. The third step was to design the animation so

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

T C T G G C C G A C C T;

T C T G G C C G A C C T; 1. (a) Gene is a (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code/read in three s; On sense/coding strand; Triplet coding for amino acid; Degenerate code; non-overlapping;

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH Introduction: The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH In the Puzzle of Life activity, students will demonstrate how the

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

3120-1 - Page 1. Name:

3120-1 - Page 1. Name: Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

CHAPTER 4: CELLULAR METABOLISM. 2. Distinguish between kinetic and potential energy, and give examples of each.

CHAPTER 4: CELLULAR METABOLISM. 2. Distinguish between kinetic and potential energy, and give examples of each. OBJECTIVES: 1. Compare and contrast the major divisions of metabolism, in terms of a general descriptive sentence, additional descriptive terms, how energy is involved, whether bonds or formed or broken,

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group. Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences

Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of

More information

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

CHAPTER 30: PROTEIN SYNTHESIS

CHAPTER 30: PROTEIN SYNTHESIS CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464

Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Call for action: Paradigm shift in teaching microbiology in a community colleges Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Project Course:

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

Chapter 3: Biological Molecules. 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids

Chapter 3: Biological Molecules. 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Chapter 3: Biological Molecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Elements in Biological Molecules Biological macromolecules are made almost entirely of just 6 elements: Carbon (C)

More information

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and

More information

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d) Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell

Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose 1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen

More information

Chapter 4 Cellular Metabolism

Chapter 4 Cellular Metabolism Chapter 4 Cellular Metabolism Metabolic processes all chemical reactions that occur in the body Two types of metabolic reactions Anabolism larger molecules are made requires energy Catabolism larger molecules

More information

How to Use this Practice Exam:

How to Use this Practice Exam: How to Use this Practice Exam: I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows. 1. Do NOT answer the questions

More information

Biochemistry 2000 Sample Question Proteins. (1) Identify the secondary structure described in each of the following statements:

Biochemistry 2000 Sample Question Proteins. (1) Identify the secondary structure described in each of the following statements: (1) Identify the secondary structure described in each of the following statements: a. A coiled peptide chain held in place by hydrogen bonding between peptide bonds in the same chain b. A structure that

More information

The Nucleus: DNA, Chromatin And Chromosomes

The Nucleus: DNA, Chromatin And Chromosomes The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information