Transcription, Translation & Protein Synthesis

Size: px
Start display at page:

Download "Transcription, Translation & Protein Synthesis"

Transcription

1 Transcription, Translation & Protein Synthesis

2 Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make, and some we can t There are infinite combinations of amino acids Can be hundreds or thousands monomers long These long chains are called polypeptide chains

3 Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus in the cytoplasm. Houston, we have a problem.

4 Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA RNA is used to carry these messages.

5 Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mrna carries a message from the DNA to the cytoplasm 2. trna transports amino acids to the mrna to make a protein 3. rrna make up ribosomes, which make protein.

6 Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name ) Contains uracil instead of thymine. RNA is single-stranded, not double-stranded (usually )

7 Ribonucleic Acids (RNA)

8 Protein Synthesis Occurs in TWO steps: 1.Transcription the genetic information from a strand of DNA is copied into a strand of mrna 2.Translation the mrna, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mrna.

9 The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N

10 Step One: Transcription 1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? 3. New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

11 Step One: Transcription Watch this simplified animation: mat/molgenetics/transcription.swf Watch the more complex animation! ion/gene/gene_a2.html

12 Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

13 Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

14 Step 1½: RNA Editing An mrna molecule has to be edited in order to be useful. There s a lot of unnecessary information that needs to be removed. An mrna sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.

15 Step 1½: RNA Editing DNA pre-rna (in nucleus) transcription exon 1 interon exon 2 interon exon 3 RNA editing interon interon RNA (in cytoplasm) exon 1 exon 2 exon 3

16 Step Two: Translation to decode or decipher the meaning of Now that our mrna molecule has been made, it s time for its message to be made into a protein sequence. How does the mrna sequence translate into an amino acid sequence?

17 Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. A T C G phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly

18 Step Two: Translation Watch this simplified animation: mat/molgenetics/translation.swf Watch the more complex animation! ion/gene/gene_a3.html

19 Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mrna sequence into codons. As you just saw and heard, codons are three-base sections of mrna: AUG CGU ACU GAU CGU UCA GAU UGA

20 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA?

21 The Genetic Code

22 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met?

23 The Genetic Code

24 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met arg thr asp arg ser asp???

25 The Genetic Code

26 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met met thr asp arg ser asp STOP

27 RECAP: 1. DNA is transcribed into mrna in the nucleus. 2. The mrna leaves the nucleus and enters the cytoplasm. 3. The protein is translated from the mrna sequence using trna and amino acids.

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet)

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet) Tuesday 11/13 Warm Up 1.What are the three parts of a nucleotide? How do two nucleotides link together 2.What binds the two strands of DNA together? Be Specific 3.What are the three main enzymes of DNA

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

RNA and Protein Synthesis Biology Mr. Hines

RNA and Protein Synthesis Biology Mr. Hines RNA and Protein Synthesis 12.3 Biology Mr. Hines Now we know how DNA (genes) are copied. But how is it used to make a living organism? Most of the structures inside of a cell are made of protein - so we

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information:

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Section 1.4 Name: Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Protein Synthesis: pages 193-196 As

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation EQ How does a cell make proteins with the information from DNA? Protein Synthesis: Get Started Get Started Think of a corn cell that is genetically modified to contain the Bt gene and a corn cell that

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 Question 1 Solutions to 7.014 Problem Set 5 a) Which of the following molecules functions directly to transfer information from the nucleus to the cytoplasm? ircle all that apply. DN mrn trn transporter

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

DNA (Deoxyribonucleic Acid)

DNA (Deoxyribonucleic Acid) DNA (Deoxyribonucleic Acid) Genetic material of cells GENES units of genetic material that CODES FOR A SPECIFIC TRAIT Called NUCLEIC ACIDS DNA is made up of repeating molecules called NUCLEOTIDES Phosphate

More information

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond 11 Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Structural Components of Nucleotides Base Sugar Phosphate Glycosidic bond H NUCLEOTIDE H 1 RNA DNA Table 3-1 Nucleic acid polymer

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis

Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis UNIT 3, CHAPTER 4: MOLECULAR GENETICS: DNA STRUCTURE AND... 3 PROTEIN SYNTHESIS... 3 LESSON

More information

Chapter 10 Molecular Biology of the Gene

Chapter 10 Molecular Biology of the Gene Chapter 10 Molecular Biology of the Gene PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS BIOLOGY INSTRUCTIONAL TASKS DNA to Protein Grade-Level Expectations The exercises in these instructional tasks address content related to the following science grade-level expectations: Contents LS-H-B1

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402)

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) 3.1.1 Monomers and Polymers 3.1.4 Proteins 3.1.5 Nucleic acids are important information-carrying molecules 3.2.1 Cell structure

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Multiple Choice Review- Genes

Multiple Choice Review- Genes Multiple Choice Review- Genes 1. Deoxyribonucleic acid nucleotides are composed of a. Ribose sugar, a phosphate group and one of four bases (adenine, cytosine, thymine and guanine) b. Ribose sugar, a phosphate

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

Bio EOC Questions for DNA and Protein Synthesis

Bio EOC Questions for DNA and Protein Synthesis Bio EOC Review Topics for DNA and Protein Synthesis o DNA: structure - What are the parts of a nucleotide? sugar, acid, N-bases (and be able to identify these parts on a diagram) A-T / T-A / C-G / G-C

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

Central Dogma of Genetics

Central Dogma of Genetics Central Dogma of Genetics Within each cell the genetic information flows from DNA to RNA to protein. This flow of information is unidirectional and irreversible. The information carried within the DNA

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Molecular Biology of The Cell - An Introduction

Molecular Biology of The Cell - An Introduction Molecular Biology of The Cell - An Introduction Nguyen Phuong Thao School of Biotechnology International University Contents Three Domain of Life The Cell Eukaryotic Cell Prokaryotic Cell The Genome The

More information

DNA - The Double Helix

DNA - The Double Helix DNA - The Double Helix Name: Date: Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

GENE EXPRESSION Transcription (Video)

GENE EXPRESSION Transcription (Video) GENE EXPRESSION Is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as rrna genes

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

CH107 Mock Exam 2. 3) Which of the following is a purine base? A) Uracil B) Adenine C) Thymine D) Cysteine E) Orotate

CH107 Mock Exam 2. 3) Which of the following is a purine base? A) Uracil B) Adenine C) Thymine D) Cysteine E) Orotate 100 pts. 1-34 2pts, 35-40 8pts. (choose 4 of 6) 1) What are the components of DNA? A) Ribonucleic acid, B) Amino group, phosphate group, pentose sugar C) Sugar-phosphate backbone D) fructose sugar, nitrogen

More information

DNA: I m All Split Up

DNA: I m All Split Up DNA: I m All Split Up By Lori Hypes, for Blue Ridge Public Television (WBRA, WMSY, WSBN) Tazewell Middle School, Tazewell, VA GRADE LEVELS: 7 th 10 th grade TIME ALLOTMENT: 3 45 minute blocks OVERVIEW:

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA. Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary

More information

Cells. DNA and Heredity

Cells. DNA and Heredity Cells DNA and Heredity ! Nucleic acids DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) Determines how cell function " change the DNA and you change the nature of the organism Changes of DNA allows

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

DNA AND IT S ROLE IN HEREDITY

DNA AND IT S ROLE IN HEREDITY DNA AND IT S ROLE IN HEREDITY Lesson overview and objectives - DNA/RNA structural properties What are DNA and RNA made of What are the structural differences between DNA and RNA What is the structure of

More information

Biology IB DIPLOMA HIGHER LEVEL SAMPLE MATERIAL DEVELOPED SPECIFICALLY FOR THE HEINEMANN BACCALAUREATE

Biology IB DIPLOMA HIGHER LEVEL SAMPLE MATERIAL DEVELOPED SPECIFICALLY FOR THE HEINEMANN BACCALAUREATE HL HEINEMANN BACCALAUREATE HIGHER LEVEL Biology DEVELOED SECIFICALLY FOR THE IB DILOMA ALAN DAMON RANDY McGONEGAL ATRICIA TOSTO WILLIAM WARD SAMLE MATERIAL to show the design and layout for the series

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

2.7 DNA replication, transcription and translation

2.7 DNA replication, transcription and translation 2.7 DNA replication, transcription and translation Essential Idea: Genetic information in DNA can be accurately copied and can be translated to make the proteins needed by the cell. The image shows an

More information