This task contains question. Please answer these questions in groups of two persons and make a small report.

Size: px
Start display at page:

Download "This task contains question. Please answer these questions in groups of two persons and make a small report."

Transcription

1 Tasks Monday January 21st 2006 Goals: - to work with public databases on the internet to find gene and protein information. - To use tools to analyse and compare DNA sequences - To find homologous sequences in other organisms and to learn the concept of orthologs and paralogs. - To make a phylogenetic analysis using ClustalW - To analyse genome sequences from multiple organisms using VISTA We will make use of public DNA (NCBI and UCSC) and protein databases (EBI). The underlying information in the various databases is mostly identical but visualisation and search options as well as annotation may vary. This task contains question. Please answer these questions in groups of two persons and make a small report. Task 1: Homologs of the E. coli photolyase gene The bacterium E. coli can repair UV-induced DNA damage. UV-light can result in the formation of cyclobutane-thymidine dimers. The enzyme photolyase can repair the damage but it needs visible light to be activated. The energy of a photon is absorbed by the enzyme and used by FADH to free an electron needed for repair of the DNA damage. In this task you will search for the E. coli K12 photolyase gene and protein and you will try to find and compare homologs in other model organisms from Page 1 of 6

2 other 'kingdoms'. You will collect information for these homologs (e.g. protein size, protein domains present). Using this information, you will try to find out the possible evolution for this gene and how it did arise in various organisms. Find the amino acid sequence of the E. coli photolyase protein at NCBI. Go to and search all databases for photolyase. Find the protein sequence starting with NP_, which means that it is reference sequence for a given organism. How many amino acids does the protein consist of? In the pull-down menu 'display' you can select another view. Select 'FASTA' for a short version of the sequence without extensive annotation. Copy the sequence, including its description which is preceded by ">" and paste it on your notepad. Save this file for later use. As depicted in the picture above, the protein contains two important activities. We will now analyse the protein for known 'domains' residing in the protein using the program "Interproscan" ( Copy the protein sequence into this screen and start the analysis. Which two large protein domains are found in the E. coli photolyase protein? What are the functions of these two domains? To find homologs in other organisms you can choose to use the complete protein or one of the two domains. We will first search for homologs in the one-cellular organism bakers yeast Saccharomyces cerevisiae. Copy the E. coli photolyase amino acid sequence and find homologs in yeast using Blast ( Which Blast program would be best suited for this task? Paste the protein sequence in the 'search' window and limit your search to "Saccharomyces cerevisiae" in the options panel. After you started the Blast comparison, a new screen will pop up, again showing the two domains present in the photolyase protein. Hit the 'format' button to go the results. Click on the best hit, preferably again a 'NP_xxxxx' sequence and retrieve and copy this sequence in FASTA format to your notepad with the E. coli sequence. Blast also returns an alignment of the E. coli and yeast protein sequence, but this is a local alignment that only shows those parts that match best. In this case, homology information for the start and end of the protein is missing. To make a global alignment, we will use the program Align ( The alignment method is Page 2 of 6

3 standard put on global alignment. Paste the E. coli and yeast protein sequences in the two different input fields. Hit 'run' to see the aligned output. What is the most striking difference between the two sequences? This part of the protein may play a role in the subcellular targeting of the protein. Go to the Saccharomyces Genome Database (SGD) ( and find out what the subcellular localisation of the yeast photolyase protein is to search for "Phr1", which is the yeast name for this protein. What is the subcellular localisation of the protein? Could this be expected? Assuming that the domain that is present in yeast and not in E. coli is responsible for this localisation, why can E. coli do without this segment? Now go back and try to find other homologs of the E. coli photolyase in Eukaryotes. Include homologs in human, mouse and a plant and some organisms of your own choice. Copy all sequences in FASTA format (preferentially sequences with NP_xxxxx names) to a new notepad file. Note that organisms may contain multiple different homologs! Collect all of them. Once you have a nice collection of sequences we will compare them with each other using the multiple sequence alignment program ClustalW ( Read the Frequently Asked Questions for more background on this tool. On the bottom of the page you will find the 'Upload a file' field. Select your saved notepad file and run the program. Discuss your findings in your report. You can improve your alignment by removing distantly related sequences. Delete these sequences (e.g. E. coli) from your notepad file and reanalyse your sequences. The human and mouse genome both contain two clear photolyase homologs: cryptochrome 1 and 2. Describe which genes are likely to be orthologs and which are paralogs. Page 3 of 6

4 Task 2: Comparative genome analysis of the human cry2 locus. From Task 1 you have learnt that you can find protein sequences and identify homologs in other organisms. However, sometimes the protein sequence is not available for a given organism or it may be questionable if the gene structure is properly predicted from the genome sequence. In this task, you will search for homologous regions in mouse, rat, chimpanzee, fugu, etcetera using the comparative genome browser VISTA ( You will find various programs on the VISTA home page for specific types of searches. Go to the VISTA Browser ( and search in the 'Human July 2003' genome for the human photolyase gene 'cry2' by filling out this term in the position field. You will now graphically see the degree of conservation between the homologous human and mouse genome sequences. Try to understand the figure and colouring using the legend. Extend the comparison by adding more organisms using the pull down menu on the left. Which parts of the gene are clearly conserved in all organisms? Which organisms are best suited for the identification of this kind of conserved regions? Which are less suited? Explain why. Which organism would be best suited for finding conserved and potentially functional promoter elements that regulate the expression of this gene? Zoom out by clicking on the magnification icon with the '-' sign. You will now see a larger genomic region. In the chimpanzee trace you will now see a large gap. What does this mean and what process is underlying this. Page 4 of 6

5 Task 3: Identification of functional genomic elements using phylogenetic shadowing This morning you have read the paper by Boffelli et al. on phylogenetic shadowing. This method is specifically suited for the identification of small conserved elements in a genome or lineage-specific features. For this task you will be using the sequences from 10 different primates (FASTA format) from the course webpage. Align these sequences using ClustalW. What can you conclude from this alignment? There is clearly another approach needed to extract information from these sequences. Use the eshadow ( tool to analyse these sequences. Play around with the window size settings to get a clear view. What is shown in the graph? How many potentially functional segments are present in this region and what principle is underlying this hypothesis? What is the estimated size of each conserved region? Page 5 of 6

6 Now let's go back to the Vista homepage and see if we can retrieve the same information using other genomes. Use the GenomeVISTA tool and use the human sequence in your sequence list to search the genomic coordinates in the human June 2004 genome assembly. Wait until your search is finished and click the 'Vista browser' option. Add all available organisms for comparison. What can you conclude? Which organisms could also be used to identify these individual elements and which are not very informative? What is the estimated size of each conserved region? Close the VISTA browser window and select the 'VISTA track' option in the search results window. You are now redirected to the UCSC genome browser, which displays your results along with existing genome annotation. There is another track with conservation information, showing the cumulative conservation using information from 10 different organisms (this is not a pairwise alignment, as you have seen thus far in VISTA, but a graphical representation of a sort of ClustalW multiple alignment). What would you conclude from the 10-way alignment? What is the estimated size of each conserved region? Under the graph you will find many options that can be displayed as well. Select the 'full' option for the sno/mirna option. Which element(s) reside in the conserved regions? What are their sizes? Page 6 of 6

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected

More information

Exercises for the UCSC Genome Browser Introduction

Exercises for the UCSC Genome Browser Introduction Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

DNA Sequencing Overview

DNA Sequencing Overview DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

EMBL-EBI Web Services

EMBL-EBI Web Services EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Analyzing A DNA Sequence Chromatogram

Analyzing A DNA Sequence Chromatogram LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Authorware Install Directions for IE in Windows Vista, Windows 7, and Windows 8

Authorware Install Directions for IE in Windows Vista, Windows 7, and Windows 8 Authorware Install Directions for IE in Windows Vista, Windows 7, and Windows 8 1. Read entire document before continuing. 2. Close all browser windows. There should be no websites open. If you are using

More information

CLC Sequence Viewer USER MANUAL

CLC Sequence Viewer USER MANUAL CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet

More information

Course Equivalencies

Course Equivalencies Course Equivalencies This tutorial is on using the Course Equivalency function for ARTSYS. Part One focuses on how to determine how one community college course transfers to a four-year institution. First,

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

Guidelines for Creating Reports

Guidelines for Creating Reports Guidelines for Creating Reports Contents Exercise 1: Custom Reporting - Ad hoc Reports... 1 Exercise 2: Custom Reporting - Ad Hoc Queries... 5 Exercise 3: Section Status Report.... 8 Exercise 1: Custom

More information

BIOINFORMATICS TUTORIAL

BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

RAST Automated Analysis. What is RAST for?

RAST Automated Analysis. What is RAST for? RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Citrix Client Install Instructions

Citrix Client Install Instructions Citrix Client Install Instructions If you are using Citrix remotely, Information Technology Services recommends updating Citrix client to the newest version available online. You must be an administrator

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

1&1 SEO Tool Expert Call

1&1 SEO Tool Expert Call 1&1 SEO Tool Expert Call Introduction Search Engine Optimization (SEO) is one of the most effective marketing tactics to generate leads and sales for your business website. Here are some few important

More information

Library page. SRS first view. Different types of database in SRS. Standard query form

Library page. SRS first view. Different types of database in SRS. Standard query form SRS & Entrez SRS Sequence Retrieval System Bengt Persson Whatis SRS? Sequence Retrieval System User-friendly interface to databases http://srs.ebi.ac.uk Developed by Thure Etzold and co-workers EMBL/EBI

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Structure Tools and Visualization

Structure Tools and Visualization Structure Tools and Visualization Gary Van Domselaar University of Alberta gary.vandomselaar@ualberta.ca Slides Adapted from Michel Dumontier, Blueprint Initiative 1 Visualization & Communication Visualization

More information

JustClust User Manual

JustClust User Manual JustClust User Manual Contents 1. Installing JustClust 2. Running JustClust 3. Basic Usage of JustClust 3.1. Creating a Network 3.2. Clustering a Network 3.3. Applying a Layout 3.4. Saving and Loading

More information

Downloading RIT Account Analysis Reports into Excel

Downloading RIT Account Analysis Reports into Excel Downloading RIT Account Analysis Reports into Excel In the last lesson you learned how to access the Account Analysis detail and export it to Excel through the Account Analysis function. Another way to

More information

CUSTOMER+ PURL Manager

CUSTOMER+ PURL Manager CUSTOMER+ PURL Manager October, 2009 CUSTOMER+ v. 5.3.1 Section I: Creating the PURL 1. Go to Administration > PURL Management > PURLs 2. Click Add Personalized URL 3. In the Edit PURL screen, Name your

More information

ecommercesoftwareone Advance User s Guide -www.ecommercesoftwareone.com

ecommercesoftwareone Advance User s Guide -www.ecommercesoftwareone.com Advance User s Guide -www.ecommercesoftwareone.com Contents Background 3 Method 4 Step 1 - Select Advance site layout 4 Step 2 - Identify Home page code of top/left and bottom/right sections 6 Step 3 -

More information

Visualization of Phylogenetic Trees and Metadata

Visualization of Phylogenetic Trees and Metadata Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com

More information

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Google Sites. How to create a site using Google Sites

Google Sites. How to create a site using Google Sites Contents How to create a site using Google Sites... 2 Creating a Google Site... 2 Choose a Template... 2 Name Your Site... 3 Choose A Theme... 3 Add Site Categories and Descriptions... 3 Launch Your Google

More information

Blocking Junk email in Outlook Version 1.00

Blocking Junk email in Outlook Version 1.00 Blocking Junk email in Outlook Version 1.00 Need to Know TM Junk and offensive email is unfortunately a fact of life these days but there is way that you can use Outlook to assist you dealing with these

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

RCS Liferay Google Analytics Portlet Installation Guide

RCS Liferay Google Analytics Portlet Installation Guide RCS Liferay Google Analytics Portlet Installation Guide Document Revisions Date Revision By 07/02/12 1 Pablo Rendón 2 Table of Contents RCS Liferay-Google Analytics...1 Document Revisions...2 General Description...4

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

Regional Drought Decision Support System (RDDSS) Charting Tools Help Documentation

Regional Drought Decision Support System (RDDSS) Charting Tools Help Documentation Regional Drought Decision Support System (RDDSS) Charting Tools Help Documentation The following help documentation was prepared to give insight to the basic functionality of the charting tools within

More information

BMC Bioinformatics. Open Access. Abstract

BMC Bioinformatics. Open Access. Abstract BMC Bioinformatics BioMed Central Software Recent Hits Acquired by BLAST (ReHAB): A tool to identify new hits in sequence similarity searches Joe Whitney, David J Esteban and Chris Upton* Open Access Address:

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Cary 100 Bio UV-Vis Operating Instructions 09/25/2012 S.V.

Cary 100 Bio UV-Vis Operating Instructions 09/25/2012 S.V. 1234 Hach Hall 515-294-5805 www.cif.iastate.edu Cary 100 Bio UV-Vis Operating Instructions 09/25/2012 S.V. Location: Contact: 1240 Hach Hall Steve Veysey, 1234 Hach Hall Safety All researchers working

More information

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest Having a BLAST: Analyzing Gene Sequence Data with BlastQuest William G. Farmerie 1, Joachim Hammer 2, Li Liu 1, and Markus Schneider 2 University of Florida Gainesville, FL 32611, U.S.A. Abstract An essential

More information

Latin American and Caribbean Flood and Drought Monitor Tutorial Last Updated: November 2014

Latin American and Caribbean Flood and Drought Monitor Tutorial Last Updated: November 2014 Latin American and Caribbean Flood and Drought Monitor Tutorial Last Updated: November 2014 Introduction: This tutorial examines the main features of the Latin American and Caribbean Flood and Drought

More information

Using Impatica for Power Point

Using Impatica for Power Point Using Impatica for Power Point What is Impatica? Impatica is a tool that will help you to compress PowerPoint presentations and convert them into a more efficient format for web delivery. Impatica for

More information

4. Do you have a VGA splitter ( Y Cable)? a document camera?

4. Do you have a VGA splitter ( Y Cable)? a document camera? Hooking up your computer to your projector and/or doc camera These instructions will assist you in performing a proper hookup of your computer to your projector and/or document camera. The instructions

More information

Inking in MS Office 2013

Inking in MS Office 2013 VIRGINIA TECH Inking in MS Office 2013 Getting Started Guide Instructional Technology Team, College of Engineering Last Updated: Fall 2013 Email tabletteam@vt.edu if you need additional assistance after

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015 Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Egnyte Single Sign-On (SSO) Installation for Okta

Egnyte Single Sign-On (SSO) Installation for Okta w w w. e g n y t e. c o m Egnyte Single Sign-On (SSO) Installation for Okta To set up Egnyte so employees can log in using SSO, follow the steps below to configure Okta and Egnyte to work with each other.

More information

Geocortex HTML 5 Viewer Manual

Geocortex HTML 5 Viewer Manual 1 FAQ Nothing Happens When I Print? How Do I Search? How Do I Find Feature Information? How Do I Print? How can I Email A Map? How Do I See the Legend? How Do I Find the Coordinates of a Location? How

More information

UF Health SharePoint 2010 Introduction to Content Administration

UF Health SharePoint 2010 Introduction to Content Administration UF Health SharePoint 2010 Introduction to Content Administration Email: training@health.ufl.edu Web Page: http://training.health.ufl.edu Last Updated 2/7/2014 Introduction to SharePoint 2010 2.0 Hours

More information

Check current version of Remote Desktop Connection for Mac.. Page 2. Remove Old Version Remote Desktop Connection..Page 8

Check current version of Remote Desktop Connection for Mac.. Page 2. Remove Old Version Remote Desktop Connection..Page 8 CONTENTS SECTION 1 Check current version of Remote Desktop Connection for Mac.. Page 2 SECTION 2 Remove Old Version Remote Desktop Connection..Page 8 SECTION 3 Download and Install Remote Desktop Connection

More information

LEARNING RESOURCE CENTRE. Guide to Microsoft Office Online and One Drive

LEARNING RESOURCE CENTRE. Guide to Microsoft Office Online and One Drive LEARNING RESOURCE CENTRE Guide to Microsoft Office Online and One Drive LEARNING RESOURCE CENTRE JULY 2015 Table of Contents Microsoft Office Online... 3 How to create folders... 6 How to change the document

More information

What is Microsoft PowerPoint?

What is Microsoft PowerPoint? What is Microsoft PowerPoint? Microsoft PowerPoint is a powerful presentation builder. In PowerPoint, you can create slides for a slide-show with dynamic effects that will keep any audience s attention.

More information

Software review. Analysis for free: Comparing programs for sequence analysis

Software review. Analysis for free: Comparing programs for sequence analysis Analysis for free: Comparing programs for sequence analysis Keywords: sequence comparison tools, alignment, annotation, freeware, sequence analysis Abstract Programs to import, manage and align sequences

More information

DCAD Website Instruction Manual

DCAD Website Instruction Manual DCAD Website Instruction Manual - 1-9/1/2010 INDEX PAGE Search Appraisal ---------------------------- 3-4 Owner Name ------------------------------ 5-6 Account Number ------------------------------ 7 Street

More information

Pipeliner CRM Phaenomena Guide Opportunity Management. 2015 Pipelinersales Inc. www.pipelinersales.com

Pipeliner CRM Phaenomena Guide Opportunity Management. 2015 Pipelinersales Inc. www.pipelinersales.com Opportunity Management 205 Pipelinersales Inc. www.pipelinersales.com Opportunity Management Learn how to manage sales opportunities with Pipeliner Sales CRM Application. CONTENT. Creating and sharing

More information

NIS-Elements Viewer. User's Guide

NIS-Elements Viewer. User's Guide NIS-Elements Viewer User's Guide Publication date 10.09.2013 v. 4.20.00 Laboratory Imaging, s. r. o., Za Drahou 171/17, CZ - 102 00 Praha 10 No part of this publication may be reproduced or transmitted

More information

Cell Division Simulation: Bacteria Activity One

Cell Division Simulation: Bacteria Activity One Cell Division Simulation: Bacteria Activity One Introduction All living things are made of cells. Some living things, like plants and animals, are made of millions of cells. But some living things are

More information

Human-Mouse Synteny in Functional Genomics Experiment

Human-Mouse Synteny in Functional Genomics Experiment Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Zoho CRM and Google Apps Synchronization

Zoho CRM and Google Apps Synchronization Zoho CRM and Google Apps Synchronization Table of Contents End User Integration Points 1. Contacts 2. Calendar 3. Email 4. Tasks 5. Docs 3 6 8 11 12 Domain-Wide Points of Integration 1. Authentication

More information

OpenIMS 4.2. Document Management Server. User manual

OpenIMS 4.2. Document Management Server. User manual OpenIMS 4.2 Document Management Server User manual OpenSesame ICT BV Index 1 INTRODUCTION...4 1.1 Client specifications...4 2 INTRODUCTION OPENIMS DMS...5 2.1 Login...5 2.2 Language choice...5 3 OPENIMS

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

THE CHILDREN S HEALTH NETWORK CONTRACTING TOOL TRAINING MANUAL

THE CHILDREN S HEALTH NETWORK CONTRACTING TOOL TRAINING MANUAL THE CHILDREN S HEALTH NETWORK CONTRACTING TOOL TRAINING MANUAL 1 TCHN CONTRACTING TOOL TABLE OF CONTENTS 2 Overview 3 Step by Step Instructions 3 Logging In 4 The Main Menu Options 5 Creating Custom Lists

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

Create a Poster Using Publisher

Create a Poster Using Publisher Contents 1. Introduction 1. Starting Publisher 2. Create a Poster Template 5. Aligning your images and text 7. Apply a background 12. Add text to your poster 14. Add pictures to your poster 17. Add graphs

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

How to use PGS: Basic Services Provision Map App

How to use PGS: Basic Services Provision Map App How to use PGS: Basic Services Provision Map App The PGS: Basic Services Provision Map App The main features of the PGP Basic Services web application includes: Navigation Tools Map Tools Main Map Links

More information

Click on various options: Publications by Wizard Publications by Design Blank Publication

Click on various options: Publications by Wizard Publications by Design Blank Publication Click on various options: Publications by Wizard Publications by Design Blank Publication Select the Blank Publications Tab: Choose a blank full page Click on Create New Page Insert > Page Select the number

More information

Tutorial for Tracker and Supporting Software By David Chandler

Tutorial for Tracker and Supporting Software By David Chandler Tutorial for Tracker and Supporting Software By David Chandler I use a number of free, open source programs to do video analysis. 1. Avidemux, to exerpt the video clip, read the video properties, and save

More information

Umbraco Content Management System (CMS) User Guide

Umbraco Content Management System (CMS) User Guide Umbraco Content Management System (CMS) User Guide Content & media At the bottom-left of the screen you ll see 2 main sections of the CMS Content and Media. Content is the section that displays by default

More information

Adobe Acrobat 6.0 Professional

Adobe Acrobat 6.0 Professional Adobe Acrobat 6.0 Professional Manual Adobe Acrobat 6.0 Professional Manual Purpose The will teach you to create, edit, save, and print PDF files. You will also learn some of Adobe s collaborative functions,

More information

Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions

Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be

More information

Filling out application form manual

Filling out application form manual Document version : 1.0.0 Date of creation : 20.12.2010 CENTRAL REGISTRY OF REPUBLIC OF MACEDONIA Blvd. Kuzman Josifoski Pitu Nr.1 1000 Skopje Tel.: + 389 2 3290-241, + 389 2 3290-248 Fax: + 389 2 3123-169

More information

From the list of Cooperative Extension applications, choose Contacts Extension Contact Management System.

From the list of Cooperative Extension applications, choose Contacts Extension Contact Management System. 1 Illustrated Guide to Creating Labels with Word for Mac 2008 for Mailing Lists in the Extension Contacts Database Note: With most computer tasks, there are multiple ways to achieve the same results. Substitute

More information

Introduction to Smart Board. Table of Contents. Connection Basics 3. Using the Board (Basics) 4. The Floating Tools Toolbar 5-6

Introduction to Smart Board. Table of Contents. Connection Basics 3. Using the Board (Basics) 4. The Floating Tools Toolbar 5-6 Introduction to Smart Board Table of Contents Overview 2 Connection Basics 3 Using the Board (Basics) 4 The Floating Tools Toolbar 5-6 The Smartboard Smart Tool Buttons Collecting and Sharing Content with

More information

Investigating World Development with a GIS

Investigating World Development with a GIS Investigating World Development with a GIS Economic and human development is not consistent across the world. Some countries have developed more quickly than others and we call these countries MEDCs (More

More information

In this example, Mrs. Smith is looking to create graphs that represent the ethnic diversity of the 24 students in her 4 th grade class.

In this example, Mrs. Smith is looking to create graphs that represent the ethnic diversity of the 24 students in her 4 th grade class. Creating a Pie Graph Step-by-step directions In this example, Mrs. Smith is looking to create graphs that represent the ethnic diversity of the 24 students in her 4 th grade class. 1. Enter Data A. Open

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

D2L: An introduction to CONTENT University of Wisconsin-Parkside

D2L: An introduction to CONTENT University of Wisconsin-Parkside D2L: An introduction to CONTENT University of Wisconsin-Parkside FOR FACULTY: What is CONTENT? The Content and Course Builder tools both allow you to organize materials in D2L. Content lets you and your

More information

After going through this lesson you would be able to:

After going through this lesson you would be able to: 18 :: Data Entry Operations 2 Operating System 2.1 INTRODUCTION The operating system in these days uses a graphical user interface (GUI). Here you do not have to remember all the commands by heart. The

More information

SPSS INSTRUCTION CHAPTER 1

SPSS INSTRUCTION CHAPTER 1 SPSS INSTRUCTION CHAPTER 1 Performing the data manipulations described in Section 1.4 of the chapter require minimal computations, easily handled with a pencil, sheet of paper, and a calculator. However,

More information

Decreases the magnification of your chart. Changes the magnification of the displayed chart.

Decreases the magnification of your chart. Changes the magnification of the displayed chart. OrgPlus Guide 1) Logging In 2) Icon Key 3) Views a. Org Chart b. Salary Org Chart c. Head Count/Span of Control 4) Viewing Profile/Explore/Bookmarks Panels a. Creating Bookmarks 5) Searching a. From the

More information