Genetics and Heredity. Part 1: Who Was Gregor Mendel?

Transcription

1 Genetics and Heredity Part 1: Who Was Gregor Mendel?

2 Introduction Genetics is the scientific study of heredity. Heredity is the passing of physical characteristics from parent to offspring. The first major experiments of heredity were done by a monk named Gregor Mendel. Mendel is known as the father of modern genetics.

3 Who Was Mendel? An Austrian monk who worked in a monastery in Brno, in present-day Czech Republic Taught biology to high school students Became interested in theories of evolution Wondered why when some plants were bred, the offspring did NOT become blended versions of their parents Experimented first on pea plants

4 More Facts on Mendel Mendel s parents were very poor and sent him to the monastery so that he could get an education. He was sent to the University of Vienna to get a teaching degree, but he failed miserably. One examiner commented that Mendel lacks insight and clarity of knowledge. Ouch. While in university, Mendel became interested in the work of a biologist who studied inheritance He came back to the monastery a teaching failure, but was allowed to perform experiments on peas two years later.

5 Brno Monastery

6 Mendel s Garden

7 Why Peas? Peas grow fast and don t take up much space. Peas show a variety of contrasting traits: pea color, flower color, height, pod shape, etc. Peas usually reproduce by self-fertilization: the flower is able to fertilize itself. This allows peas to make purebreds easily: all offspring show the same traits every generation

8 Mendel s Work For 7 years, Mendel grew and tested 28,000 pea plants. He looked carefully at 7 individual traits: Height Flower Position Seed Shape Flower Color Seed Color Pod Color Pod Shape

9

10 Mendel s Work Mendel developed a new method to control exactly how the pea plants were fertilized: Self-fertilization Always produces offspring with the same traits as the parent plant Cross-fertilization Produces offspring that may be different or the same as the parent plant Purebred Hybrid

11 Review: Flower Anatomy Male Anther Releases pollen grains Female Ovary Holds the egg cell

12 Mendel s Method

13 Parent Generation Example: Flower Color Mendel let each variety self-fertilize for several generations, creating two pure-breeding parent (P) generations

14 First Generation (F1) Then, he carefully cross-pollinated a parent (P1) with white flowers and a parent (P2) with purple flowers

15 First Generation (F1) Mendel Then, he saw carefully in the first cross-pollinated generation (F1) a that parent ALL the (P1) peas with white had purple flowers flowers and a parent the white (P2) color with disappeared! purple flowers

16 Second Generation (F2) Then, Mendel created a second generation (F2) by letting the hybrid plants self fertilize.

17 Second Generation (F2) The white color reappeared! But this time, there was a clear ratio of 3 purple plants to 1 white plant (3:1)

18 A Summary

19 More Findings Mendel s other experiments with different traits ended the same way. For example: plant height (tall/short)

20 More Findings Mendel s other experiments with different traits ended the same way. How was this possible? Mendel analyzed all of his data and found patterns. From his analysis, he made several conclusions...

21 There must have two factors or versions for each trait: one from each parent. Traits = genes Factors/Versions = alleles Some traits, like purple flowers, will always appear, even if only 1 factor is present. Visible forms = dominant alleles Other traits, such as white flowers, can be hidden by other factors. Masked forms = recessive alleles

22 Any Questions?

23 Genetics and Heredity Part 2: Punnett Squares

24 Sample Problem A mother is heterozygous for brown eyes. The father is homozygous for blue eyes. What s the likelihood of having a blue-eyed child? The allele for brown eyes is dominant The allele for blue eyes is recessive B b Mother Father B Bb b b bb b

25 Sample Problem Mother Heterozygous Brown Father Homozygous Blue B b b b Bb Bb bb bb 50% Brown 50% Blue

26 Punnet Square Method Mother Heterozygous Brown Father Homozygous Blue B b b b Bb Bb 50% bb bb 50%

27 Step By Step Guide 1. Determine the genotypes of the 2 parents. 2. Write down the two alleles for each. 3. Put the father s alleles on the top of the P.S. 4. Put the mother s alleles on the side of the P.S. 5. Finish the P.S. by cross-multiplying the alleles. 6. Determine the final phenotypes and ratios.

28 Boy or Girl? A mother and father want to have a child. What is the likelihood of the child being a boy? The X chromosome codes for a girl The Y chromosome codes for a boy X Y Mother Father X X X Y

29 Boy or Girl? Mother Father X X X Y XX XY 50% XX XY 50%

30 Challenge 1 Elmo Monster was born to proud parents Ernie and Elma Monster. Both parents had red fur.

31 Challenge 1 If Elmo s parents BOTH had red fur, how could Lulu be born with yellow fur? Write down the possible genotypes of Elmo s parents and use a Punnett Square to show how Lulu s yellow fur could be possible.

32 Elmo and Lulu Mother - Elma Father - Ernie R r R r RR Rr Rr rr 75% red fur 25% yellow

33 Challenge 2 Grover Monster looks like an ordinary monster, but he is blessed with superhero genes. The gene is recessive and Grover is homozygous for it.

34 Challenge 2 If Grover marries his girlfriend Zoe, who has only one copy of the recessive superhero gene, what is the chance of having superhero children?

35 Grover and Zoe Zoe - Normal Grover - Superhero S s s s Ss ss Ss ss 50% super 50% normal

36 Any Questions?

37 Genetics and Heredity Part 3: DNA

38 Introduction Cells contain information inside the nucleus. This information is stored as genetic material in a molecule called DNA. DNA is short for deoxyribonucleic acid The DNA acts a code and controls the production of proteins in each cell.

39 The Protein Connection All organisms are built out of proteins. Proteins are the building blocks of all cells and organisms made up of cells. The type of proteins in an organism help determine its size, shape, color, and many other traits.

40 The DNA Connection To put it simply, the code found in DNA acts as a blueprint to build proteins from scratch.

41 The Protein Connection There are over 10,000 different proteins in one body cell! Each protein is described by one segment of DNA called a gene. One Gene = One Protein

42 The Protein Connection one chromosome gene for a protein for green eyes gene for a protein for curly hair gene for a protein for tallness But we re getting gene for a protein for five fingers gene for a protein for stomach lining ahead of ourselves gene for a protein for jaw strength gene for a protein for nose shape One Gene = One Protein

43 Chromosomes DNA is an extremely long molecule. The DNA in each cell is tightly-packed into structures called chromosomes. Each chromosome is about cm long, but stretched out they would be 7 cm long! You have 46 chromosomes total.

44 Uncoiled DNA - Chromatin

45

46 Cool Fact If you unraveled the DNA in ALL of your chromosomes from all of your cells, it would stretch from Earth to the Moon nearly 6000 times

47 Key Facts So Far 1. DNA is the genetic material found in the nucleus of all cells. 2. DNA is an extremely long molecule. 3. DNA is tightly packed into chromosomes 4. DNA acts as a code to make proteins. 5. Each protein is coded by its own segment of DNA, called a gene. 6. Since there are over 100,00 proteins in a human, there are over 100,000 genes.

48 Next Question! But how does DNA act as a code?

49 DNA Structure The structure of DNA lets it act as a code. DNA looks like a twisted ladder. It has 2 flexible arms bent into a spiral pattern And different rungs held between the arms The shape is a double helix.

50 DNA Structure The rungs are very important. They are called nucleotides and there are four different types of them: A Adenine Cytosine C G Guanine Thymine T

51 DNA Structure The nucleotides pair up in a certain way. Adenine always pairs with Thymine A T Cytosine always pairs with Guanine G C

52 DNA Structure The nucleotides pair up in a certain way. Adenine always pairs with Thymine A T All Tigers Can Growl Cytosine always pairs with Guanine G C

53 Cool Fact If you wrote down all the nucleotides in one cell it would fill 1000 phone books

54 DNA Code So how do DNA nucleotides give instructions? DNA is a 4-letter code. The order of A, T, C, Gs creates a four-letter alphabet that is read by ribosomes when they make proteins. Each protein has its own code!

55 An Example If Hemoglobin you unraveled is a the special DNA in protein ALL found in of red your blood chromosomes cells that from captures all oxygen. of your cells, it would stretch from Earth to the Moon nearly Here is its unique nucleotide sequence

56 Hemoglobin DNA Sequence TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGA CCGCTCATACCACGCCTCCGGGACCTCTCCTACAAGGACAGGAGGGGTGGTGGTTCTGGATGAAGG GCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGTGCCGTTCTTCCACCGGCTGCGCG ACTGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTG CGCGTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGAC CGGCGGGTGGAGGGGCGGCTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGA AGACACTCGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAGCCATCGTCAAGGAGGACGGT CTACCCGGAGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTC AGACTCACCCGCCGTACCACGTGGACTGAGGACTCCTCTTCAGACGCCAATGACGGGACACCCCGT TCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCGACGACCACCAGATGGGAACCTGGG TCTCCAAGAAACTCAGGAAACCCCTAGACAGGTGAGGACTACGTCAATACCCGTTGGGATTCCACTTC CGAGTACCGTTCTTTCACGAGCCACGGAAATCACTACCGGACCGAGTGGACCTGTTGGAGTTCCCGTG GAAACGGTGTGACTCACTCGACGTGACACTGTTCGACGTGCACCTAGGACTCTTGAAGTCCGAGGAC CCGTTGCACGACCAGACACACGACCGGGTAGTGAAACCGTTTCTTAAGTGGGGTGGTCACGTCCGAC GGATAGTCTTTCACCACCGACCACACCGATTACGGGACCGGGTGTTCATAGTGATTACCACGACAGAG GACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCAC GCCTCCGGGACCTCTCCTACAAGGACAGGAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGA CTCGGTGCCGAGACGGGTCCAATTCCCGGTGCCGTTCTTCCACCGGCTGCGCGACTGGTTGCGGCAC CGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTGCGCGTGTTCGAAGC CCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGCGGGTGGAGG GGCGGCTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTCGTGGCA CGACTGGAGGTTTATGGCAATTCGACCTCGGAGCCATCGTCAAGGAGGACGGTCTACCCGGAGGGTT GCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGACTCACCCGCCG TACCACGTGGACTGAGGACTCCTCTTCAGACGCCAATGACGGGACACCCCGTTCCACTTGCACCTACT TCAACCACCACTCCGGGACCCGTCCGACGACCACCAGATGGGAACCTGGGTCTCCAAGAAACTCA GGAAACCCCTAGACAGGTGAGGACTACGTCAATACCCGTTGGGATTCCACTTCCGAGTACCGTTCTTTC ACGAGCCACGGAAATCACTACCGGACCGAGTGGACCTGTTGGAGTTCCCGTGGAAACGGTGTGACT CACTCGACGTGACACTGTTCGACGTGCACCTAGGACTCTTGAAGTCCGAGGACCCGTTGCACGACCA GACACACGACCGGGTAGTGAAACCGTTTCTTAAGTGGGGTGGTCACGTCCGACGGATAGTCTTTCACC ACCGACCACACCGATTACGGGACCGGGTGTTCATAGTGATT

57 Another Example Pepsin is an enzyme found in the stomach which helps to digest proteins in your food. TACCACGACAGAGGA CGGCTGTTCTGGTTGCA GTTCCGGCGGACCCC GTTCCAACCGCGCGTG CGACCGCTCATACCAC GCCTCCGGGACCTCTC CTACAAGGACAGGAA GGGGTGGTGGTTCTGG ATGAAGGGCGTGAAG CTGGACTCGGTGCCGA GACGGGTCCAATTCCC GGTGCCGTTCTTCCACC GGCTGCGCGACTGGTT GCGGCACCGCGTGCA CCTGCTGTACGGGTTGC GCGACAGGCGGGACT CGCTGGACGTGCGCGT GTTCGAAGCCCACCTG GGCCAGTTGAAGTTCG AGGATTCGGTGACGG gene on chromosome DNA segment nucleotide code pepsin protein

58 Key Facts So Far 1. DNA looks like a twisted ladder. This shape is called a double helix. 2. The rungs of the ladder are nucleotides. 3. There are 4 types of nucleotides: adenine, thymine, cytosine, and guanine. 4. The order of the nucleotides forms a four-letter code that is read by ribosomes. 5. Each protein in your body has its own unique nucleotide sequence.

59 It is packaged into tight structures called chromosomes. DNA Packaging DNA is a thin molecule that is very long. The length of DNA in one cell is over 3 METERS long! DNA must be tightly packaged to be able to fit into a cell.

60 Chromosomes Different species have different # of chromosomes. Mosquitoes have 3 Flies have 6 Cats have 19 Mice have 21 Potatoes have 24 Chickens have 39

61 Any Questions?

62 Genetics and Heredity Part 4: DNA and Protein Synthesis

63 The DNA Code The DNA code is similar to our alphabet. Our alphabet has 26 letters. You can combine any of these 26 letters to create over 400,000 words! But, for the alphabet code to make sense, the letters must be in some order

64 The DNA Code How is the alphabet a code, exactly? Take the word koala It s made of the letters K, O, A, L These letters appear in many other words, but don t have anything to do with koalas! G Day The letters must be put in a certain order to make sense.

65 The DNA Code The DNA is also a code. But only with 4 letters, not 26! The meaning of the DNA code lies in the order of ATCG, in the same way the order of letters in a word is important. So, DNA has meaning!

66 Proteins Proteins are made up of smaller amino acids. To make a protein, amino acids combine together in a long chain like a necklace. There are 20 different kinds of amino acids. Like our alphabet, they can be combined together in a huge number of ways.

67 Amino Acids

68 Proteins

69 Summary The order of the nucleotides in DNA forms a code that specifies the order of amino acids in a protein.

70 Any Questions?