What next? Computational Biology and Bioinformatics. Finding homologs 2. Finding homologs. 4. Searching for homologs with BLAST
|
|
- Steven Peters
- 7 years ago
- Views:
Transcription
1 Computational Biology and Bioinformatics 4. Searching for homologs with BLAST What next? Comparing sequences and searching for homologs Sequence alignment and substitution matrices Searching for sequences with BLAST MSA and profiles Multiple sequence alignment PSSM-based profiles Evolving sequences Phylogenetic trees Finding homologs We now know how to do alignments and how to score these alignments The next question is: Given a sequences q, can we find other sequences d in a database D that are homologues to q? For instance, when q is the G2A, the search process should find all similar genes. So it has to find genes G1A, G1B et G2B and they have to be at the top of the list The sequences found by this method can provide information concerning the structure and function of the protein q Finding homologs 2 Simple approach : Make a global alignment between q and every sequence d in the database D BUT : Sometimes only a segment of q to a segment in the other sequence d or there is only a similarity in a particular pattern or the order of the domains in q and d is not the same, but there are similarities between domains For these reasons we need to use a local alignment
2 Finding homologs 3 Local alignment the Smith-Waterman algorithm BUT, exhaustively applying SW takes too much time December 2009, UniprotKB/TREMBL contains 107 entries In the years , the computational resources were limited There was a need for efficient techniques FASTA et BLAST DP guarantees to find the optimal alignment. This is no longer true for FASTA and BLAST since they use heuristic methods FASTA W. Pearson et D.J. Lipman (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85: FASTA BLAST fasta33/index.html S.F. Altschul et al (1990) Basic local alignment search tool. J Mol Biol 215:
3 Some initial definitions BLAST A segment is a subsequence of a certain length in the original sequence A word is a segment of size w Maximal scoring segment pairs (MSP)is a pair of aligned segments (no gaps) of the same length with the highest score in the sequences q and d High scoring segment pairs (HSP) is a pair of aligned segments for which the score can not be improved by extending the the alignment at either side of the two segments (no gaps). BLAST consists of 4 steps 1. For every sequence d in D, look for the words of the sequence d that have a score of at least T when aligned with words in sequence q 2. Determine the HSP: take the pairs of aligned words and try to improve the alignment by extending at both sides 3. Use dynamic programming to determine the gapped alignments for the HSP 4. Retrieve the local alignments from the HSP obtained in the previous round BLAST The structure of BLAST is equivalent to the structure of FASTA There are two important difference between the two systems In the first stage, FASTA looks for k-tuples in every sequence d that are identical to those in the sequence q. BLAST looks for k-tuples with a score above a threshold T BLAST stage 1 For every sequence d in D, look for the words of the sequence d that have a score of at least T when aligned with words in sequence q Every word pair that meets this condition is called a hit Originally the same indexation technique (hashing et chaining) as FASTA was used BUT They showed that a finite state transducer could improve the efficiency In the first stage, FASTA uses a lookup table. BLAST can use the same data structure, but they discovered that a finite state transducer is more efficient
4 Deterministic Finite State Automata A deterministic finite state automata is defined as a 5-tuple (Q,,δ,q0,F) : Q is a finite set of states is the alphabet δ:qx Q is the transition function q0 Q is the start state F Q is the set of end states Finite state transducers These are DFA that can produce output The Moore machines The Mealey machines Mealey machines are also often used in cryptography There is only one start state Finite state transducers 2 An FST is defined like an ADF but with three differences: 1. There are no end states anymore 2. Λ is a finite output alphabet 3. λ is an output function λ:qx Λ for Mealey machines λ:q Λ for Moore machines Therefore a finite state transducer is defined as 6-tuple (Q,,Λ,δ,λ,q0) M. Cameron et al (2006) A deterministic finite automaton for faster protein hit detection in BLAST. Jour Comp Biol 13(4): BLAST stage I 2 Take the following sequence q (size = n=10) and w=2 AQRQRRQARQ The sequence is again partitioned into w-tuples: The alphabet is {A,Q,R} with size α=3 AQ,QR,RQ,QR,RR,RQ,QA,AR,RQ BLOSUM 62 is used for the scores look for all the words of size w (2 3 =8 in total) that have a score bigger T (here T=5) when aligned to the w- tuples of q
5 AQ QR RQ RR QA AR AA AQ AR QA QQ QR RA RQ RR BLAST stage I 3 All words with a score bigger than for are accepted The elements in blue represent identical associations The elements in red are similar associations How is the Mealey machine constructed? BLAST stage I 4 Every prefix of size k-1 of a word is state of the transfucer three prefixes : A, Q and R BLAST stage I 5 Every state can have α transitions to other states BLAST stage I 6 The output alphabet corresponds to the start positions of the words in the sequence q q = AQRQRRQARQ First the exact matches between words AQ QR RQ RR QA AR AA AQ AR QA QQ QR RA RQ RR
6 BLAST stage I 7 The output alphabet corresponds to the start positions of the words in the sequence q Second the similar matches between words BLAST stage I 8 Using this Mealey machine we can look for the hits in every sequence d of D q = AQRQRRQARQ AQ QR RQ RR QA AR AA AQ AR QA QQ QR RA RQ RR d = RAAQQARAQR RA 6 AA / AQ 0,7 QQ 1,2,3,5,8 QA 6 AR 0,7 RA 6 AQ 0,7 QR 1,3,4 (0,6) / (2,0),(2,7) (3,1), (3,2),(3,3), (3,5),(3,8) (4,6) (5,0),(5,7) (6,6) (7,0),(7,7) (8,1),(8,3),(8,4) d = RAAQQARAQR BLAST stage I 9 Using this Mealey machine we can look for the hits in every sequence d of D BLAST stage 2 As in FASTA the diagonals are calculated Look for the HSP : Take every hit and try to extend the ends Stop when the score S becomes les than S-X identical similar RA 6 AA / AQ 0,7 QQ 1,2,3,5,8 QA 6 AR 0,7 RA 6 AQ 0,7 QR 1,3,4 (0,6) / (2,0),(2,7) (3,1), (3,2),(3,3), (3,5),(3,8) (4,6) (5,0),(5,7) (6,6) (7,0),(7,7) (8,1),(8,3),(8,4) The (j,i)-pairs are used in the second stage of BLAST identical similar Since the article published in1997 in NAR, one first tries to combine hits that are on the same diagonal When the distance between 2 hits is less than or equal to 4, the two hits are merged
7 How are the hits combined? BLAST stage 2 2 BLAST stage 2 3 One can also include the score (S) and size (T) of the hit RA (0,6) AA / AQ (2,0),(2,7) QQ (3,1), (3,2),(3,3), (3,5),(3,8) QA (4,6) AR (5,0),(5,7) RA (6,6) AQ (7,0),(7,7) QR (8,1),(8,3),(8,4) identical similar 1. detemine the diagonal for every pair (j,i): for instance : diag(ra)=j-i=0-6=-6 2. Store the start position (in q) in a table map which is indexed by the diagonal value RA : map(-6)=6 AQ : map(2)=0 ; map(-5)=7 QQ : map(2) =1 3. If the index in map is already occupied, determine the distance between the initial positions in q: AQ starts at 0 and QR starts at 1 : combine the hits et recalculate the score BLOSUM 62 Score(AQQ,AQR) = 4+5+1=10 All complete hits I P S T BLAST stage 2 4 Take every hit and try to extend the ends Stop when the score S becomes les than S-X Assume here X=1, the one HSP can be extended : extensions In this stage the indels are not considered I P S T BLAST stage 3 Use dynamic programming to determine the gapped alignments for the HSP All the gapless alignments that have a score higher than S1 are used Assume here S1>14 The HSP with score > S1 I P S T
8 BLAST stage 3 2 BLAST stage 4 Use a banded version of SW to look over a local alignment with gaps that contains the HSP Retrace starting from the highest value to get the local alignment Like with FASTA, the distance is limited at both sides of the diagonal The idea is to limit the number of insertions and deletions In case of the banded SW algorithm we get : QRQRR-QAR -RAA-QQAR Smith-Waterman with a gap penalty (g) of -10 the HSP BLAST Statistical significance Blast.cgi Does the sequence d* with a score S* found at the top of the list really correspond to a homolog of q? To understand the statistical significance we need to answer two questions: 1. What is the probability that a score of at least S is produced by chance? 2. How many chance associations can one expect when one searches for homologs in a database? the following slides were adapted from INFO-F-434
9 Statistical significance 2 Statistical significance 3 Using BLOSUM62 S= (sa,b) u u The probability distribution of the scores is an extreme value distribution (EVD) R L A S V E T D M P L T L R Q H.. : :. :..... T L T S L Q T T L K A H L G T H =21 What is the statistical significance of this score? When one looks for homologs in a database, one is only interested at those sequences at the top In every alignment we always take the one that is the best The distribution is not Gaussian Its an EVD W.P. Pearson (2000) ISMB tutorial: Protein sequence comparison and protein evolution Statistical significance 4 Where does this EVD come from? Statistical significance 5 Where does this EVD come from? Repeat the following step a 1000 times (3 examples to the right): Sampe 1000 values (z) from a normal distribution In every run, we collect the mean and the maximum The final distribution of mean values is again a norma distribution BUT the distribution of the maximum values is an EVD one run corresponds here to one alignment between two sequences Distribution de la moyenne (Normal) Distribution du maximum (EVD)
10 Statistical significance 6 Statistical significance 7 Where does this EVD come from? Distribution de la moyenne (Normal) Distribution du maximum (EVD) The distribution shows the probability that we find a certain score by chance f(k,λ) Question 1: What is the probability of finding the score by chance? answer : P-val = 2 -S The theoretical distributions The DVE represents the distribution of scores that one can expect when one performs an alignment between two unrelated sequences alignment score Question 2: How many random matches will I find when searching the database? answer : E-val = N/2 -S
Pairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationBLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationRapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST
Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some
More informationSimilarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
More informationAlgorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationProtein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
More informationDatabase searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999
Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate
More informationSGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationOrdered Index Seed Algorithm for Intensive DNA Sequence Comparison
Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Dominique Lavenier IRISA / CNRS Campus de Beaulieu 35042 Rennes, France lavenier@irisa.fr Abstract This paper presents a seed-based algorithm
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationLecture 4: Exact string searching algorithms. Exact string search algorithms. Definitions. Exact string searching or matching
COSC 348: Computing for Bioinformatics Definitions A pattern (keyword) is an ordered sequence of symbols. Lecture 4: Exact string searching algorithms Lubica Benuskova http://www.cs.otago.ac.nz/cosc348/
More informationProtein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationAmino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
More informationOptimal neighborhood indexing for protein similarity search
Optimal neighborhood indexing for protein similarity search Pierre Peterlongo, Laurent Noé, Dominique Lavenier, Van Hoa Nguyen, Gregory Kucherov, Mathieu Giraud To cite this version: Pierre Peterlongo,
More informationWeb Data Extraction: 1 o Semestre 2007/2008
Web Data : Given Slides baseados nos slides oficiais do livro Web Data Mining c Bing Liu, Springer, December, 2006. Departamento de Engenharia Informática Instituto Superior Técnico 1 o Semestre 2007/2008
More informationDesign Style of BLAST and FASTA and Their Importance in Human Genome.
Design Style of BLAST and FASTA and Their Importance in Human Genome. Saba Khalid 1 and Najam-ul-haq 2 SZABIST Karachi, Pakistan Abstract: This subjected study will discuss the concept of BLAST and FASTA.BLAST
More informationGenome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
More informationCSC4510 AUTOMATA 2.1 Finite Automata: Examples and D efinitions Definitions
CSC45 AUTOMATA 2. Finite Automata: Examples and Definitions Finite Automata: Examples and Definitions A finite automaton is a simple type of computer. Itsoutputislimitedto yes to or no. It has very primitive
More informationSequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More informationConsensus alignment server for reliable comparative modeling with distant templates
W50 W54 Nucleic Acids Research, 2004, Vol. 32, Web Server issue DOI: 10.1093/nar/gkh456 Consensus alignment server for reliable comparative modeling with distant templates Jahnavi C. Prasad 1, Sandor Vajda
More informationNetwork Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
More information7 Gaussian Elimination and LU Factorization
7 Gaussian Elimination and LU Factorization In this final section on matrix factorization methods for solving Ax = b we want to take a closer look at Gaussian elimination (probably the best known method
More informationHidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
More informationTHREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering
More informationRegular Languages and Finite State Machines
Regular Languages and Finite State Machines Plan for the Day: Mathematical preliminaries - some review One application formal definition of finite automata Examples 1 Sets A set is an unordered collection
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationIntroduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationMultiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
More informationFART Neural Network based Probabilistic Motif Discovery in Unaligned Biological Sequences
FART Neural Network based Probabilistic Motif Discovery in Unaligned Biological Sequences M. Hemalatha, P. Ranjit Jeba Thangaiah and K. Vivekanandan, Member IEEE Abstract Finding Motif in bio-sequences
More informationUCHIME in practice Single-region sequencing Reference database mode
UCHIME in practice Single-region sequencing UCHIME is designed for experiments that perform community sequencing of a single region such as the 16S rrna gene or fungal ITS region. While UCHIME may prove
More informationA java applet visualizing the Aho-Corasick can be found at: http://www-sr.informatik.uni-tuebingen.de/ buehler/ac/ac1.html
5 BLAST Dan Gusfield: Algorithms on Strings, Trees, and Sequences. Computer Science and Computational Biology. Cambridge University Press, Cambridge, 1997, pages 379ff. ISBN 0-521-58519-8 An earlier version
More informationClone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
More informationPHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationAnalyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
More informationBIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
More informationEfficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationHow To Compare A Markov Algorithm To A Turing Machine
Markov Algorithm CHEN Yuanmi December 18, 2007 1 Abstract Markov Algorithm can be understood as a priority string rewriting system. In this short paper we give the definition of Markov algorithm and also
More informationBUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
More informationDNA Printer - A Brief Course in sequence Analysis
Last modified August 19, 2015 Brian Golding, Dick Morton and Wilfried Haerty Department of Biology McMaster University Hamilton, Ontario L8S 4K1 ii These notes are in Adobe Acrobat format (they are available
More informationCore Bioinformatics. Degree Type Year Semester
Core Bioinformatics 2015/2016 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat Teachers Use of
More informationStatistical Machine Translation: IBM Models 1 and 2
Statistical Machine Translation: IBM Models 1 and 2 Michael Collins 1 Introduction The next few lectures of the course will be focused on machine translation, and in particular on statistical machine translation
More informationA First Investigation of Sturmian Trees
A First Investigation of Sturmian Trees Jean Berstel 2, Luc Boasson 1 Olivier Carton 1, Isabelle Fagnot 2 1 LIAFA, CNRS Université Paris 7 2 IGM, CNRS Université de Marne-la-Vallée Atelier de Combinatoire,
More informationGAST, A GENOMIC ALIGNMENT SEARCH TOOL
Kalle Karhu, Juho Mäkinen, Jussi Rautio, Jorma Tarhio Department of Computer Science and Engineering, Aalto University, Espoo, Finland {kalle.karhu, jorma.tarhio}@aalto.fi Hugh Salamon AbaSci, LLC, San
More informationApproximate String Matching in DNA Sequences
Approximate String Matching in DNA Sequences Lok-Lam Cheng David W. Cheung Siu-Ming Yiu Department of Computer Science and Infomation Systems, The University of Hong Kong, Pokflum Road, Hong Kong {llcheng,dcheung,smyiu}@csis.hku.hk
More informationDynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction
Lecture 11 Dynamic Programming 11.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
More informationMATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
More informationGenetic programming with regular expressions
Genetic programming with regular expressions Børge Svingen Chief Technology Officer, Open AdExchange bsvingen@openadex.com 2009-03-23 Pattern discovery Pattern discovery: Recognizing patterns that characterize
More informationDNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
More informationComputational searches of biological sequences
UNAM, México, Enero 78 Computational searches of biological sequences Special thanks to all the scientis that made public available their presentations throughout the web from where many slides were taken
More informationProtein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
More informationClustering. 15-381 Artificial Intelligence Henry Lin. Organizing data into clusters such that there is
Clustering 15-381 Artificial Intelligence Henry Lin Modified from excellent slides of Eamonn Keogh, Ziv Bar-Joseph, and Andrew Moore What is Clustering? Organizing data into clusters such that there is
More informationAC 2007-305: INTEGRATION OF BIOINFORMATICS IN SCIENCE CURRICULUM AT FORT VALLEY STATE UNIVERSITY
AC 2007-305: INTEGRATION OF BIOINFORMATICS IN SCIENCE CURRICULUM AT FORT VALLEY STATE UNIVERSITY Ramana Gosukonda, Fort Valley State University Assistant Professor computer science Masoud Naghedolfeizi,
More informationData Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
More informationPushdown Automata. place the input head on the leftmost input symbol. while symbol read = b and pile contains discs advance head remove disc from pile
Pushdown Automata In the last section we found that restricting the computational power of computing devices produced solvable decision problems for the class of sets accepted by finite automata. But along
More informationPrimes in Sequences. Lee 1. By: Jae Young Lee. Project for MA 341 (Number Theory) Boston University Summer Term I 2009 Instructor: Kalin Kostadinov
Lee 1 Primes in Sequences By: Jae Young Lee Project for MA 341 (Number Theory) Boston University Summer Term I 2009 Instructor: Kalin Kostadinov Lee 2 Jae Young Lee MA341 Number Theory PRIMES IN SEQUENCES
More informationCOMPUTATIONAL FRAMEWORKS FOR UNDERSTANDING THE FUNCTION AND EVOLUTION OF DEVELOPMENTAL ENHANCERS IN DROSOPHILA
COMPUTATIONAL FRAMEWORKS FOR UNDERSTANDING THE FUNCTION AND EVOLUTION OF DEVELOPMENTAL ENHANCERS IN DROSOPHILA Saurabh Sinha, Dept of Computer Science, University of Illinois Cis-regulatory modules (enhancers)
More informationWebserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de
Webserver: bioinfo.bio.wzw.tum.de Mail: w.mewes@weihenstephan.de About me H. Werner Mewes, Lehrstuhl f. Bioinformatik, WZW C.V.: Studium der Chemie in Marburg Uni Heidelberg (Med. Fakultät, Bioenergetik)
More informationCore Bioinformatics. Titulació Tipus Curs Semestre. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Codi: 42397 Crèdits: 12 Titulació Tipus Curs Semestre 4313473 Bioinformàtica/Bioinformatics OB 0 1 Professor de contacte Nom: Sònia Casillas Viladerrams Correu electrònic:
More informationInformatique Fondamentale IMA S8
Informatique Fondamentale IMA S8 Cours 1 - Intro + schedule + finite state machines Laure Gonnord http://laure.gonnord.org/pro/teaching/ Laure.Gonnord@polytech-lille.fr Université Lille 1 - Polytech Lille
More informationFinite Automata. Reading: Chapter 2
Finite Automata Reading: Chapter 2 1 Finite Automata Informally, a state machine that comprehensively captures all possible states and transitions that a machine can take while responding to a stream (or
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationOD-seq: outlier detection in multiple sequence alignments
Jehl et al. BMC Bioinformatics (2015) 16:269 DOI 10.1186/s12859-015-0702-1 RESEARCH ARTICLE Open Access OD-seq: outlier detection in multiple sequence alignments Peter Jehl, Fabian Sievers * and Desmond
More informationClustering Near-Identical Sequences for Fast Homology Search
Clustering Near-Identical Sequences for Fast Homology Search Michael Cameron 1, Yaniv Bernstein 1, and Hugh E. Williams 2 1 School of Computer Science and Information Technology RMIT University, GPO Box
More informationFinite Automata. Reading: Chapter 2
Finite Automata Reading: Chapter 2 1 Finite Automaton (FA) Informally, a state diagram that comprehensively captures all possible states and transitions that a machine can take while responding to a stream
More information6.045: Automata, Computability, and Complexity Or, Great Ideas in Theoretical Computer Science Spring, 2010. Class 4 Nancy Lynch
6.045: Automata, Computability, and Complexity Or, Great Ideas in Theoretical Computer Science Spring, 2010 Class 4 Nancy Lynch Today Two more models of computation: Nondeterministic Finite Automata (NFAs)
More informationActivity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of
More informationConvergence of Translation Memory and Statistical Machine Translation
Convergence of Translation Memory and Statistical Machine Translation Philipp Koehn and Jean Senellart 4 November 2010 Progress in Translation Automation 1 Translation Memory (TM) translators store past
More informationFormal Languages and Automata Theory - Regular Expressions and Finite Automata -
Formal Languages and Automata Theory - Regular Expressions and Finite Automata - Samarjit Chakraborty Computer Engineering and Networks Laboratory Swiss Federal Institute of Technology (ETH) Zürich March
More informationComputing the maximum similarity bi-clusters of gene expression data
BIOINFORMATICS ORIGINAL PAPER Vol. 23 no. 1 2007, pages 50 56 doi:10.1093/bioinformatics/btl560 Gene expression Computing the maximum similarity bi-clusters of gene expression data Xiaowen Liu and Lusheng
More informationClusterControl: A Web Interface for Distributing and Monitoring Bioinformatics Applications on a Linux Cluster
Bioinformatics Advance Access published January 29, 2004 ClusterControl: A Web Interface for Distributing and Monitoring Bioinformatics Applications on a Linux Cluster Gernot Stocker, Dietmar Rieder, and
More informationChapter 13: Query Processing. Basic Steps in Query Processing
Chapter 13: Query Processing! Overview! Measures of Query Cost! Selection Operation! Sorting! Join Operation! Other Operations! Evaluation of Expressions 13.1 Basic Steps in Query Processing 1. Parsing
More information2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
More informationClustering. Danilo Croce Web Mining & Retrieval a.a. 2015/201 16/03/2016
Clustering Danilo Croce Web Mining & Retrieval a.a. 2015/201 16/03/2016 1 Supervised learning vs. unsupervised learning Supervised learning: discover patterns in the data that relate data attributes with
More informationRegular Expressions and Automata using Haskell
Regular Expressions and Automata using Haskell Simon Thompson Computing Laboratory University of Kent at Canterbury January 2000 Contents 1 Introduction 2 2 Regular Expressions 2 3 Matching regular expressions
More informationCommunity Detection Proseminar - Elementary Data Mining Techniques by Simon Grätzer
Community Detection Proseminar - Elementary Data Mining Techniques by Simon Grätzer 1 Content What is Community Detection? Motivation Defining a community Methods to find communities Overlapping communities
More informationFile Management. Chapter 12
Chapter 12 File Management File is the basic element of most of the applications, since the input to an application, as well as its output, is usually a file. They also typically outlive the execution
More informationIncreasing Interaction and Support in the Formal Languages and Automata Theory Course
Increasing Interaction and Support in the Formal Languages and Automata Theory Course [Extended Abstract] Susan H. Rodger rodger@cs.duke.edu Jinghui Lim Stephen Reading ABSTRACT The introduction of educational
More information3515ICT Theory of Computation Turing Machines
Griffith University 3515ICT Theory of Computation Turing Machines (Based loosely on slides by Harald Søndergaard of The University of Melbourne) 9-0 Overview Turing machines: a general model of computation
More informationSequence Analysis on a 216-Processor Beowulf Cluster
USEIX Association Proceedings of the 4th Annual Linux Showcase & Conference, Atlanta Atlanta, Georgia, USA October 10 14, 2000 THE ADVACED COMPUTIG SYSTEMS ASSOCIATIO 2000 by The USEIX Association All
More informationOn line construction of suffix trees 1
(To appear in ALGORITHMICA) On line construction of suffix trees 1 Esko Ukkonen Department of Computer Science, University of Helsinki, P. O. Box 26 (Teollisuuskatu 23), FIN 00014 University of Helsinki,
More informationDatabases. DSIC. Academic Year 2010-2011
Databases DSIC. Academic Year 2010-2011 1 Lecturer José Hernández-Orallo Office 236, 2nd floor DSIC. Email: jorallo@dsic.upv.es http://www.dsic.upv.es/~jorallo/docent/bda/bdaeng.html Attention hours On
More informationUF EDGE brings the classroom to you with online, worldwide course delivery!
What is the University of Florida EDGE Program? EDGE enables engineering professional, military members, and students worldwide to participate in courses, certificates, and degree programs from the UF
More informationHow To Cluster
Data Clustering Dec 2nd, 2013 Kyrylo Bessonov Talk outline Introduction to clustering Types of clustering Supervised Unsupervised Similarity measures Main clustering algorithms k-means Hierarchical Main
More informationProtecting Websites from Dissociative Identity SQL Injection Attacka Patch for Human Folly
International Journal of Computer Sciences and Engineering Open Access ReviewPaper Volume-4, Special Issue-2, April 2016 E-ISSN: 2347-2693 Protecting Websites from Dissociative Identity SQL Injection Attacka
More informationUsing MATLAB: Bioinformatics Toolbox for Life Sciences
Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY
More informationDevelopment and Implementation of Novel Data Compression Technique for Accelerate DNA Sequence Alignment Based on Smith Waterman Algorithm
L JUNID SM et al: DEVELOPMEN ND IMPLEMENION OF NOVEL D OMSSION... Development and Implementation of Novel Data ompression echnique for ccelerate DN Sequence lignment Based on Smith Waterman lgorithm l
More information