FAQs of Differential Gene Expression using RNA-Seq A collection of questions about RNA-Seq

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "FAQs of Differential Gene Expression using RNA-Seq A collection of questions about RNA-Seq"

Transcription

1 FAQs of Differential Gene Expression using RNA-Seq A collection of questions about RNA-Seq July 18, 2013 Jyothi Thimmapuram Bioinformatics Core

2 Strategies for RNA-Seq Haas and Zody, Nature Biotechnology, 2010, 28:421

3 RNA-Seq - issues Coverage across transcriptome may not be random Some reads map to multiple locations Some reads do not map Some reads map outside exons new genes or new gene models?

4 What platform to use HiSeq/MiSeq How many lanes/flowcell How many reads/lane What is PE and SE sequencing What is the format of sequencing file

5 Illumina HiSeq 2500) 2 independent Flow Cells

6

7 Single Reads Barcode primer Adaptor A Adaptor B barcode s_1_sequence.txt SP2 SP1 Paired-end Reads Barcode primer Adaptor A Adaptor B barcode SP2 s_1_1_sequence.txt s_1_2_sequence.txt

8 HiSeq 2500 MiSeq No. of lanes 8 1 Length of Run 10 days 1 day Single Reads (per lane) million million Paired-end Reads million million Read length 50,100bp 2 x 250bp Bases > Q30 >85% (2x50bp) >85% (2x100bp) >80% (2x100bp) >80% (2x150bp) >70% (2x250bp) HiSeq 2500, Rapid Run Chemistry: 2 lanes, 120 million reads per lane, 50, 100,150bp, two days

9 Illumina files: one fastq file per sample Sequence ID Sequence Quality CTTGACAAAGGGTGCAAGGCAGTTAGTGGTGCAAGATGCATTGCTGATGATGGGTTCATCAGGGCTGTAATCATA + CGTGTCTTAAGGAGGCACCAAACAATATAAAGCTACAGATGGCGTCCTTGGTTTTTAATTTTAAGTTGGGGGACT + ggggggggggggegggdgggggegggffdgggggggggeggggggggggggegfggeegggfgcgggefgge^eg Seq 1 Seq 2

10 How many reads are needed (depth of sequencing) Number of reads/lane Number of samples/lane Read length

11 Number of reads/coverage Number of genes in the species Number of genes expressed under the treatment/tissue Rare transcripts

12 Number of reads/coverage Trapnell et al., Nature Biotechnology, 2010, 28:311

13 Sample Pairwise Comparisons Number of Differentially Expressed (DE) genes by each method edger voom Cufflinks Cond1_vs_Cond Cond1_vs_Cond Cond1_vs_Cond Cond2_vs_Cond Cond2_vs_Cond Cond3_vs_Cond Each of these samples had at least 50 million PE reads

14 Standards, Guidelines and Best Practices for RNA-Seq The ENCODE consortium The ability to detect reliably low copy number transcripts/isoforms depends upon the depth of sequencing and on a sufficiently complex library. For experiments from a typical mammalian tissue or in which sensitivity of detection is important, a minimum depth of M 2 x 76 bp or longer reads is currently recommended. Evaluating the impact of sequencing depth on transcriptome profiling in human adipose Liu et. al., PLoS One 8:e66883

15 Experimental Design Number of biological replicates

16 We can sequence multiple samples on one lane by indexing (barcoding, tagging) the sample Multiplexed The index is usually 6-7 bp that is used to separate sequences for each sample SP1 Paired-end Reads Barcode primer Adaptor A Adaptor B barcode SP2

17 Auer P L, and Doerge R W Genetics 2010;185: Balanced Blocked Design

18 Quality Control How do you check the quality of reads How do you trim and filter low quality bases Do we need to trim and filter low quality bases

19 Sequence quality check FastQC FASTX-Toolkit Quality score > 30 Min. length 50% of the read

20 Bad run Good run x-axis: Position in read y-axis: Quality scores

21 FastQC Before trimming After trimming x-axis: Position in read y-axis: Quality scores

22 Mapping to reference genome or transcriptome No reference available Draft genome available Not well annotated reference

23 Align to genome Bioinformatics Core Mapping of RNA-Seq reads Can detect novel exons or un-annotated genes Aligners should be able to map reads across splice sites Reads from non-genic regions influence expression values, SNP detection etc. Align to transcriptome Information about splice junctions is not required PE distance and junction reads - isoforms

24 Strategies for RNA-Seq Haas and Zody, Nature Biotechnology, 2010, 28:421

25 To map RNA-Seq reads Number of mismatches allowed Number of hits allowed Exon-exon/exon-intron junctions Expected distance in PE reads

26 What alignment program to use Unique or multiple mapping Usually what %reads map to reference How to generate read counts

27

28 TopHat alignment

29 TopHat-Cufflinks-Cuffcompare-CuffDiff Uses Bowtie Splits the read into segments and map independently and glue them together to produce end-to-end read alignment Currently does not support short indels Can align up to 1024 bp Do not mix PE and single reads

30 TopHat contd. Junctions from GFF or other list file Without reference Neighboring coverage islands joined with an intron PE reads genomic coordinates and expected distance Two segments of the same read mapped apart reports alignments across GT-AG introns

31 Cufflinks, Cuffcompare and CuffDiff Cufflinks Assembles transcripts and estimates abundances Alignments in SAM format as input Cuffcompare/Cuffmerge Compares assembled sequences to a ref. annotation Compares Cufflinks transcripts across experiments Input - GTF file from Cufflinks CuffDiff GTF file & SAM files Finds significant changes in transcript expression, splicing and promoter use Output files Genes.fpkm_tracking Gnes_exp.diff

32 Some popular aligners BWA slow for long reads and reads with higher error rate; suboptimal alignment pairs; allows gapped alignment TopHat uses Bowtie; maps reads to genome, builds a database of possible splice junctions, and maps the reads against these junctions to confirm Novoalign most accurate, slow Others: SpliceMap, MapSplice, SOAP, MAQ, CLC Bio

33 Overlap multireads can cause inaccurate expression estimates Van Verk et al., Trends Plant Sci. 18:

34 Counting reads with HTSeq

35 What are the different methods for DGE analysis What is RPKM/FPKM Why do we use more than one method How to validate and verify the RNA-Seq results How to select genes for qrt-pcr

36 Length of genes Sequencing depth Differential Gene Expression RPKM Reads Per Kilobase of exon model per Million mapped reads Mortazavi et al., Nature Methods,2008, 5:621 FPKM Fragment Per Kilobase of exon model per Million mapped reads Normalization gene counts should be adjusted to minimize the bias Statistical model should account for length and depth

37 Differential expression methods Fisher s exact test or similar tests for RPKM/FPKM R-packages for RNA-Seq analysis: DESeq small # or no replicates; negative binomial (NB) dist edger NB dist; Similar to Fisher s exact test using NB (instead of hypergeometric probablities) bayseq more complex; empirical Bayesian methods DEGseq based on MA-plots

38 DESeq-edgeR-Cufflinks DESeq 10,939 edger 11,770 Cufflinks 6,263 DESeq+edgeR 10,219 DESeq+Cufflinks 6,070 edger+cufflinks 6,077 DESeq+edgeR+Cufflinks 6,045 DESeq and edger novo align mapping

39 DESeq-edgeR-baySeq DESeq 888 edger 895 bayseq 1,115 DESeq + edger 591 DESeq + bayseq 488 edger + bayseq 465 DESeq + edger + bayseq Soneson and Delorenzi, BMC Bioinfomatics. 14:91 Rapaport et. al.,

40 Yendrek et al., BMC Research Notes. 5:506 Comparing RNA-Seq with qrt-pcr

41 Sequencing platform to use FAQs of RNA-Seq Illumina HiSeq, 8lanes/flowcell, fastq files Sequencing depth number of reads At least mil/sample Paired-end or single reads PE Length of reads At least 50bp, usually 100bp Number of biological replicates At least 3 (more if you can afford) Experimental design for sequencing Balanced Block Design How to analyze RNA-Seq data

42 FAQs of RNA-Seq cont. How to analyze RNA-Seq data How to check quality and trim/filter low quality FASTQC and FASTXtoolkit Reference genome or transcriptome Depends on the purpose of the expt Build a reference transcriptome if not available (Trinity, Trans-ABySS, Velvet/Oases) What alignment program to use TopHat, Bowtie2, BWA Unique or multiple mapping Unique A good %mapping : 70-90%

43 FAQs of RNA-Seq cont. How to analyze RNA-Seq data How to get read counts HTSeq with option union What statistical methods to use limma package (edger, voom, rpkm), DESeq Why do we use more than one method Different normalization methods and assumptions Validation and verification How to select genes : FDR, FC, pathway

44 Applications using RNA-Seq data Differential gene expression Structural annotation of a genome Alternative splicing Fusion transcripts de novo transcriptome assembly SNPs/Indels Phylogenomics

45 Resources for RNA-Seq analysis RNA-Seq Blog Transcriptome Analysis: Sequencing and Profiling

46 Additional references for RNA-Seq analysis: Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Trapnell et. al., Nature Protocols. 7: Evaluating the impact of sequencing depth on transcriptome profiling in human adipose Liu et. al., PLoS One 8:e Counting reads in features with htseq-count

47 References for statistical analysis of DGE: Design and validation issues in RNA-seq experiments Fang and Cui, Brief Bioinform. 12: A comprehensive evaluation of normalization methods for Illumina highthroughput RNA sequencing data analysis Dillies, et. al., Brief Bioinform. doi: /bib/bbs046 A comparison of statistical methods for detecting differentially expressed genes from RNA-Seq data Kvam et. al., Am. J. Botany. 99: Comprehensive evaluation of differential expression analysis methods for RNA- Seq data Rapaport et. al., A comparison of methods for differential expression analysis of RNA-seq data Soneson and Delorenzi, BMC Bioinfomatics. 14:91.

48 BIOINFORMATICS CORE IS SUPPORTED BY: Financial: OVPR College of Agriculture Ag. Research Programs College of Technology College of Veterinary Medicine Cancer Center Cyber Center - Discovery Park (College of Science) Technical: Rosen Center for Advanced Computing (RCAC) ITaP AgIT

49 Genomics Facility Information: Phillip San Miguel, Ph.D. Genomics Facility Director (765)

50 THANK YOU!

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012 RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

Expression Quantification (I)

Expression Quantification (I) Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

Deep Sequencing Data Analysis

Deep Sequencing Data Analysis Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist

More information

Gene Expression Analysis

Gene Expression Analysis Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview

More information

From Reads to Differentially Expressed Genes. The statistics of differential gene expression analysis using RNA-seq data

From Reads to Differentially Expressed Genes. The statistics of differential gene expression analysis using RNA-seq data From Reads to Differentially Expressed Genes The statistics of differential gene expression analysis using RNA-seq data experimental design data collection modeling statistical testing biological heterogeneity

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

NGS Data Analysis: An Intro to RNA-Seq

NGS Data Analysis: An Intro to RNA-Seq NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental

More information

A survey of best practices for RNA-seq data analysis

A survey of best practices for RNA-seq data analysis Conesa et al. Genome Biology (2016) 17:13 DOI 10.1186/s13059-016-0881-8 REVIEW A survey of best practices for RNA-seq data analysis Open Access Ana Conesa 1,2*, Pedro Madrigal 3,4*, Sonia Tarazona 2,5,

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

High Throughput Sequencing Data Analysis using Cloud Computing

High Throughput Sequencing Data Analysis using Cloud Computing High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom (stephane.le_crom@upmc.fr) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.

CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. : An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results

More information

Isoform prefiltering improves performance of count-based methods for analysis of differential transcript usage

Isoform prefiltering improves performance of count-based methods for analysis of differential transcript usage Soneson et al. Genome Biology (206) 7:2 DOI 86/s3059-05-0862-3 RESEARCH Isoform prefiltering improves performance of count-based methods for analysis of differential transcript usage Charlotte Soneson,2,

More information

RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance

RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance RNA Express Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance ILLUMINA PROPRIETARY 15052918 Rev. A February 2014 This document and its contents are

More information

RNA-seq. Quantification and Differential Expression. Genomics: Lecture #12

RNA-seq. Quantification and Differential Expression. Genomics: Lecture #12 (2) Quantification and Differential Expression Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #12 Today (2) Gene Expression per Sources of bias,

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

mrna NGS Data Analysis Report

mrna NGS Data Analysis Report mrna NGS Data Analysis Report Project: Test Project (Ref code: 00001) Customer: Test customer Company/Institute: Exiqon Date: Monday, June 29, 2015 Performed by: XploreRNA Exiqon A/S Company Reg. No. (CVR)

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es)

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es) WEB-SERVER MANUAL Contact: Michael Hackenberg (hackenberg@ugr.es) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation

More information

Lukas Windhager LFE Bioinformatik, Institut für Informatik Ludwig-Maximilians-Universität München Coverage variability in NGS Data

Lukas Windhager LFE Bioinformatik, Institut für Informatik Ludwig-Maximilians-Universität München Coverage variability in NGS Data Lukas Windhager LFE Bioinformatik, Institut für Informatik Ludwig-Maximilians-Universität München Coverage variability in NGS Data 06.04.2011 Short talk Reproducible pattern SOLiD reads mapped to rrna

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Sequencing power for every scale. Systems for every application, for every lab.

Sequencing power for every scale. Systems for every application, for every lab. Sequencing power for every scale. Systems for every application, for every lab. Proven sequencing technology. Accelerate your research. Achieve your next breakthrough. What started as novel Illumina chemistry,

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina im411@cam.ac.uk Head of Computational Biology Lab HPC Service, University of Cambridge, UK EMBL-EBI Scientific collaborator Genome Campus, Hinxton, Cambridge,

More information

Methods, tools, and pipelines for analysis of Ion PGM Sequencer mirna and gene expression data

Methods, tools, and pipelines for analysis of Ion PGM Sequencer mirna and gene expression data WHITE PAPER Ion RNA-Seq Methods, tools, and pipelines for analysis of Ion PGM Sequencer mirna and gene expression data Introduction High-resolution measurements of transcriptional activity and organization

More information

NSilico Life Science Introductory Bioinformatics Course

NSilico Life Science Introductory Bioinformatics Course NSilico Life Science Introductory Bioinformatics Course INTRODUCTORY BIOINFORMATICS COURSE A public course delivered over three days on the fundamentals of bioinformatics and illustrated with lectures,

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Human Tissue RNA-Seq Data from the Illumina HiSeq 2000 System

Human Tissue RNA-Seq Data from the Illumina HiSeq 2000 System Human Tissue RNA-Seq Data from the Illumina HiSeq 2000 System Gary Schroth & the Gene Expression Applications Group Research & Development 2009 Illumina, Inc. All rights reserved. Illumina, illuminadx,

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

RNA- seq de novo ABiMS

RNA- seq de novo ABiMS RNA- seq de novo ABiMS Cleaning 1. import des données d'entrée depuis Data Libraries : Shared Data Data Libraries RNA- seq de- novo 2. lancement des programmes de nettoyage pas à pas BlueLight.sample.read1.fastq

More information

Efficient tool deployment to the Galaxy Cloud: An RNA-seq workflow case study

Efficient tool deployment to the Galaxy Cloud: An RNA-seq workflow case study Efficient tool deployment to the Galaxy Cloud: An RNA-seq workflow case study Sebastian J. Schultheiss Machine Learning in Biology, Rätsch Lab, FML of the Max Planck Society Tübingen,

More information

Text file One header line meta information lines One line : variant/position

Text file One header line meta information lines One line : variant/position Software Calling: GATK SAMTOOLS mpileup Varscan SOAP VCF format Text file One header line meta information lines One line : variant/position ##fileformat=vcfv4.1! ##filedate=20090805! ##source=myimputationprogramv3.1!

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Cavan Reilly December 5, 2012 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform BWT example Introduction

More information

TGC AT YOUR SERVICE. Taking your research to the next generation

TGC AT YOUR SERVICE. Taking your research to the next generation TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina

More information

Physical map of the wheat chromosome arm 3DS Jan Bartoš

Physical map of the wheat chromosome arm 3DS Jan Bartoš Physical map of the wheat chromosome arm 3DS Jan Bartoš Centre of Region Haná for Biotechnological and Agricultural Research Institute of Experimental Botany Šlechtitelů 31 783 71 Olomouc - Holice Wheat

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,

More information

Bioinformatics Unit Department of Biological Services. Get to know us

Bioinformatics Unit Department of Biological Services. Get to know us Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert May 3, 2016 Abstract FlipFlop implements a fast method for de novo transcript

More information

Visualization with the Integrative Genomics Viewer (IGV)

Visualization with the Integrative Genomics Viewer (IGV) Ecole de Bioinformatique Aviesan - Integrative Genomics Viewer (IGV) 1 Visualization with the Integrative Genomics Viewer (IGV) Elodie Girard Institut Curie U900 Inserm Mines ParisTech Ecole de Bioinformatique

More information

Genome-scale technologies 2/ Algorithmic and statistical aspects of DNA sequencing What to sequence next? Exciting achievements of the -seq.

Genome-scale technologies 2/ Algorithmic and statistical aspects of DNA sequencing What to sequence next? Exciting achievements of the -seq. Genome-scale technologies 2/ Algorithmic and statistical aspects of DNA sequencing What to sequence next? Exciting achievements of the -seq. Ewa Szczurek University of Warsaw, MIMUW szczurek@mimuw.edu.pl

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

-> Integration of MAPHiTS in Galaxy

-> Integration of MAPHiTS in Galaxy Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration

More information

Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models

Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Megan Bowman Childs Lab Bioinformatics Seminar 22 April 2015 Outline GC content in plant genomes Codon usage

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,

More information

Normalization of RNA-Seq

Normalization of RNA-Seq Normalization of RNA-Seq Davide Risso Modified: April 27, 2012. Compiled: April 27, 2012 1 Retrieving the data Usually, an RNA-Seq data analysis from scratch starts with a set of FASTQ files (see e.g.

More information

CUDA-Enabled Applications for Nextgeneration. Bertil Schmidt

CUDA-Enabled Applications for Nextgeneration. Bertil Schmidt CUDA-Enabled Applications for Nextgeneration Sequencing Bertil Schmidt Next-Generation Sequencing (NGS) DNA Read-sequences May contain errors! DNA-sequence 1x drop from -1 Illumina HiSeq Read length (typical)

More information

CIDANE: comprehensive isoform discovery and abundance estimation

CIDANE: comprehensive isoform discovery and abundance estimation Canzar et al. Genome Biology (2016) 17:16 DOI 10.1186/s13059-015-0865-0 METHOD Open Access CIDANE: comprehensive isoform discovery and abundance estimation Stefan Canzar 1,4 *, Sandro Andreotti 2, David

More information

RNA-Seq Alignment v1.0 BaseSpace App Guide

RNA-Seq Alignment v1.0 BaseSpace App Guide RNA-Seq Alignment v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow 5 Workflow Diagram 6 Set Analysis Parameters 7 Analysis Methods 11 Analysis

More information

Practical Differential Gene Expression. Introduction

Practical Differential Gene Expression. Introduction Practical Differential Gene Expression Introduction In this tutorial you will learn how to use R packages for analysis of differential expression. The dataset we use are the gene-summarized count data

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Cahier de réalisation

Cahier de réalisation Référence : cahier_realisation_mini_projet-sepia-theba-1.0 Page : 1/8 Cahier de réalisation SEPIA THEBA REDACTION Nom, prénom Gildas Le Corguillé Erwan Corre Unité ABiMS ABiMS Version Date Nature des modifications

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) stephane.le_crom@upmc.fr Paris November 2013 The Sanger DNA sequencing method Sequencing

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs

Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Fishing for variants in the deep end of the gene pool: OGT s custom bait designs Jolyon Holdstock, Simon Hughes and Daniel Swan Abstract Oxford Gene Technology (OGT) has extensive expertise in probe design

More information

Understanding West Nile Virus Infection

Understanding West Nile Virus Infection Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information

Copy Number Variation: available tools

Copy Number Variation: available tools Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available

More information

Research Article Stormbow: A Cloud-Based Tool for Reads Mapping and Expression Quantification in Large-Scale RNA-Seq Studies

Research Article Stormbow: A Cloud-Based Tool for Reads Mapping and Expression Quantification in Large-Scale RNA-Seq Studies ISRN Bioinformatics Volume 2013, Article ID 481545, 8 pages http://dx.doi.org/10.1155/2013/481545 Research Article Stormbow: A Cloud-Based Tool for Reads Mapping and Expression Quantification in Large-Scale

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Disease gene identification with exome sequencing

Disease gene identification with exome sequencing Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre c.gilissen@antrg.umcn.nl Contents Infrastructure Exome sequencing

More information

edger: differential expression analysis of digital gene expression data User s Guide Yunshun Chen, Davis McCarthy, Mark Robinson, Gordon K.

edger: differential expression analysis of digital gene expression data User s Guide Yunshun Chen, Davis McCarthy, Mark Robinson, Gordon K. edger: differential expression analysis of digital gene expression data User s Guide Yunshun Chen, Davis McCarthy, Mark Robinson, Gordon K. Smyth First edition 17 September 2008 Last revised 8 October

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information