New Genetic Testing in Pregnancy

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "New Genetic Testing in Pregnancy"

Transcription

1 Oklahoma Academy of Family Physicians New Genetic Testing in Pregnancy J. Stephen Jones. MD Maternal Fetal Medicine Saint Francis Tulsa Oklahoma 16 June,

2 Prenatal Testing for Fetal Aneuploidy Noninvasive Prenatal Testing for Fetal Aneuploidy (NIPT) Cell Free Fetal DNA Testing (CffDNA) 2

3 Prenatal Testing for Fetal Aneuploidy Significant patient population 5 M pregnancies every year in the U.S. Majority of women undergo prenatal testing today (>70%) 1,2 ACOG guidelines for universal prenatal testing published in Current options have limitations Blood tests and ultrasound lack specificity 4 Invasive testing poses risk of fetal loss 5 1. American Pregnancy Association, ; 2. Frost and Sullivan, Strategic Analysis of the U.S. Prenatal Testing Market, N940-55, 2011.; 3. ACOG Practice Bulletin, Screening for fetal chromosomal abnormalities. Obstet Gynecol. 2007;109: ; 4. Ibid, ACOG Practice Bulletin 2007.; 5. ACOG Practice Bulletin, Invasive prenatal testing for aneuploidy. Obstet Gynecol. 2007; 110:

4 The Case for Widespread Prenatal Testing Majority of babies born with Down syndrome are in women under 35 years old 2007 Universal Screening Guidelines Source: Provider handbook for The California Prenatal Screening Program 4

5 Conventional Prenatal Testing Options Screening Assesses risk for trisomy 21 and trisomy 18/13 1 st trimester serum markers and/or nuchal translucency 2 nd trimester serum markers Risk score for T21, T18 Detection: 70-92% 1 False positive 5% 2 ~3M screenings tests/yr 3 Diagnosis Can detect wide array of genetic conditions Invasive procedures 1 st trimester chorionic villus sampling 2 nd trimester amniocentesis Gold standard for trisomy diagnosis Risk of fetal loss 1 in 400 to 1 in ~200,000 procedures/yr 1. ACOG Practice Bulletin, Screening for fetal chromosomal abnormalities. Obstet Gynecol. 2007;109: ;2. Ibid, ACOG Practice Bulletin 2007.; 3. Frost and Sullivan, Strategic Analysis of the U.S. Prenatal Testing Market, N940-55, ; 4. ACOG Practice Bulletin, Invasive prenatal testing for aneuploidy. Obstet Gynecol. 2007; 110:

6 Potential Limitations of Current Testing High false positives Screening tests may have up to a 5% false positive rate 1 potentially creating anxiety for many women every year. Convenience Current screening tests may require multiple visits and specialized ultrasound, and may limit access. Timeline Current screening tests that provide highest detection are not complete until the second trimester, extending the timeline for results. Safety concerns Many women decline invasive procedures (CVS, amnio) because of risk concerns. 1 Strategic Analysis of the U.S. Prenatal Testing Market: Increasing Maternal Age, Improved Screening Algorithms, and Maturation of Noninvasive Prenatal Diagnostics, May 2011, page 42 6

7 Prevalence of Trisomies 21, 18, 13 Trisomy Type Condition Name Frequency Chromosome 21 Down syndrome 1 in 750 live births Chromosome 18 Edwards syndrome 1 in 3,000-6,000 live births Chromosome 13 Patau syndrome 1 in 16,000 live births U.S. National Library of Medicine. Genetics Home Reference. Down Syndrome. Trisomy Trisomy Accessed July 12,

8 Cell-free DNA in Maternal Blood Cell-free DNA (cfdna) are short DNA fragments In pregnancy, cfdna from both the mom and fetus are in maternal blood Amount of fetal cfdna present is a small fraction of the maternal cfdna 8

9 Principles of Fetal Trisomy Testing From a Maternal Blood Sample Using DNA Sequencing ~10% of the DNA fragments in a pregnant woman s blood are from the fetus ( ) ~90% are from the mother ( ) Schematic of DNA Fragments Isolated From Maternal Plasma Containing Maternal DNA and Euploid Fetal DNA Schematic of DNA Fragments Isolated From Maternal Plasma Containing Maternal DNA, Fetal DNA and Extra Fragments of Chromosome 21, 18 or 13 Contributed by a Fetal Trisomy 21, 18 or 13 Euploid Fetus Fetus with Trisomy 21, 18 or 13

10 Fetal Trisomy Detection With cfdna Fetal cfdna Extra fragments derived from fetal trisomy 21 Maternal cfdna Reference chromosome Chromosome 21 fragments Each bar represents thousands of cfdna fragments The overabundance of chromosome 21 cfdna fragments in trisomy 21, although small, can be measured with DNA sequencing 10

11 Principles of Fetal Trisomy 21 Testing From a Maternal Blood Sample Using DNA Sequencing The total number of ccf-fetal fragments vs. ccf-maternal fragments of any one chromosome is proportional to the size of the chromosome, and is consistent from sample to sample, and patient to patient. Sequencing tells you which chromosome the combined maternal and fetal fragments come from. Chromosome 1 Chromosome 21

12 Principles of Fetal Trisomy Testing From a Maternal Blood Sample Using DNA Sequencing Sequencing tells you which chromosome the ccf fragment comes from. TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr21 chr10 chr14 chr10 chr21 chr10 chr10 chr10 chr21 chr14 chr10 chr21 chr10 chr10 chr14 chr X Y

13 Cell Free Fetal DNA Performance Detection Rate False Positive Rate T21 (99-100%) 0-2% T18 (84-100%) 0-2% T13 (44-100%) 0-6% 40% 60% 80% 100% Trisomy 21 accuracy appears to be more robust than that for trisomy 18 and trisomy Palomaki GE, Kloza EM, Lambert-Messerlian GM, et al. DNA sequencing of maternal plasma to detect Down syndrome: an international clinical validation study. Genet Med 2011 Nov;13(11): ; 2. Bianchi DW, Platt LD, Goldberg JD, Abuhamad AZ, Sehnert AJ, Rava RP, Genome-Wide Fetal Aneuploidy Detection by Maternal Plasma DNA Sequencing. Obstet Gynecol. [Epub ahead of print] 2012 Feb 22.; 3. Chiu et. Al BMJ 2011;342:c7401 Chen et.al (2011) 13

14 Clinical Study & Publication Overview Study Status Description NICE (Non-Invasive Chromosomal Evaluation) Average Risk (Nicolaides) Ariosa Blinded Nicolaides Blinded Proof of Concept Trisomy 13 Fetal Fraction NICE substudy Fetal Fraction Published Editor s choice in The Gray Journal (August 2012) Published The Gray Journal (2012, avail online) Published Editor s choice in The Gray Journal (April 2012) Published Editor s choice in The Gray Journal (April 2012) Published cover article Prenatal Diagnosis (Jan 2012) Published The White Journal (2012, avail online) Published J Mat Fet Med (2012, avail online) Published Fetal Diagnosis and Therapy (2012) 14 Multi-center (50 sites) clinical validation study, combined high risk and low risk women. Largest NIPT cohort study. Exclusive average-risk study of Harmony test in 1 st trimester pregnancy Blinded study with risk score reporting 1 st trimester blinded study Initial description of directed cfdna approach with combined average-risk and high-risk women Performance for T13 detection with combined average-risk and high-risk women Fetal fraction same in high-risk and low-risk women Fetal fraction correlated to placental mass 14

15 NICE Study Non-Invasive Chromosomal Evaluation (NICE) Study: Results of a Multicenter, Prospective, Cohort Study for Detection of Fetal Trisomy 21 and Trisomy 18 Norton, M., Brar, H., Weiss, J., Karimi, A., Laurent, L.C., Caughey, A., Rodriguez, M.H., Williams III, J., Mitchell, M.E., Adair, C.D, Lee, H., Jacobbson, B., Tomlinson, M.W., Oepkes, D., Hollemon, D., Sparks, A.B., Oliphant, A., Song, K. Published August 2012 in American Journal of Obstetrics and Gynecology Laboratory validation study 15

16 NICE Study Design International multicenter prospective study across 50 clinical sites Cohort study all eligible subjects were analzyed Study Population Singleton pregnancy Gestational age 10 weeks or later Invasive testing for any indication Sensitivity and specificity of Harmony test reported at 1% risk score cut-off 16 Norton, M., Brar, H., Weiss, J., Karimi, A., et al. Non-Invasive Chromosomal Evaluation (NICE) Study: Results of a Multicenter, Prospective, Cohort Study for Detection of Fetal Trisomy 21 and Trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog

17 NICE Study 50 participating clinical sites in U.S. and Europe Largest cohort study to date All eligible subjects evaluated Study population was women undergoing invasive testing for any indication and thus included low risk women Sensitivity Specificity False Positive Rate Trisomy % (81/81) 99.97% (2887/2888) 0.03% (1/2888) Trisomy 18 97% (37/38) 99.93% (2886/2888) 0.07% (2/2888) Norton ME et al. (2012) American Journal of Obstetrics and Gynecology 17

18 Clinical Performance Studied in over 6,000 patients, including >2,000 low-risk women Detection Rate False Positive Rate T21 >99% (214 of 214) <0.1% T18 >98% (103 of 105) <0.1% T13 8 of 10 detected with Harmony <0.1% 1. Sparks, A.B., Struble, C.A., Wang, E.T., Song, K., Oliphant, A., Non-invasive Prenatal Detection and Selective Analysis of Cell-free DNA Obtained from Maternal Blood: Evaluation for Trisomy 21 and Trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog ; 2. Ashoor, G., Syngelaki, A., Wagner, M., Birdir, C., Nicolaides, K.H., Chromosome-selective sequencing of maternal plasma cell-free DNA for first trimester detection of trisomy 21 and trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog ; 3. Sparks, A.B., Wang, E.T., Struble, C.A., Barrett, W., et al, Selective analysis of cell-free DNA 18 in maternal blood for evaluation of fetal trisomy. Prenat Diagn (2012);32(1):3-9. doi: /pd Epub 2012 Jan 6.; 4. Norton, M., Brar, H., Weiss, J., Karimi, A., et al. Non-Invasive Chromosomal Evaluation (NICE) Study: Results of a Multicenter, Prospective, Cohort Study for Detection of Fetal Trisomy 21 and Trisomy 18, Am J Obstet Gynecol. (2012), doi: /j.ajog ; 5. Nicolaides KH, Syngelaki A, Ashoor G, et al. Noninvasive prenatal testing for fetal trisomies in a routinely screened first-trimester population. Am J Obstet Gynecol (2012);207:x.ex-x.ex.; 6. Ashoor G, Syngelaki A, Nicolaides KH, et al. Trisomy 13 detection in the first trimester of pregnancy using a chromosome-selective cell-free DNA analysis method, ULTRASOUND Obstet Gynecol. (2012), DOI: /uog

19 Screening Options for T21, T18 and T13 AFP4 (Quad) Sensitivity for T21 is 81% False Positive is 5% Sensitivity for T18 is 80% False Positive is 5% Does not calculate a T13 Performed between weeks List price is $304 First Trimester with Nasal Bone ** NTD Laboratories Sensitivity for T21 is 95% False Positive is 2% Sensitivity for T18 is 95% False Positive is 0.3% Sensitivity for T13 is 95% False Positive is 0.3% **ACOG Practice Bulletin 77 Sensitivity for T % False Positive is 5% Harmony Sensitivity for T21 is greater than 99% False positive is 0.1% Sensitivity for T18 is greater than 98% False positive is 0.1% Sensitivity for T13 is 80% False Positive is 0.1% Performed 10 weeks throughout pregnancy List Price is $795 MaterniT21 Plus Sensitivity for T21 is 99.1% False Positive is 0.1% Sensitivity for T18 is greater than 99.9% False Positive is 0.4% Sensitivity for T13 is 91.7% False Positive is 0.3% Y Chromosome accuracy is 99.4% Performed 10 weeks throughout pregnancy List Price is $1500 Performed between weeks List Price is $160

20 Importance of Low False Positive Rate The less common a genetic condition, the more important it is to have a low false positive rate Example: Delivery service with 5,000 births/yr # of true trisomies # of false positives (at below false positive rates) 1% 0.5% 0.1% T21 (1 in 740) T18 (1 in 5,000) T13 (1 in 16,000)

21 Educational Tool for Patients English and Spanish language versions available Education about trisomy detection, the test and suggested follow-up if a result comes back low risk or high risk 21 21

22 Who do we Screen? Any woman who desires information regarding her baby Discuss screening options for all pregnancies -- 50% of all Trisomy 21 fetuses have no abnormal U/S findings -- 50% of all Trisomy 21 fetuses have a congenital heart defect Genetic Screening should be offered in a PRO pregnancy format 22

Clinical Studies Abstract Booklet

Clinical Studies Abstract Booklet Clinical Studies Abstract Booklet The Harmony Prenatal Test is a non-invasive prenatal test (NIPT) that assesses the risk of trisomies by analyzing cell-free DNA (cfdna) in maternal blood. Since January

More information

Incorporating DNA sequencing into current prenatal screening practice for Down s syndrome

Incorporating DNA sequencing into current prenatal screening practice for Down s syndrome 1 Incorporating DNA sequencing into current prenatal screening practice for Down s syndrome Nicholas J Wald FRS* Wolfson Institute of Preventive Medicine Barts and the London School of Medicine and Dentistry

More information

Non-Invasive Prenatal Testing (NIPT) Factsheet

Non-Invasive Prenatal Testing (NIPT) Factsheet Introduction NIPT, which analyzes cell-free fetal DNA circulating in maternal blood, is a new option in the prenatal screening and testing paradigm for trisomy 21 and a few other fetal chromosomal aneuploidies.

More information

Sequencing-based Tests to Determine Trisomy 21 from Maternal Plasma DNA

Sequencing-based Tests to Determine Trisomy 21 from Maternal Plasma DNA Sequencing-based Tests to Determine Trisomy 21 from Maternal Plasma DNA Policy Number: Original Effective Date: MM.03.006 09/01/2013 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST 09/01/2013

More information

Panorama Non-Invasive Prenatal Screening for Microdeletion Syndromes

Panorama Non-Invasive Prenatal Screening for Microdeletion Syndromes 1 Panorama Non-Invasive Prenatal Screening for Microdeletion Syndromes MEGAN P. HALL, PH.D. INTRODUCTION Panorama TM is a non-invasive prenatal screening test for fetal chromosomal anomalies. The screening

More information

your questions answered the reassurance of knowing A guide for parents-to-be on noninvasive prenatal testing.

your questions answered the reassurance of knowing A guide for parents-to-be on noninvasive prenatal testing. your questions answered the reassurance of knowing A guide for parents-to-be on noninvasive prenatal testing. Accurate answers about your baby s health simply, safely, sooner. What is the verifi Prenatal

More information

Current Status in Non-Invasive Prenatal Detection of Down Syndrome, Trisomy 18, and Trisomy 13 Using Cell-Free DNA in Maternal Plasma

Current Status in Non-Invasive Prenatal Detection of Down Syndrome, Trisomy 18, and Trisomy 13 Using Cell-Free DNA in Maternal Plasma No. 287, February 2013 Current Status in Non-Invasive Prenatal Detection of Down Syndrome, Trisomy 18, and Trisomy 13 Using Cell-Free DNA in Maternal Plasma This committee opinion has been prepared by

More information

a new era in prenatal testing

a new era in prenatal testing TM a new era in prenatal testing TM What is? Non-Invasive Prenatal Testing (NIPT) represents a major advance in screening and risk assessment for chromosomal abnormalities. In January 2016, the UK National

More information

Objectives. Disclosures 4/22/2012. Next-Gen DNA Sequencing in Prenatal Screening for Down Syndrome: How is it best used? Barbara M.

Objectives. Disclosures 4/22/2012. Next-Gen DNA Sequencing in Prenatal Screening for Down Syndrome: How is it best used? Barbara M. Next-Gen DNA Sequencing in Prenatal Screening for Down Syndrome: How is it best used? Barbara M. O Brien, MD Women & Infants Hospital Alpert Medical School of Brown University Providence, RI Women & Infants

More information

Trisomy 13 detection in the first trimester of pregnancy using a chromosome-selective cell-free DNA analysis method

Trisomy 13 detection in the first trimester of pregnancy using a chromosome-selective cell-free DNA analysis method Trisomy 13 detection in the first trimester of pregnancy using a chromosome-selective cell-free DNA analysis method Ghalia ASHOOR 1, Argyro SYNGELAKI 1, Eric WANG 2, Craig STRUBLE 2, Arnold OLIPHANT 2,

More information

A test your patients can trust.

A test your patients can trust. A test your patients can trust. A simple, safe, and accurate non-invasive prenatal test for early risk assessment of Down syndrome and other conditions. informaseq Prenatal Test Simple, safe, and accurate

More information

cfdna in maternal plasma obtained from a population undergoing routine screening at 11-13 weeks gestation.

cfdna in maternal plasma obtained from a population undergoing routine screening at 11-13 weeks gestation. Reports of Major Impact www.ajog.org Noninvasive prenatal testing for fetal trisomies in a routinely screened first-trimester population Kypros H. Nicolaides, MD; Argyro Syngelaki, RM; Ghalia Ashoor, MD;

More information

COMMITTEE OPINION. Cell-free DNA Screening for Fetal Aneuploidy

COMMITTEE OPINION. Cell-free DNA Screening for Fetal Aneuploidy The American College of Obstetricians and Gynecologists WOMEN S HEALTH CARE PHYSICIANS (Published Electronically Ahead of Print on June 26, 2015) COMMITTEE OPINION Number 640 September 2015 (This Committee

More information

Implementation of maternal blood cell-free DNA testing in early screening for aneuploidies

Implementation of maternal blood cell-free DNA testing in early screening for aneuploidies Ultrasound Obstet Gynecol 2013; 42: 34 40 Published online 7 June 2013 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/uog.12504 Implementation of maternal blood cell-free DNA testing in

More information

Information for Your Patients

Information for Your Patients Information for Your Patients What is first trimester risk assessment for Down syndrome? First trimester screening for Down syndrome, also known as nuchal translucency screening, is a test offered to women

More information

First Trimester Screening for Down Syndrome

First Trimester Screening for Down Syndrome First Trimester Screening for Down Syndrome What is first trimester risk assessment for Down syndrome? First trimester screening for Down syndrome, also known as nuchal translucency screening, is a test

More information

Noninvasive Prenatal Testing for Fetal Aneuploidies Using Cell- Free Fetal DNA

Noninvasive Prenatal Testing for Fetal Aneuploidies Using Cell- Free Fetal DNA Noninvasive Prenatal Testing for Fetal Aneuploidies Using Cell- Free Fetal DNA Policy Number: Original Effective Date: MM.03.006 09/01/2013 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST

More information

What is. PrenatalSAFE Karyo test is the most technologically advanced genome-wide NIPT

What is. PrenatalSAFE Karyo test is the most technologically advanced genome-wide NIPT What is PrenatalSAFE Karyo test is the most technologically advanced genome-wide NIPT Through cfdna analysis from maternal plasma, PrenatalSAFE Karyo detects: Aneuploidies structural chromosomal aberrations

More information

The first 3,000 Non-Invasive Prenatal Tests (NIPT) with the Harmony test in Belgium and the Netherlands

The first 3,000 Non-Invasive Prenatal Tests (NIPT) with the Harmony test in Belgium and the Netherlands FVV in ObGyn, 2014, 6 (1): 7-12 Preliminary report The first 3,000 Non-Invasive Prenatal Tests (NIPT) with the Harmony test in Belgium and the Netherlands P.J. Willems 1, H. Dierickx 1, ES. Vandenakker

More information

Genetic Screening and Pregnancy: Selecting the Best Test for Your Patient

Genetic Screening and Pregnancy: Selecting the Best Test for Your Patient Genetic Screening and Pregnancy: Selecting the Best Test for Your Patient Britton Rink, MD, MS The Ohio State University Division of Maternal Fetal Medicine ACOG Practice Bulletin January 2007 Screening

More information

Noninvasive Prenatal Screening for Fetal Aneuploidies and Microdeletions Using Cell-Free Fetal DNA

Noninvasive Prenatal Screening for Fetal Aneuploidies and Microdeletions Using Cell-Free Fetal DNA MEDICAL POLICY POLICY RELATED POLICIES POLICY GUIDELINES DESCRIPTION SCOPE BENEFIT APPLICATION RATIONALE REFERENCES CODING APPENDIX HISTORY Noninvasive Prenatal Screening for Fetal Aneuploidies and Microdeletions

More information

Position Statement from the Aneuploidy Screening Committee on Behalf of the Board of the International Society for Prenatal Diagnosis, April 2013

Position Statement from the Aneuploidy Screening Committee on Behalf of the Board of the International Society for Prenatal Diagnosis, April 2013 Position Statement from the Aneuploidy Screening Committee on Behalf of the Board of the International Society for Prenatal Diagnosis, April 2013 Peter Benn (Chair), Antoni Borell, Rossa Chiu, Howard Cuckle,

More information

journal of medicine The new england DNA Sequencing versus Standard Prenatal Aneuploidy Screening ABSTRACT

journal of medicine The new england DNA Sequencing versus Standard Prenatal Aneuploidy Screening ABSTRACT The new england journal of medicine established in 1812 february 27, 2014 vol. 370 no. 9 DNA Sequencing versus Standard Prenatal Aneuploidy Screening Diana W. Bianchi, M.D., R. Lamar Parker, M.D., Jeffrey

More information

Complimentary and personal copy for

Complimentary and personal copy for Complimentary and personal copy for www.thieme.com Publishing House and Copyright: 2015 by Georg Thieme Verlag KG Rüdigerstraße 14 70469 Stuttgart ISSN Any further use only by permission of the Publishing

More information

A test your patients can trust. A company you know and trust.

A test your patients can trust. A company you know and trust. A test your patients can trust. A company you know and trust. informaseq Prenatal Test an advanced, non-invasive, prenatal screening for T21, T18, and T13 chromosomal aneuploidies using next generation

More information

Noninvasive prenatal screen for pregnancy

Noninvasive prenatal screen for pregnancy Noninvasive prenatal screen for pregnancy What is QNatal TM Advanced Noninvasive Prenatal Screening? The QNatal Advanced prenatal screen is a noninvasive test that provides a high degree of accuracy for

More information

Patient Education. intermountainhealthcare.org. A Guide to Prenatal Testing LIVING AND LEARNING TOGETHER

Patient Education. intermountainhealthcare.org. A Guide to Prenatal Testing LIVING AND LEARNING TOGETHER Patient Education intermountainhealthcare.org A Guide to Prenatal Testing LIVING AND LEARNING TOGETHER Most news is good news. Most babies are born without major birth defects. Early in your pregnancy,

More information

MASSIVELY PARALLEL SEQUENCING OF MATE RNAL PLASMA DNA IN 113 CASES OF FETAL NUCHAL CYSTIC HYGROMA

MASSIVELY PARALLEL SEQUENCING OF MATE RNAL PLASMA DNA IN 113 CASES OF FETAL NUCHAL CYSTIC HYGROMA Scuola di specializzazione in Genetica Medica Journal Club 14 gennaio 2014 MASSIVELY PARALLEL SEQUENCING OF MATE RNAL PLASMA DNA IN 113 CASES OF FETAL NUCHAL CYSTIC HYGROMA Bianchi, Diana W. MD; Prosen,

More information

Non-invasive prenatal detection of chromosome aneuploidies using next generation sequencing: First steps towards clinical application

Non-invasive prenatal detection of chromosome aneuploidies using next generation sequencing: First steps towards clinical application Non-invasive prenatal detection of chromosome aneuploidies using next generation sequencing: First steps towards clinical application PD Dr. rer. nat. Markus Stumm Zentrum für Pränataldiagnostik Kudamm-199

More information

fi АУ : fi apple Ав Ав АУ . apple, АУ fiав Ав. АК applefi АУ, АУАв Ав fi АУ apple fi Ав. А applefi АУ АУ АУ АсА» Ас Ам, длappleapple Ас...

fi АУ : fi apple Ав Ав АУ . apple, АУ fiав Ав. АК applefi АУ, АУАв Ав fi АУ apple fi Ав. А applefi АУ АУ АУ АсА» Ас Ам, длappleapple Ас... АВАВАКдлАмА дла длама АсАядлАмА АВА АсдлАя & MАядлдлАмАК TА. 4, T. 2, АВ. 113-118, 2005 fi АУ : Аяapplefi. fiapple АсА» Ас Ам, длappleapple Ас..., Ая: Аяapplefi. fiapple, АВАУ Ас, АсА» Ас Ам длappleapple

More information

Research. Currently, the most effective and

Research. Currently, the most effective and Research GENETICS Non-Invasive Chromosomal Evaluation (NICE) Study: results of a multicenter prospective cohort study for detection of fetal trisomy 21 and trisomy 18 Mary E. Norton, MD; Herb Brar, MD;

More information

Non-invasive prenatal testing. Contents:

Non-invasive prenatal testing. Contents: february 2014 A REGULAR CASE-BASED SERIES ON PRACTICAL PATHOLOGY FOR GPs Contents: What is non-invasive prenatal testing? Screening test vs diagnostic tests Case studies Who should be offered NIPT? Non-invasive

More information

Clinical and Cost Consequences of Incorporating a Novel Non-Invasive Prenatal Test into the Diagnostic Pathway for Fetal Trisomies

Clinical and Cost Consequences of Incorporating a Novel Non-Invasive Prenatal Test into the Diagnostic Pathway for Fetal Trisomies Clinical and Cost Consequences of Incorporating a Novel Non-Invasive Prenatal Test into the Diagnostic Pathway for Fetal Trisomies Susan S. Garfield, DrPH; Shannon O. Armstrong, BA Summary Background:

More information

Cell-Free DNA Analysis for Trisomy Risk Assessment in First-Trimester Twin Pregnancies

Cell-Free DNA Analysis for Trisomy Risk Assessment in First-Trimester Twin Pregnancies Original Paper Received: September 12, 2013 Accepted after revision: October 21, 2013 Published online: November 15, 2013 Cell-Free DNA Analysis for Trisomy Risk Assessment in First-Trimester Twin Pregnancies

More information

Executive summary. Current prenatal screening

Executive summary. Current prenatal screening Executive summary Health Council of the Netherlands. NIPT: dynamics and ethics of prenatal screening. The Hague: Health Council of the Netherlands, 2013; publication no. 2013/34. In recent years, new tests

More information

The California Prenatal Screening Program

The California Prenatal Screening Program The California Prenatal Screening Program Quad Marker Screening One blood specimen drawn at 15 weeks - 20 weeks of pregnancy (second trimester) Serum Integrated Screening Prenatal Patient Booklet - English

More information

Prenatal Testing Special tests for your baby during pregnancy

Prenatal Testing Special tests for your baby during pregnancy English April 2006 [OTH-7750] There are a number of different prenatal (before birth) tests to check the development of your baby. Each test has advantages and disadvantages. This information is for people

More information

New Prenatal Tests for Down Syndrome: Brian G. Skotko, MD, MPP Co-Director, Down Syndrome Program Massachusetts General Hospital

New Prenatal Tests for Down Syndrome: Brian G. Skotko, MD, MPP Co-Director, Down Syndrome Program Massachusetts General Hospital New Prenatal Tests for Down Syndrome: International Updates and What This All Means for Your Family Brian G. Skotko, MD, MPP Co-Director, Down Syndrome Program Massachusetts General Hospital Band of Angels

More information

Obstetrical Ultrasound and Prenatal Diagnostic Center

Obstetrical Ultrasound and Prenatal Diagnostic Center Obstetrical Ultrasound and Prenatal Diagnostic Center Prenatal Diagnosis: Options and Opportunities Learn about various screening options including Early Risk Assessment (ERA), now available to women of

More information

Fetal Fraction Estimate in Twin Pregnancies Using Directed Cell-Free DNA Analysis

Fetal Fraction Estimate in Twin Pregnancies Using Directed Cell-Free DNA Analysis Original Paper Received: August 22, 2013 Accepted after revision: September 17, 2013 Published online: December 7, 2013 Pregnancies Using Directed Cell-Free DNA Analysis Craig A. Struble a Argyro Syngelaki

More information

Prenatal screening and diagnostic tests

Prenatal screening and diagnostic tests Prenatal screening and diagnostic tests Contents Introduction 3 First trimester routine tests in the mother 3 Testing for health conditions in the baby 4 Why would you have a prenatal test? 6 What are

More information

In most developed countries, prenatal screening

In most developed countries, prenatal screening Genome-Wide Fetal Aneuploidy Detection by Maternal Plasma DNA Sequencing Diana W. Bianchi, MD, Lawrence D. Platt, MD, James D. Goldberg, MD, Alfred Z. Abuhamad, MD, Amy J. Sehnert, MD, and Richard P. Rava,

More information

Maternal serum free b-hcg and PAPP-A in fetal sex chromosome defects in the rst trimester

Maternal serum free b-hcg and PAPP-A in fetal sex chromosome defects in the rst trimester PRENATAL DIAGNOSIS Prenat Diagn 2000; 20: 390±394. Maternal serum free b-hcg and PAPP-A in fetal sex chromosome defects in the rst trimester Kevin Spencer 1 *, Natasha Tul 2 and Kypros H. Nicolaides 2

More information

The California Prenatal Screening Program

The California Prenatal Screening Program The California Prenatal Screening Program Provider ook netic Disease Screening Program Quad Marker Screening Serum Integrated Screening Full Integrated Screening TABLE OF CONTENTS WELCOME to the California

More information

National Down Syndrome Society

National Down Syndrome Society National Down Syndrome Society The national advocate for the value, acceptance and inclusion of people with Down syndrome What is Down Syndrome? Down syndrome is the most commonly occurring chromosomal

More information

Noninvasive prenatal screening for fetal aneuploidy, 2016 update: a position statement of the American College of Medical Genetics and Genomics

Noninvasive prenatal screening for fetal aneuploidy, 2016 update: a position statement of the American College of Medical Genetics and Genomics American College of Medical Genetics and Genomics ACMG Statement Noninvasive prenatal screening for fetal aneuploidy, 2016 update: a position statement of the American College of Medical Genetics and Genomics

More information

Sonographic screening for trisomy 13 at 11 to 13 D6 weeks of gestation

Sonographic screening for trisomy 13 at 11 to 13 D6 weeks of gestation American Journal of Obstetrics and Gynecology (2006) 194, 397 401 www.ajog.org Sonographic screening for trisomy 13 at 11 to 13 D6 weeks of gestation Aris T. Papageorghiou, MD, a Kyriaki Avgidou, MD, a

More information

FIGO Good Practice Advice

FIGO Good Practice Advice FIGO Good Practice Advice 1. Screening for chromosomal abnormalities and non invasive prenatal diagnosis and testing Universal screening is a strategy applied to all individuals of a certain category to

More information

LEUKODYSTROPHY GENETICS AND REPRODUCTIVE OPTIONS FOR AFFECTED FAMILIES. Leila Jamal, ScM Kennedy Krieger Institute, Baltimore MD

LEUKODYSTROPHY GENETICS AND REPRODUCTIVE OPTIONS FOR AFFECTED FAMILIES. Leila Jamal, ScM Kennedy Krieger Institute, Baltimore MD LEUKODYSTROPHY GENETICS AND REPRODUCTIVE OPTIONS FOR AFFECTED FAMILIES Leila Jamal, ScM Kennedy Krieger Institute, Baltimore MD 2 Outline Genetics 101: Basic Concepts and Myth Busting Inheritance Patterns

More information

Screening for trisomy 21 by fetal tricuspid regurgitation, nuchal translucency and maternal serum free β-hcg and PAPP-A at 11 + 0to13+ 6 weeks

Screening for trisomy 21 by fetal tricuspid regurgitation, nuchal translucency and maternal serum free β-hcg and PAPP-A at 11 + 0to13+ 6 weeks Ultrasound Obstet Gynecol 2006; 27: 151 155 Published online 30 December 2005 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/uog.2699 Screening for trisomy 21 by fetal tricuspid regurgitation,

More information

Genetics and Pregnancy Loss

Genetics and Pregnancy Loss Genetics and Pregnancy Loss Dorothy Warburton Genetics and Development (in Pediatrics) Columbia University, New York Estimates of Pregnancy Loss from Conception 1000 fertilized eggs (27% are lost) 728

More information

Consent to Perform Preimplantation Genetic Screening (PGS) using. Comparative Genomic Hybridization (acgh) or Next Generation Sequencing (NGS)

Consent to Perform Preimplantation Genetic Screening (PGS) using. Comparative Genomic Hybridization (acgh) or Next Generation Sequencing (NGS) Consent to Perform Preimplantation Genetic Screening (PGS) using Array Comparative Genomic Hybridization (acgh ) or Next Generation Sequencing (NGS) Purpose The purpose of Preimplantation Genetic Screening

More information

A Guide to Prenatal Genetic Testing

A Guide to Prenatal Genetic Testing Patient Education Page 29 A Guide to Prenatal Genetic Testing This section describes prenatal tests that give information about your baby s health. It is your choice whether or not to have these tests

More information

Cell-free DNA Analysis for Noninvasive Examination of Trisomy

Cell-free DNA Analysis for Noninvasive Examination of Trisomy original article Cell-free DNA Analysis for Noninvasive Examination of Trisomy Mary E. Norton, M.D., Bo Jacobsson, M.D., Ph.D., Geeta K. Swamy, M.D., Louise C. Laurent, M.D., Ph.D., Angela C. Ranzini,

More information

Neural tube defects: open spina bifida (also called spina bifida cystica)

Neural tube defects: open spina bifida (also called spina bifida cystica) Screening Programmes Fetal Anomaly Neural tube defects: open spina bifida (also called spina bifida cystica) Information for health professionals Publication date: April 2012 Review date: April 2013 Version

More information

Non-invasive Prenatal Testing for Chromosomal Abnormality using Maternal Plasma DNA

Non-invasive Prenatal Testing for Chromosomal Abnormality using Maternal Plasma DNA Non-invasive Prenatal Testing for Chromosomal Abnormality using Maternal Plasma DNA Scientific Impact Paper No. 15 March 2014 Non-invasive Prenatal Testing for Chromosomal Abnormality using Maternal Plasma

More information

Prenatal screening and diagnosis of chromosomal and genetic abnormalities in the fetus in pregnancy

Prenatal screening and diagnosis of chromosomal and genetic abnormalities in the fetus in pregnancy The Royal Australian and New Zealand College of Obstetricians and Gynaecologists Prenatal screening and diagnosis of chromosomal and genetic abnormalities in the fetus in pregnancy This statement has been

More information

The National Down Syndrome Cytogenetic Register for England and Wales: 2008/9 Annual Report

The National Down Syndrome Cytogenetic Register for England and Wales: 2008/9 Annual Report 0 The National Down Syndrome Cytogenetic Register for England and Wales: 2008/9 Annual Report Joan K Morris, Elizabeth De Souza December 2009 National Down Syndrome Cytogenetic Register Queen Mary University

More information

RESEARCH PARTICIPANT INFORMATION SHEET. Safer pre-natal diagnosis using free DNA in maternal blood test. (also known as the IONA Study)

RESEARCH PARTICIPANT INFORMATION SHEET. Safer pre-natal diagnosis using free DNA in maternal blood test. (also known as the IONA Study) RESEARCH PARTICIPANT INFORMATION SHEET Safer pre-natal diagnosis using free DNA in maternal blood test (also known as the IONA Study) REC ref: 07/H0607/101 Principal Investigator: Mr Edward Johnstone Version

More information

Trisomy 13 (also called Patau s syndrome or T13)

Trisomy 13 (also called Patau s syndrome or T13) Screening Programmes Fetal Anomaly Trisomy 13 (also called Patau s syndrome or T13) Information for parents Publication date: April 2012 Review date: April 2013 Version 2 117 Information sheet to help

More information

Screening for chromosomal abnormalities at 10 14 weeks: the role of ductus venosus blood flow

Screening for chromosomal abnormalities at 10 14 weeks: the role of ductus venosus blood flow Ultrasound Obstet Gynecol 1998;12:380 384 Screening for chromosomal abnormalities at 10 14 weeks: the role of ductus venosus blood flow A. Matias*, C. Gomes*, N. Flack*, N. Montenegro and K. H. Nicolaides*

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

Patient & Family Guide Pre-Existing Diabetes and Pregnancy

Patient & Family Guide Pre-Existing Diabetes and Pregnancy Patient & Family Guide Pre-Existing Diabetes and Pregnancy Center for Perinatal Care Meriter Hospital 202 S. Park Street Madison, WI 53715 608.417.6667 meriter.com 09/12/1000 A Meriter Hospital and University

More information

Gutenberg Center in MALAGA

Gutenberg Center in MALAGA Introduction Gutenberg Center in MALAGA Gutenberg Center in Málaga opened in 1987 as a clinic to provide integral assisstance for women, divided into 6 Units, specialized in the different aspects of Obs

More information

Analytical goal setting in aneuploidy screening: within person biological variability of first trimester biochemical markers

Analytical goal setting in aneuploidy screening: within person biological variability of first trimester biochemical markers DOI: 10.1002/pd.4019 ORIGINAL ARTICLE Analytical goal setting in aneuploidy screening: within person biological variability of first trimester biochemical markers Kevin Spencer* and Nicholas J. Cowans

More information

Optimal Detection of Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood

Optimal Detection of Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood Clinical Chemistry 57:7 1042 1049 (2011) Molecular Diagnostics and Genetics Optimal Detection of Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal

More information

Selective analysis of cell-free DNA in maternal blood for evaluation of fetal trisomy

Selective analysis of cell-free DNA in maternal blood for evaluation of fetal trisomy DOI: 10.1002/pd.2922 ORIGINAL ARTICLE Selective analysis of cell-free DNA in maternal blood for evaluation of fetal trisomy Andrew B. Sparks 1, Eric T. Wang 1, Craig A. Struble 1, Wade Barrett 1, Renee

More information

Lecture 32: Numerical Chromosomal Abnormalities and Nondisjunction. Meiosis I Meiosis II Centromere-linked markers

Lecture 32: Numerical Chromosomal Abnormalities and Nondisjunction. Meiosis I Meiosis II Centromere-linked markers Lecture 32: Numerical Chromosomal Abnormalities and Nondisjunction Meiosis I Meiosis II Centromere-linked markers Female Male 46,XX 46,XY Human chromosomal abnormalities may be numerical or structural.

More information

Preimplantation Genetic Diagnosis (PGD) in Western Australia

Preimplantation Genetic Diagnosis (PGD) in Western Australia Preimplantation Genetic Diagnosis (PGD) in Western Australia Human somatic cells have 46 chromosomes each, made up of the 23 chromosomes provided by the egg and the sperm cell from each parent. Each chromosome

More information

The 11 13 +6 weeks scan

The 11 13 +6 weeks scan The 11 13 +6 weeks scan Kypros H. Nicolaides The 11 13 +6 weeks scan Fetal Medicine Foundation, London 2004 Dedication to Herodotos & Despina Contents Introduction 1. First trimester diagnosis of chromosomal

More information

Prenatal Care Screening and Testing Guideline

Prenatal Care Screening and Testing Guideline Prenatal Care Screening and Testing Guideline Major Changes as of October 2013 2 Visit Schedule 2 Initial Visit 3 Second Trimester Visits (14 28 Weeks) 11 Third Trimester Visits (28 41 Weeks) 12 Postpartum

More information

ORIGINAL ARTICLE. Supporting information may be found in the online version of this article.

ORIGINAL ARTICLE. Supporting information may be found in the online version of this article. DOI: 10.1002/pd.4002 ORIGINAL ARTICLE Clinical application of massively parallel sequencing-based prenatal noninvasive fetal trisomy test for trisomies 21 and 18 in 11 105 pregnancies with mixed risk factors

More information

Evaluation and Follow-up of Fetal Hydronephrosis

Evaluation and Follow-up of Fetal Hydronephrosis Evaluation and Follow-up of Fetal Hydronephrosis Deborah M. Feldman, MD, Marvalyn DeCambre, MD, Erin Kong, Adam Borgida, MD, Mujgan Jamil, MBBS, Patrick McKenna, MD, James F. X. Egan, MD Objective. To

More information

Nasal bone assessment in fetuses with trisomy 21 at 16 24 weeks of gestation by three-dimensional ultrasound

Nasal bone assessment in fetuses with trisomy 21 at 16 24 weeks of gestation by three-dimensional ultrasound DOI: 10.1002/pd.2938 ORIGINAL ARTICLE Nasal bone assessment in fetuses with trisomy 21 at 16 24 weeks of gestation by three-dimensional ultrasound Nicola Persico 1,2 *, Francisca Molina 3, Guillermo Azumendi

More information

Patient information on soft markers

Patient information on soft markers Patient information on soft markers Before you read this section remember the following important points. The vast majority of babies with soft markers are normal. Soft markers are frequently seen in healthy

More information

3D Ultrasound. Outline. What is 3D US? Volume Sonography. 3D Ultrasound in Obstetrics: Current Modalities & Future Potential. Alfred Abuhamad, M.D.

3D Ultrasound. Outline. What is 3D US? Volume Sonography. 3D Ultrasound in Obstetrics: Current Modalities & Future Potential. Alfred Abuhamad, M.D. in Obstetrics: Current Modalities & Future Potential Outline What is 3D US? What are obvious advantages of 3D US? What is the future of 3D US? Alfred Abuhamad, M.D. Eastern Virginia Medical School 2D US

More information

Each person normally has 23 pairs of chromosomes, or 46 in all. We inherit one chromosome per pair from our mother and one from our father.

Each person normally has 23 pairs of chromosomes, or 46 in all. We inherit one chromosome per pair from our mother and one from our father. AP Psychology 2.2 Behavioral Genetics Article Chromosomal Abnormalities About 1 in 150 babies is born with a chromosomal abnormality (1, 2). These are caused by errors in the number or structure of chromosomes.

More information

CONGENITAL HEART DISEASE

CONGENITAL HEART DISEASE CONGENITAL HEART DISEASE Introduction Congenital heart disease (CHD) is the most common congenital disorder in newborns [1]. Due to definitional issues, there are large variations in prevalence estimates.

More information

Genetics in Family Medicine: The Australian Handbook for General Practitioners Testing and pregnancy

Genetics in Family Medicine: The Australian Handbook for General Practitioners Testing and pregnancy Genetics in Family Medicine: The Australian Handbook for General Practitioners Testing and pregnancy Testing and pregnancy GP s role 3 Counselling before and during pregnancy 3 Collecting the family history

More information

Ultrasound evaluation of fetal gender at 12 14 weeks

Ultrasound evaluation of fetal gender at 12 14 weeks Ultrasound evaluation of fetal gender at 12 14 weeks Marek Lubusky a,b, Martina Studnickova a, Ales Skrivanek a, Katherine Vomackova c, Martin Prochazka a Aims. The aim of this study was to assess the

More information

Frontomaxillary and mandibulomaxillary facial angles at 11 + 0to13+ 6 weeks in fetuses with trisomy 18

Frontomaxillary and mandibulomaxillary facial angles at 11 + 0to13+ 6 weeks in fetuses with trisomy 18 Ultrasound Obstet Gynecol 2007; 30: 928 933 Published online 1 November 2007 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.2/uog.5188 Frontomaxillary and mandibulomaxillary facial angles

More information

Clinical Policy Title: Home uterine activity monitoring

Clinical Policy Title: Home uterine activity monitoring Clinical Policy Title: Home uterine activity monitoring Clinical Policy Number: 12.01.01 Effective Date: August 19, 2015 Initial Review Date: July 17, 2013 Most Recent Review Date: July 15, 2015 Next Review

More information

Dose dependency between cigarette consumption and reduced maternal serum PAPP-A levels at weeks of gestation

Dose dependency between cigarette consumption and reduced maternal serum PAPP-A levels at weeks of gestation PRENATAL DIAGNOSIS Prenat Diagn 2007; 27: 849 853. Published online 25 June 2007 in Wiley InterScience (www.interscience.wiley.com).1793 Dose dependency between cigarette consumption and reduced maternal

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: maternal_and_fetal_diagnostics 1/2000 3/2016 3/2017 3/2016 Description of Procedure or Service Fetal diagnostic

More information

The quadruple test screening for Down s syndrome and spina bifida

The quadruple test screening for Down s syndrome and spina bifida The quadruple test screening for Down s syndrome and spina bifida This leaflet provides information about a blood test to check for Down s syndrome and spina bifida. This test is available to you between

More information

NATIONAL DOWN SYNDROME SOCIETY

NATIONAL DOWN SYNDROME SOCIETY NATIONAL DOWN SYNDROME SOCIETY down syndrome Down syndrome affects people of all ages, races and economic levels. It is one of the most frequently occurring chromosomal abnormalities, occurring once in

More information

Effect of incorrect gestational dating on Down s syndrome and neural tube risk assessment

Effect of incorrect gestational dating on Down s syndrome and neural tube risk assessment Original Article Ann Clin Biochem 2001; 38: 230±234 Effect of incorrect gestational dating on Down s syndrome and neural tube risk assessment S N Millner From the Department of Pathology, University of

More information

Neural Tube Defects - NTDs

Neural Tube Defects - NTDs Neural Tube Defects - NTDs Introduction Neural tube defects are also known as NTDs. They happen when the spine and brain do not fully develop while the fetus is forming in the uterus. Worldwide, there

More information

AUSTRALIA AND NEW ZEALAND FACTSHEET

AUSTRALIA AND NEW ZEALAND FACTSHEET AUSTRALIA AND NEW ZEALAND FACTSHEET What is Stillbirth? In Australia and New Zealand, stillbirth is the death of a baby before or during birth, from the 20 th week of pregnancy onwards, or 400 grams birthweight.

More information

Prenatal Screening for Fetal Aneuploidy in Singleton Pregnancies

Prenatal Screening for Fetal Aneuploidy in Singleton Pregnancies No. 261 (Replaces No. 187, February 2007) Prenatal Screening for Fetal Aneuploidy in Singleton Pregnancies This clinical practice guideline has been prepared by the Genetics Committee of the Society of

More information

Who Is Involved in Your Care?

Who Is Involved in Your Care? Patient Education Page 3 Pregnancy and Giving Birth Who Is Involved in Your Care? Our goal is to surround you and your family with a safe environment for the birth of your baby. We look forward to providing

More information

Association of Glucose Levels in Pregnancy with Use of Health

Association of Glucose Levels in Pregnancy with Use of Health Funded by Centers for Disease Control and Prevention Contract No. 200-2009-31663 Kaiser Permanente Association of Glucose Levels in Pregnancy with Use of Health Care Services Mark C. Hornbrook PhD 2014

More information

Information on the anomaly scan

Information on the anomaly scan Information on the anomaly scan The 20-week ultrasound August 2014 2 Contents 1. What can I find in this brochure? 5 2. Screening for physical defects 7 3. Abnormal test results 8 4. Making a conscious

More information

Innovators in Reproductive Genetics

Innovators in Reproductive Genetics ANEUPLOIDY DIAGNOSTICS DIAGNOSTICS EXCELLENCE 6182 DIAGNOSTICS PERFORMED OVER 10 YEARS OF EXPERIENCE PGS-NGS 360 PGD DIAGNOSIS SINCE 2005 TRANSLOCATION DIAGNOSIS NEXT GENERATION SEQUENCING Innovators in

More information

Trisomies 13 and 18. -Maternal age. (Patau and Edward s syndrome)

Trisomies 13 and 18. -Maternal age. (Patau and Edward s syndrome) Trisomies 13 and 18 (Patau and Edward s syndrome) Trisomy 21 (Down syndrome) is the commonest chromosomal disorder at birth, and has been considered in detail in previous annual reports 23. Other relatively

More information

Prediction of Pregnancy Outcome Using HCG, CA125 and Progesterone in Cases of Habitual Abortions

Prediction of Pregnancy Outcome Using HCG, CA125 and Progesterone in Cases of Habitual Abortions Prediction of Pregnancy Outcome Using HCG, CA125 and Progesterone in * (MBChB, FICMS, CABOG) **Sawsan Talib Salman (MBChB, FICMS, CABOG) ***Huda Khaleel Ibrahim (MBChB) Abstract Background: - Although

More information

Billing Guidelines for Obstetrical Services and PCO Responsibilities

Billing Guidelines for Obstetrical Services and PCO Responsibilities Billing Guidelines for Obstetrical Services and PCO Responsibilities Providing obstetrical services to UnitedHealthcare Community Plan members and your patients is a collaborative effort. Complying with

More information

Parvovirus B19 Infection in Pregnancy

Parvovirus B19 Infection in Pregnancy Parvovirus B19 Infection in Pregnancy Information Pack Parvovirus B19 Infection in Pregnancy Information Booklet CONTENTS: THE VIRUS page 3 CLINICAL MANIFESTATIONS page 6 DIAGNOSIS page 8 PATIENT MANAGEMENT

More information

BACKGROUND PAPER. Non-Invasive Prenatal Testing (NIPT) Identifying key clinical, ethical, social, legal and policy issues

BACKGROUND PAPER. Non-Invasive Prenatal Testing (NIPT) Identifying key clinical, ethical, social, legal and policy issues BACKGROUND PAPER Non-Invasive Prenatal Testing (NIPT) Identifying key clinical, ethical, social, legal and policy issues Professor Vardit Ravitsky, University of Montreal, Canada 1 November 2015 Note The

More information

Mother s blood test to check her unborn baby s blood group

Mother s blood test to check her unborn baby s blood group Mother s blood test to check her unborn baby s blood group This leaflet explains why it is important to have a blood test to check the baby s blood group, so that only those who need it, receive anti-d

More information