Laboratory diagnostic of Avian Influenza in the Caribbean

Size: px
Start display at page:

Download "Laboratory diagnostic of Avian Influenza in the Caribbean"

Transcription

1 Laboratory diagnostic of Avian Influenza in the Caribbean

2 CIRAD, Guadeloupe CIRAD International Research Centre in Agricultural for Development Research, development, training Veterinary medicine and public health CIRAD Guadeloupe Research unit Control of exotic and emerging animal diseases 3 researchers, 5 lab technicians, 2 animal technicians, 1 secretary 1 webmaster + 4 students a year (Vet, Master, PhD) Laboratory = Platform for biotechnology 300 m 2 : cellular biology (L2 security), molecular biology (real time PCR, micro-array) serology, parasitology, immunology Animal house (100 goats, rabbits) + surgery Biological resources centre

3 Detection of the virus Molecular detection RT-PCR identification Type A : RT-PCR based on M gene Subtyping using H and N specific primers Rapid results : few hours Specificity & sensitivity : excellent Detection for a longer period than virus isolation Allow detection even if the virus is dead allows genetic characterization (sequencing) and subsequent classification in LP or HP

4 Detection of the virus Molecular detection Real Time RT-PCR detection All classical RT-PCR s advantages More sensitive than classical RT-PCR M and H5 gene : kits and protocols already exist PCR efficiency control : standards curves Extraction quality control : poultry GAPDH Rapid results

5 Detection of the virus Molecular detection Method of choice : rapid, sensitive, specific, high throughput detection possible. Easy to perform a PCR for ND in parallel Usable in an outbreak context Necessitate a skilled PCR laboratory : false positive if lab contamination No need for L3 laboratory (material inactivated for PCR) Allows epidemiological surveillance of the epizootics : tracing of epidemic strains, genetic evolution (ideally with virus isolation)

6 Avian Influenza molecular diagnostic implemented at CIRAD, Guadeloupe Veterinary services need rapid diagnostic to quickly implement actions (quarantine, slaughtering ) Choice of the diagnostic : Molecular diagnostic: can be used on inactivated samples (L3 lab not mandatory) and is rapid, sensitive and specific Implemented in collaborations with CIRAD Montpellier, Weybridge, Padova followed by inter-laboratory assays Laboratory facilities Bio safety procedures and quality assurance (ISO 17025) BSL2+, biosafety cabinet, autoclave, molecular biology separated areas Long experience of PCR and real time PCR 4 thermocyclers and 1 real time One technician dedicated to AI diagnostic (3 others able to perform the tests)

7 Avian Influenza molecular diagnostic implemented at CIRAD, Guadeloupe

8 New development of molecular diagnostic at CIRAD France + Guadeloupe Extraction critical: 4 extraction kits/techniques tested (Qiagen, Rneasy, Trizol, Macherey-Nagel) Real time PCR for gene M: Weybridge protocole Adiavet (internal avian gene control) Applied-biosystem (gene M + H5) H5-H7 real time PCR Weybridge, Padova and CIRAD interlaboratory assay Inter laboratory assay French reference laboratory for AI (AFSSA) Choice of primers and probes in the Caribbean According to circulating strains: PANAFTOSA-CIRAD-Ames

9 Séquence (5'-3') Publication RT-PCR Primers M1 PrimersM2 AGC GTA GAC GCT TTG TC GAC GAT CAA GAA TCC AC Starick Primers M+25 AGA TGA GTC TTC TAA CCG AGG TCG Q-RT-PCR Primer M-124 TGC AAA AAC ATC TTC AAG TCT CTG OIE (primers Spackman) M+64 FAM-BHQ1 TCA GGC CCC CTC AAA GCC GA RT-PCR H5-Kha-1 H5-Kha-3 CCT CCA GAR TAT GCM TAY AAA ATT GTC TAC CAA CCG TCT ACC ATK CCY TG OIE RT-PCR J3 B2a GAT AAA TTC TAG CAT GCC ATT CC TTT TGT CAA TGA TTG AGT TGA CCT TAT TGG OIE H5LH1 /H+1456 ACA TAT GAC TAC CCA CAR TAT TCA G* Q-RT-PCR H5RH1/H AGA CCA GCT AYC ATG ATT GC VLA Webridge /Spackman H5PRO FAM-TCW ACA GTG GCG AGT TCC CTA GCA QHQ1 RT-PCR Primer GK 7.3 Primer GK 7.4 ATG TCC GAG ATA TGT TAA GCA TTT GTA ATC TGC AGC AGT TC VLA Weybridge Primer LH6H7 GGC CAG TAT TAG AAA CAA CAC CTA TGA Q-RT-PCR Primer RH4H7 GCC CCG AAG CTA AAC CAA AGT AT VLA Weybridge Sonde : H7pro11 FAM-CCGCTGCTTAGTTTGACTGGGTCA ATCT-BHQ1 RT-PCR Primer F2-S Primer F2-AS AAC AGG ACA CTG ACC ACT TGG CAG CAT TCT GGT TGG CT H.M Pham Q-RT-PCR Primer F+4839 Primer F2-AS TCCGGAGGATACAAGGGTCT TGGCAGCATTCTGGTTGGCT Mark G.Wise and E.Spackman * Spackman: two different forward primers

10 Sub-regional Workshop for Preparedness and Prevention of AI and IP in the Caribbean, Barbados July, 2006 Different steps for the diagnostic First step: rapid antigenic test (symbiotics and directigen) -Not sensitive, flock tests, to be followed by molecular diagnostic or virus isolation even if the rapid is negative but the clinical signs suggest HPAI. -All countries wish to get some rapid antigen test kits (from USDA-APHIS?) Second step: molecular diagnostic - Sent to a satellite laboratory with AI molecular diagnostic capacities Third step: confirmation by reference laboratory by virus isolation - Weybridge -Ames - Afssa France for Guadeloupe Martinique and French Guyana

11 Avian Influenza diagnostic in the Caribbean: network of laboratories Labs already operating molecular diagnostic of AI in the Caribbean CIRAD Guadeloupe Labs with operating PCR facilities willing to develop AI molecular diagnostic Barbados, Trinidad, Jamaica, Dominica, Belize Labs willing to develop PCR and molecular diagnostic of AI Dominican Republic, Cayman island, Needs: rooms, biosafety cabinets, BSL2, PCR equipment, reagents

12 Avian Influenza diagnostic in the Caribbean Technical workshop for AI molecular diagnostic - Brazil (TCP FAO America) February 2007 Barbados, Trinidad, Jamaica, Dominica, Cuba - Guadeloupe (CIRAD/FSP/FCR): June 2007 Barbados, Trinidad, Jamaica, Dominica, Belize, Cuba, Dominican Republic - Next one: Cayman, Antigua.

13 Exchange of samples in the Caribbean Not inactivated tissues (3mm 3 ) Swabs in ATB cloacal / oropharyngeal / tracheal Swabs (dry) Inactivated (to avoid) RNA Later Freeze Alcool 100% Lysis buffer Ambient T -20 C +4 C -20 C FEDEX IATA 650/602

14 Current procedures for sending samples to Guadeloupe Type of samples carried out: Live animals: cloacal and tracheal swabs Dead animals: cloacal and tracheal swabs + post mortem tissues (liver, heart) Conservation medium for transport: Non inactivated samples: antibiotic media or RNA later for tissues Sending of samples: Classified in the infectious substances (6.2) category B (UN3373): Diagnosis Specimens Standard triple packing IATA 650: (602 could be necessary with some airlines) Labelling Accompanying documents: diagnostic sample Fret company: FEDEX To be tested

15 GUADELOUPE SITE DE DUCLOS DOCUMENT QSE ENREGISTREMENT Follow-up of Avian Influenza samples Date d application Code : E - TE /GUA Révision : 00 A- General information Date of sampling : Name of the person who did the sampling : Name, function, and address of the person requesting the analysis: Name of farmer : Location of the bird : B- Information on the sample Bird specie : Identification number : Type of sample (swab, tissue) : Number of samples : Preservation before shipment : (time and temperature) C-Information on the bird Number of sick birds dead birds number of birds in the farm Other information D Requested diagnostic Avian influenza Newcastle disease West Nile (only on tissue) Shipping date Name and signature

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure TCB No. 2011-007 May 2013 Technical Bulletin GS FLX and GS Junior Systems Short Fragment Removal for the Amplicon Library Preparation Procedure Introduction Some library preparation methods may result

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

VETERINARY LABORATORIES IN KENYA

VETERINARY LABORATORIES IN KENYA VETERINARY LABORATORIES IN KENYA Dr. J. M. Macharia and Dr. D.M. Mwangangi MINISTRY OF LIVESTOCK DEVELOPMENT ORGANIZATIONAL CHART DIRECTOR OF AGRICULTURE PERMANENT SECRETARY DIRECTOR OF VETERINARY SERVICES

More information

Algorithm for detecting Zika virus (ZIKV) 1

Algorithm for detecting Zika virus (ZIKV) 1 Algorithm for detecting Zika virus (ZIKV) 1 This algorithm is addressed to laboratories with established capacity (molecular, antigenic and/or serological) to detect dengue (DENV), Zika (ZIKV) 2, and chikungunya

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Taqman TCID50 for AAV Vector Infectious Titer Determination

Taqman TCID50 for AAV Vector Infectious Titer Determination Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through

More information

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Recommended Procedures for the Extraction of RNA Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 RNA Extraction Isolates RNA from other cellular components in the

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

HPAI H5N8 outbreak in layers in the Netherlands. 20 November 2014, Ruth Bouwstra

HPAI H5N8 outbreak in layers in the Netherlands. 20 November 2014, Ruth Bouwstra HPAI H5N8 outbreak in layers in the Netherlands 20 November 2014, Ruth Bouwstra Avian Influenza Surveillance in the Netherlands Passive surveillance (notification of suspect situation) Acute infections

More information

3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD)

3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) 3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) - 1 R 3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) enibacterium salmoninarum infections can occur at any life stage in salmonid

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a) E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

http:www.aphis.gov/animal_health/vet_accreditation/training_modules.shtml

http:www.aphis.gov/animal_health/vet_accreditation/training_modules.shtml APHIS Approved Supplemental Training for Accredited Veterinarians has now been approved for Continuing Education Credit by the Texas Board of Veterinary Medical Examiners In the new accreditation process,

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

The Danish veterinary preparedness for avian influenza and Newcastle disease

The Danish veterinary preparedness for avian influenza and Newcastle disease The Danish veterinary preparedness for avian influenza and Newcastle disease Sten Mortensen, Veterinary R&D manager, Animal Health Division, Deputy head 19-04-2016 Livestock statistics, Denmark 2015 Species

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Animal Health Programs: Combining Surveillance, Detection, and Response

Animal Health Programs: Combining Surveillance, Detection, and Response United States Department of Agriculture Animal and Plant Health Inspection Service Animal Health Programs: Combining Surveillance, Detection, and Response The Animal and Plant Health Inspection Service

More information

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Archimer http://archimer.ifremer.fr

Archimer http://archimer.ifremer.fr Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site Fish

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

Vaccination as a control tool against HPAI Recommendation of OIE/FAO Network of Expertise on Animal Influenza

Vaccination as a control tool against HPAI Recommendation of OIE/FAO Network of Expertise on Animal Influenza Inception Meeting of the OIE/JTF Project for Controlling Zoonoses in Asia under One Health Concept Tokyo, 19-20 December 2013 Vaccination as a control tool against HPAI Recommendation of OIE/FAO Network

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Avian Influenza: the moving target

Avian Influenza: the moving target Avian Influenza: the moving target Ilaria Capua 1 & Dennis J Alexander 2 OIE/FAO Reference Laboratories 1 Istituto Zooprofilattico Sperimentale delle Venezie Legnaro, Padova IT 2 VLA Weybridge, UK H5N1

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

Chlamydomonas adapted Green Fluorescent Protein (CrGFP)

Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Plasmid pfcrgfp for fusion proteins Sequence of the CrGFP In the sequence below, all amino acids which have been altered from the wildtype GFP from

More information

HPAI Response HPAI Response Goals November 18, 2015

HPAI Response HPAI Response Goals November 18, 2015 HPAI Response HPAI Response Goals November 18, 2015 Please note: These may be revised as the situation continues to change. USDA APHIS will work to achieve these goals for critical activities in a highly

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa Available online at www.sciencedirect.com Veterinary Parasitology 157 (2008) 123 127 Short communication Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in

More information

VETERINARY MEDICINE IN AFGHANISTAN Dr. Nasrin Stanikzai AFGHANISTAN History of Veterinary Medicine in Afghanistan In Afghanistan it has been traditional to use the horse as a mode of transportation. The

More information

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes?

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Journal of Alzheimer s Disease 7 (2005) 63 80 63 IOS Press Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Eric Steen,

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

PDF Version: Select up to 6 modules per USB drive ($25.00 includes shipping)

PDF Version: Select up to 6 modules per USB drive ($25.00 includes shipping) Name: Mailing Address: (First) (Last) City: State: Zip/Postal Code: Phone: USDA-APHIS National Veterinary Accreditation Program (NVAP) APHIS-Approved Supplemental Training Materials Order Form Country*

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour

More information

Fare clic per modificare lo stile del titolo

Fare clic per modificare lo stile del titolo FAO Regional Program Progress Cambodia, China, LaoPDR,, Myanmar, Vietnam Emergency Centre for Transboundary Animal Disease FAO Regional Office for Asia and the Pacific On behalf of FAO-RAP ECTAD Dr Lotfi

More information

der Strukturbiologie

der Strukturbiologie Einführung Aspekte der in Thermodynamik die Bioinformatik in der Strukturbiologie Wintersemester 2012/13 16:00-16:45 Hörsaal N100 B3 Peter Güntert Literatur Jean-Michel Claverie, Cedric Notredame: Bioinformatics

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Shipping of Infectious Substances and Patient Specimens

Shipping of Infectious Substances and Patient Specimens Shipping of Infectious Substances and Patient Specimens If you ship infectious substances or patient specimens you should be aware of the International Air Transport Association (IATA) Dangerous Goods

More information

Global Influenza Surveillance Network (GISN) Activities in the Eastern Mediterranean Region

Global Influenza Surveillance Network (GISN) Activities in the Eastern Mediterranean Region Global Influenza Surveillance Network (GISN) Activities in the Eastern Mediterranean Region Dr Hassan El Bushra Regional Adviser, Emerging Diseases, Communicable Diseases Surveillance, Forecasting and

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

AU/IBAR-CHINA ASSISTANCE PROTOCOL ON THE PREVENTION AND CONTROL OF HPAI IN AFRICA

AU/IBAR-CHINA ASSISTANCE PROTOCOL ON THE PREVENTION AND CONTROL OF HPAI IN AFRICA African Union Interafrican Bureau of Animal Resources Regional SPINAP-AHI Coordination for Eastern Africa AU/IBAR-CHINA ASSISTANCE PROTOCOL ON THE PREVENTION AND CONTROL OF HPAI IN AFRICA CHINA-AFRICA

More information

9. Materials. 9.1 Chemicals Acetic Acid (glacial) Materials. 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate.

9. Materials. 9.1 Chemicals Acetic Acid (glacial) Materials. 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate. 9. Materials 9.1 Chemicals Acetic Acid (glacial) Acetone Acetonitrile Agarose 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate Ampicillin ATP Bromophenol Blue Butanol Chloroform CTP 7-Deaza-GTP

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

http://www.who.int/csr/disease/avian_influenza/phase/en 4 http://new.paho.org/hq/index.php?option=com_content&task=view&id=1283&itemid=569

http://www.who.int/csr/disease/avian_influenza/phase/en 4 http://new.paho.org/hq/index.php?option=com_content&task=view&id=1283&itemid=569 Food and Agriculture Organization of the United Nations International Food Safety Authorities Network (INFOSAN) (Update) 30 April 2009 INFOSAN Information Note No. 2/2009 Human-animal interface aspects

More information

582670 Algorithms for Bioinformatics

582670 Algorithms for Bioinformatics Adapted from slides by Veli Mäkinen / Algorithms for Bioinformatics 011 which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms

More information

The United States Department of Defense Biological Threat Reduction Program. Threat Agent Detection and Response and Cooperative Biological Research

The United States Department of Defense Biological Threat Reduction Program. Threat Agent Detection and Response and Cooperative Biological Research The United States Department of Defense Biological Threat Reduction Program Threat Agent Detection and Response and Cooperative Biological Research Shawn Cali, Sara Mayer and Roger Breeze February 23,

More information

Connecticut Veterinary Medical Diagnostic Laboratory

Connecticut Veterinary Medical Diagnostic Laboratory Connecticut Veterinary Medical Diagnostic Laboratory Department of Pathobiology and Veterinary Science College of Agriculture and Natural Resources University of Connecticut SL Bushmich, MS, DVM CVMDL:

More information

REFERENCE LABORATORY TESTING

REFERENCE LABORATORY TESTING Diagnostic Services Price List Tel: +44 (0) 1483 232441 Fax: +44 (0) 1483 232621 Reference Laboratories Incoming.Samples@pirbright.ac.uk October 2014 1 REFERENCE LABORATORY TESTING The Pirbright Institute

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

Interleukin-4 Receptor Signal Transduction: Involvement of P62

Interleukin-4 Receptor Signal Transduction: Involvement of P62 Interleukin-4 Receptor Signal Transduction: Involvement of P62 Den Naturwissenschaftlichen Fakultäten der Friedrich Alexander Universität Erlangen Nürnberg zur Erlangung des Doktorgrades vorgelegt von

More information

Animal Disease Surveillance System

Animal Disease Surveillance System CHAPTER 4 Animal Disease Surveillance System Monitoring and surveillance program for animal diseases is one of key components of DLD s mission. Surveillance programs and activities are aimed at ensuring

More information