12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL

Transcription

1 Dr. Sanjeeva Srivastava IIT Bombay Genomics Transcriptomics Why proteomics? IIT Bombay 2 1

2 IIT Bombay 3 Genome: The entire sequence of an organism s hereditary information, including both coding and non-coding regions, encoded in DNA is known as genome. Studying genome of an organism by employing sequencing and genome mapping is known as genomics. IIT Bombay 4 2

3 IIT Bombay 5 IIT Bombay 6 3

4 IIT Bombay 7 Technique Description Sensitivity Chain termination method (Sanger) Pyrosequencing MALDI-TOF Gold standard but time consuming Based on chemiluminescent detection Identifies variant alleles SNPs High Very high Very high IIT Bombay 8 4

5 IIT Bombay 9 IIT Bombay 10 5

6 Genome 3.2 bp Sequence is same in 99.9% people 2% of genome encodes instructions for protein synthesis Average gene 3,000 bp Total genes 25,000 IIT Bombay 11 Molecular Medicine Environment Agriculture and Livestock Microbial Genetics Risk assessment of individuals to specific allergens Bioarchaeology, Anthropology, Evolution, and Human Migration IIT Bombay 12 6

7 IIT Bombay 13 Next generation or second generation sequencing technology sequencing by ligation or by synthesis, including pyrosequencing and reversible chain termination Third generation sequencing technology - to improve secondgeneration sequencing technology and lower the cost, use of scanning tunneling electron microscope, fluorescence resonance energy transfer, single-molecule detection and protein nanopores IIT Bombay 14 7

8 IIT Bombay 15 Illumina Pyro- sequencung Helicos NGS Platforms SOLiD Ion Torrent Ref: Am J Clin Pathol 2011;136: IIT Bombay 16 8

9 In NGS preparations are done in vitro Transformation of E. coli and other limitations are avoided NGS methods based on arrays (not capillary) Sequencing time is reduced Reduced cost IIT Bombay 17 IIT Bombay 18 9

10 IIT Bombay 19 IIT Bombay 20 10

11 Transcriptome - analysis of all species of transcript, including mrnas, non-coding RNAs and small RNAs Transcript analysis is used to quantify the expression level changes of each transcript during development and under different conditions IIT Bombay 21 Northern blotting Quantitative real-time polymerase chain reaction Differential display Serial analysis of gene expression Microarray IIT Bombay 22 11

12 IIT Bombay 23 IIT Bombay 24 12

13 IIT Bombay 25 IIT Bombay 26 13

14 AAAAAAAAA mrna RNA fragments OR AAAAAAAAA TTTTTTTTTT cdna EST library with adaptors AGTTTGCCAATGACTAGGTACCAGGTAAA GTTACCATGGATTCCATTGG Short sequence reads GTAGTCGTAAGCTAGTCAGTACGTAGCTAA GTGATACAGTCTAGTACAGTATCGATGATAA Junction reads Exonic reads ORF Coding sequence..aaaaaaaa A..AAAA Poly A end reads Mapped sequence reads Ref: Nat Review Genetics 2009;10:57-63 IIT Bombay 27 Base resolution expression profile RNA expression level Nucleotide position IIT Bombay 28 14

15 IIT Bombay 29 Proteome entire complement of proteins expressed by genome of an organism under defined conditions The study of entire compendium of proteins encoded by a genome is known as proteomics IIT Bombay 30 15

16 IIT Bombay 31 Availability of completed genome sequences of several species has shifted the focus towards identification and characterization of all gene products of organism Genome represents only the starting point but products of gene expression, proteins, provide a much more meaningful insight into essential biological processes. IIT Bombay 32 16

17 IIT Bombay 33 Single gene, multiple protein products indicates complexity of the proteome IIT Bombay 34 17

18 IIT Bombay 35 IPG strip DIFFERENCE GEL ELECTROPHORESIS (DIGE) 2-D ELECTROPHORESIS (2-DE) SDS-PAGE IIT Bombay 36 18

19 Ioniza'on Mass Sor'ng (filtering) Detec'on Ion Source Forms ions (charged molecules) Mass Analyzer Sort Ions by Mass (m/z) Ion Detector Detects ions Data System Sample Inlet Data Processing Rela=ve Abundance Mass Spectrum m/z IIT Bombay 37 Gene insert Protein expression Expression vector Heterologous host (e.g. E. coli) Gene of interest Protein purification Chromatography Functionalized array surface Protein purification SDS-PAGE IIT Bombay 38 19

20 Free antigen Antigen-Antibody complex % Reflectivity Reflection angle Flow cell system Bound antibodies Glass slide Incident light Prism Gold film Reflected light Change in angle of reflection IIT Bombay 39 Genomics Transcriptomics Why Proteomics? Need for Systems Level investigation IIT Bombay 40 20

21 Berg J., Tmyoczko J. & Stryer L., Biochemitry fifth ed., W. H. Freeman & company, ISBN: Link A. J. & Joshua LaBaer, Proteomics: A laboratory Cold Spring Harbor course manual first ed., Cold Spring Harbor laboratory press, ISBN: Simpson R. J. Proteins and Proteomics: a laboratory manual ed., Cold Spring Harbor laboratory press, ISBN: Voet D. & Voet J., Biochemistry fourth ed., Wiley, ISBN: X. Zhong Wang, Mark Gerstein, Michael Snyder, RNA-Seq: a revolutionary tool for transcriptomics. Nat Review Genetics 2009;10: Jeffrey S. Ross, MD,1,2 and Maureen Cronin, Whole Cancer Genome Sequencing by Next-Generation Methods. Am J Clin Pathol 2011;136: Wang et al. RNA-Seq: a revolutionary tool for transcriptomics. Nat Review Genetics 2009;10:57-63 IIT Bombay Science Genome Map. Science 16 February Vol. 291 no p Pareek et al. Sequencing technologies and genome sequencing. Journal of Applied Genetics. November 2011, Volume 52, Issue 4, pp , Lawler et al Harbinger of a Litigious Future? Science 10 November 2000: Vol. 290 no p IIT Bombay 21