12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL

Size: px
Start display at page:

Download "12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL"


1 Dr. Sanjeeva Srivastava IIT Bombay Genomics Transcriptomics Why proteomics? IIT Bombay 2 1

2 IIT Bombay 3 Genome: The entire sequence of an organism s hereditary information, including both coding and non-coding regions, encoded in DNA is known as genome. Studying genome of an organism by employing sequencing and genome mapping is known as genomics. IIT Bombay 4 2

3 IIT Bombay 5 IIT Bombay 6 3

4 IIT Bombay 7 Technique Description Sensitivity Chain termination method (Sanger) Pyrosequencing MALDI-TOF Gold standard but time consuming Based on chemiluminescent detection Identifies variant alleles SNPs High Very high Very high IIT Bombay 8 4

5 IIT Bombay 9 IIT Bombay 10 5

6 Genome 3.2 bp Sequence is same in 99.9% people 2% of genome encodes instructions for protein synthesis Average gene 3,000 bp Total genes 25,000 IIT Bombay 11 Molecular Medicine Environment Agriculture and Livestock Microbial Genetics Risk assessment of individuals to specific allergens Bioarchaeology, Anthropology, Evolution, and Human Migration IIT Bombay 12 6

7 IIT Bombay 13 Next generation or second generation sequencing technology sequencing by ligation or by synthesis, including pyrosequencing and reversible chain termination Third generation sequencing technology - to improve secondgeneration sequencing technology and lower the cost, use of scanning tunneling electron microscope, fluorescence resonance energy transfer, single-molecule detection and protein nanopores IIT Bombay 14 7

8 IIT Bombay 15 Illumina Pyro- sequencung Helicos NGS Platforms SOLiD Ion Torrent Ref: Am J Clin Pathol 2011;136: IIT Bombay 16 8

9 In NGS preparations are done in vitro Transformation of E. coli and other limitations are avoided NGS methods based on arrays (not capillary) Sequencing time is reduced Reduced cost IIT Bombay 17 IIT Bombay 18 9

10 IIT Bombay 19 IIT Bombay 20 10

11 Transcriptome - analysis of all species of transcript, including mrnas, non-coding RNAs and small RNAs Transcript analysis is used to quantify the expression level changes of each transcript during development and under different conditions IIT Bombay 21 Northern blotting Quantitative real-time polymerase chain reaction Differential display Serial analysis of gene expression Microarray IIT Bombay 22 11

12 IIT Bombay 23 IIT Bombay 24 12

13 IIT Bombay 25 IIT Bombay 26 13

14 AAAAAAAAA mrna RNA fragments OR AAAAAAAAA TTTTTTTTTT cdna EST library with adaptors AGTTTGCCAATGACTAGGTACCAGGTAAA GTTACCATGGATTCCATTGG Short sequence reads GTAGTCGTAAGCTAGTCAGTACGTAGCTAA GTGATACAGTCTAGTACAGTATCGATGATAA Junction reads Exonic reads ORF Coding sequence..aaaaaaaa A..AAAA Poly A end reads Mapped sequence reads Ref: Nat Review Genetics 2009;10:57-63 IIT Bombay 27 Base resolution expression profile RNA expression level Nucleotide position IIT Bombay 28 14

15 IIT Bombay 29 Proteome entire complement of proteins expressed by genome of an organism under defined conditions The study of entire compendium of proteins encoded by a genome is known as proteomics IIT Bombay 30 15

16 IIT Bombay 31 Availability of completed genome sequences of several species has shifted the focus towards identification and characterization of all gene products of organism Genome represents only the starting point but products of gene expression, proteins, provide a much more meaningful insight into essential biological processes. IIT Bombay 32 16

17 IIT Bombay 33 Single gene, multiple protein products indicates complexity of the proteome IIT Bombay 34 17


19 Ioniza'on Mass Sor'ng (filtering) Detec'on Ion Source Forms ions (charged molecules) Mass Analyzer Sort Ions by Mass (m/z) Ion Detector Detects ions Data System Sample Inlet Data Processing Rela=ve Abundance Mass Spectrum m/z IIT Bombay 37 Gene insert Protein expression Expression vector Heterologous host (e.g. E. coli) Gene of interest Protein purification Chromatography Functionalized array surface Protein purification SDS-PAGE IIT Bombay 38 19

20 Free antigen Antigen-Antibody complex % Reflectivity Reflection angle Flow cell system Bound antibodies Glass slide Incident light Prism Gold film Reflected light Change in angle of reflection IIT Bombay 39 Genomics Transcriptomics Why Proteomics? Need for Systems Level investigation IIT Bombay 40 20

21 Berg J., Tmyoczko J. & Stryer L., Biochemitry fifth ed., W. H. Freeman & company, ISBN: Link A. J. & Joshua LaBaer, Proteomics: A laboratory Cold Spring Harbor course manual first ed., Cold Spring Harbor laboratory press, ISBN: Simpson R. J. Proteins and Proteomics: a laboratory manual ed., Cold Spring Harbor laboratory press, ISBN: Voet D. & Voet J., Biochemistry fourth ed., Wiley, ISBN: X. Zhong Wang, Mark Gerstein, Michael Snyder, RNA-Seq: a revolutionary tool for transcriptomics. Nat Review Genetics 2009;10: Jeffrey S. Ross, MD,1,2 and Maureen Cronin, Whole Cancer Genome Sequencing by Next-Generation Methods. Am J Clin Pathol 2011;136: Wang et al. RNA-Seq: a revolutionary tool for transcriptomics. Nat Review Genetics 2009;10:57-63 IIT Bombay Science Genome Map. Science 16 February Vol. 291 no p Pareek et al. Sequencing technologies and genome sequencing. Journal of Applied Genetics. November 2011, Volume 52, Issue 4, pp , Lawler et al Harbinger of a Litigious Future? Science 10 November 2000: Vol. 290 no p IIT Bombay 21

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Microarray Technology

Microarray Technology Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Department of Biology Sample

Department of Biology Sample Syllabus BIOTECHNOLOGY Spring 2013 Instructor: Atanu Duttaroy, Professor Tel: 202-806-5362 Email: aduttaroy@howard.edu Office: Room 336, Just Hall Teaching Assistant: Mr. Subhas Mukherjee Lecture: Room

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina im411@cam.ac.uk Head of Computational Biology Lab HPC Service, University of Cambridge, UK EMBL-EBI Scientific collaborator Genome Campus, Hinxton, Cambridge,

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Common Course Topics Biology 1414: Introduction to Biotechnology I

Common Course Topics Biology 1414: Introduction to Biotechnology I Common Course Topics Biology 1414: Introduction to Biotechnology I Assumptions Students may be enrolled in this course for several reasons; they are enrolled in the Biotechnology Program, they need a science

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Gene Cloning and DNA Analysis: An Introduction

Gene Cloning and DNA Analysis: An Introduction Gene Cloning and DNA Analysis: An Introduction Brown, Terry A. ISBN-13: 9781405111218 Table of Contents PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Analysis of gene expression data. Ulf Leser and Philippe Thomas

Analysis of gene expression data. Ulf Leser and Philippe Thomas Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

Biotechnology. Biotechnology s Laboratories. Lab Name Location Person in Charge Programs Served Courses Served. Biotechnology Department

Biotechnology. Biotechnology s Laboratories. Lab Name Location Person in Charge Programs Served Courses Served. Biotechnology Department Biotechnology s oratories Biotechnology Name Location Person in Charge Programs Served Courses Served General Biology W12-039 Zahra Yassin General Microbiology M12-132 Aisha Echtibi General (Basic Course)

More information

The National Institute of Genomic Medicine (INMEGEN) was

The National Institute of Genomic Medicine (INMEGEN) was Genome is...... the complete set of genetic information contained within all of the chromosomes of an organism. It defines the particular phenotype of an individual. What is Genomics? The study of the

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information



More information

Techniques in Molecular Biology (to study the function of genes)

Techniques in Molecular Biology (to study the function of genes) Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression

More information

Introduction to Biotechnology (BIO-210)

Introduction to Biotechnology (BIO-210) Bergen Community College Division of Mathematics, Science, and Technology Department of Biology and Horticulture Introduction to Biotechnology (BIO-210) General Course Syllabus Spring 2016 Course Title:

More information



More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

3 rd Generation Sequencing Technologies. Roger E. Bumgarner

3 rd Generation Sequencing Technologies. Roger E. Bumgarner 3 rd Generation Sequencing Technologies Roger E. Bumgarner rogerb@uw.edu Brief review First generation sequencing technologies Sanger and Maxim Gilbert methods Used either chemical or enzymatic methods

More information

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex

More information

An Introduction to Next-Generation Sequencing for Cell Biologists

An Introduction to Next-Generation Sequencing for Cell Biologists An Introduction to Next-eneration Sequencing for Cell Biologists www.illumina.com/nstech Table of Contents Welcome to Next-eneration Sequencing 3 Why Next-eneration Sequencing? 3 High-Throughput Science

More information



More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE

Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE Pharmaceutical Biotechnology Recombinant DNA technology Western blotting and SDS-PAGE Recombinant DNA Technology Protein Synthesis Western Blot Western blots allow investigators to determine the molecular

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Basics of microarrays. Petter Mostad 2003

Basics of microarrays. Petter Mostad 2003 Basics of microarrays Petter Mostad 2003 Why microarrays? Microarrays work by hybridizing strands of DNA in a sample against complementary DNA in spots on a chip. Expression analysis measure relative amounts

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

Common Course Topics Biology 1406: Cell and Molecular Biology

Common Course Topics Biology 1406: Cell and Molecular Biology Common Course Topics Biology 1406: Cell and Molecular Biology 1. Introduction to biology --the scientific study of organisms --properties of life --assumptions, methods and limitations of science --underlying

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

Strategies for studying gene regulation mechanisms have changed dramatically over the

Strategies for studying gene regulation mechanisms have changed dramatically over the By Michael F. Carey, University of California, Los Angeles; Craig L. Peterson, University of Massachusetts Medical School, Worcester; and Stephen T. Smale, University of California, Los Angeles Strategies

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Protein immunoblotting

Protein immunoblotting Protein immunoblotting (Western blotting) Dr. Serageldeen A. A. Sultan Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt seaas@lycos.com Western blotting -It is an analytical technique used to

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

Ion Torrent Amplicon Sequencing

Ion Torrent Amplicon Sequencing APPLICATION NOTE Amplicon Sequencing Ion Torrent Amplicon Sequencing Introduction The ability to sequence a genome or a portion of a genome has enabled researchers to begin to understand how the genetic

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Chapter 3 Contd. Western blotting & SDS PAGE

Chapter 3 Contd. Western blotting & SDS PAGE Chapter 3 Contd. Western blotting & SDS PAGE Western Blot Western blots allow investigators to determine the molecular weight of a protein and to measure relative amounts of the protein present in different

More information

Global MicroRNA Amplification Kit

Global MicroRNA Amplification Kit Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Subject Coverage Read and see these newly featured protocols online at www.cshprotocols.org:

Subject Coverage Read and see these newly featured protocols online at www.cshprotocols.org: Subject Coverage Antibodies Bioinformatics/Genomics Cell Biology Chromatography Computational Biology DNA Delivery/Gene Transfer Electrophoresis Genetics High Throughput Analysis Imaging/Microscopy Immunology

More information


Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Translational Technologies Resources (TTR)

Translational Technologies Resources (TTR) Translational Technologies Resources (TTR) TTR at CWRU Bioinformatics and Biostatistics Core This core can provide services on typical data which are focused on large scale information datasets (a.k.a.

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Proteomics in Practice

Proteomics in Practice Reiner Westermeier, Torn Naven Hans-Rudolf Höpker Proteomics in Practice A Guide to Successful Experimental Design 2008 Wiley-VCH Verlag- Weinheim 978-3-527-31941-1 Preface Foreword XI XIII Abbreviations,

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

Analysis of proteins

Analysis of proteins Analysis of proteins Western blot Protein seperation (liqiuid chromatography) Mass spectrometry Assaying of protein in... Blood (e.g. viral infections, pregnancy test) Cells Tissue Urin (bladder infection)

More information