Next Generation Sequencing in Myeloid Malignancies

Size: px

Start display at page:

Download "Next Generation Sequencing in Myeloid Malignancies"

Geoffrey Ray
7 years ago
Views:

1 Next Generation Sequencing in Myeloid Malignancies Nabeel R. Yaseen, MD, PhD Associate Professor Hematopathology Section Head Department of Pathology and Immunology Washington University School of Medicine

2 Myeloid Malignancies Acute Myeloid Leukemia Myelodysplastic Syndromes Myeloproliferative Neoplasms Myelodysplastic/Myeloproliferative Neoplasms

3 WHO 2008 Classification of AML AML with recurrent genetic abnormalities AML with myelodysplasia-related changes Therapy-related myeloid neoplasms AML, not otherwise specified

4 AML with recurrent genetic abnormalities Balanced translocations/inversions Acute promyelocytic leukemia with t(15;17)(q22;q21); PML-RARA AML with t(8;21)(q22;q22); RUNX1-RUNX1T1 (AML1-ETO) AML with inv(16)(p13.1q22) or t(16;16)(p13.1;q22); CBFB-MYH11 AML with t(9;11)(p22;q23); MLL-MLLT3 AML with t(6;9)(p23;q34); DEK-NUP214 AML with inv(3)(q21;q26.2) or t(3;3 )(q21;q26.2); RPN1-EVI1 AML (megakaryoblastic) with t(1;22)(p13;q13); RBM15-MKL1 AML with gene mutations FLT3 NPM1 CEBPA

5 FLT3 (FMS-like tyrosine kinase) Receptor tyrosine kinase expressed by hematopoietic stem/progenitor cells. Plays roles in survival, proliferation and differentiation Mutated in approximately 1/3 of AML cases resulting in constitutive activation: FLT3 ITD (Internal Tandem Duplication): ~25% of AML Poor prognostic marker FLT3 TKD (tyrosine kinase domain) mutation (most commonly D835): ~10% of AML Prognostic significance unclear Small, Hematology 2006;2006:

6 Nucleophosmin (NPM1) Multifunctional nucleolar protein Exon 12 mutations result in cytopalsmic localization Common in AML with normal karyotype Good prognostic marker in the absence of FLT3_ITD Chen et al. 2006, Archives of Pathology and Laboratory Medicine; Falini et al., Blood, 2006

7 CEBPA C/EBP is a transcription factor that is important for granulocytic differentiation Functions as a homodimer or as a heterodimer with other CEBP proteins Two isoforms produced by alternative translation initiation: p42 (thought to be the active form) and p30 Inactivated by mutations in ~ 6-15% of de novo AML Mutations are often biallelic; the most common are: C-terminal mutations disrupting DNA-binding and dimerization domains: often both alleles involved N-terminal frameshift mutations resulting in loss of the p42 isoform with the p30 acting in a dominant negative fashion to inhibit the remaining p42 Favorable prognosis for the biallelic mutants in the absence of poor prognostic factors Fasan et al., Leukemia, 2014,

8 AML risk stratification Martelli et al. / Blood Reviews 27 (2013) 13 22

9 Genes mutated in AML The Cancer Genome Atlas Research Network. N Engl J Med 2013;368:

10 Genes Mutated in Myeloid Malignancies Signal transduction: Receptors: FLT3, KIT, CSF3R, MPL RAS pathway: NRAS, KRAS, CBL, NF1, PTPN11 JAK2 LNK Transcription factors: CEBPA, RUNX1, PHF6, p53, WT1, ETV6, CTCF Epigenetic modifiers: DNA methylation: DNMT3A, TET2, IDH1/2 Histone modification: MLL, ASXL1, ASXL2, EZH2, SUZ12, EED, BCOR, NCOR2 Pre-mRNA splicing: SF3B1 (75% of RARS), SRSF2, U2AF1, ZRSR2 Cohesins: STAG2, RAD21, SMC3, SMC1A DNA damage response: P53, ATM, BRCC3 Other: NPM1, SETBP1, CALR, LAMB4

11 AML and DNA Methylation DNMT3A TET2 IDH1/2 Shih et al. 2012, Nature Reviews Cancer 12,

12 PRC2 ASXL1 and the Polycomb LL Repressor Complex 2 repress transcription through histone H3K27 methylation b 5mC IDH1/2 αkg TET2 DNMT3A ASXL1 NR 5hmC 5mC K27me3 LL Murati et al., BMC Cancer 2012, 12:304

13 AML risk stratification Martelli et al. / Blood Reviews 27 (2013) 13 22

14 WHO Classification of Myelodysplastic Syndromes Refractory cytopenia with unilineage dysplasia: RA, RN, RT Refractory anemia with ring sideroblasts Refractory cytopenia with multilineage dysplasia Refractory anemia with excess blasts RAEB-1 RAEB-2 5q- syndrome Myelodysplastic syndrome, unclassifiable Childhood myelodysplastic syndrome Therapy-related myelodysplastic syndrome

15 Dysplastic changes

16 Cytogenetic abnormalities in MDS Karyotypic abnormalitites are seen in ~40-60% of primary MDS and ~90% of t-mds In cases with questionable dysplasia can help establish a diagnosis Nybakken and Bagg. J Mol Diagn Mar;16(2): Olney and Le Beau, Leuk Res, 31 (2007),

17 Risk Stratification in MDS: IPSS Bejar, Hematology Am Soc Hematol Educ Program, 2013:

18 Treatment of MDS Zeidan et al., Blood Reviews, Volume 27, Issue 5, 2013,

19 Cytogenetic Findings in MDS Karyotypic abnormalitites are seen in ~40-60% of primary MDS and ~90% of t-mds In cases with questionable dysplasia can help establish a diagnosis Nybakken and Bagg. J Mol Diagn Mar;16(2): Olney and Le Beau, Leuk Res, 31 (2007),

20 Genes Mutated in MDS 90% of MDS patients have at least 1 mutation Median 3 mutations/patient Haferlach et al., Leukemia (2014) 28,

21 Genes Mutated in MDS Abdel-Wahab, and Figueroa, Hematology 2012;2012:56-64 Thota S et al. Blood 2014;124:

22 Presence of MDS-related Mutations Decreases Overall Survival Mutations in TP53, EZH2, ETV6, RUNX1, or ASXL1 impact prognosis independent of IPSS score Bejar et al. N Engl J Med 2011; 364:

23 Prognostic models for MDS including molecular markers Haferlach et al., Leukemia (2014) 28,

24 Mutation analysis in suspected MDS 28 patients with suspected MDS were sequenced using a 26-gene panel: ASXL1, BCOR, BRAF, CBL, DNMT3A, ETV6, EZH2, FLT3 (TKD), GATA1, GATA2, IDH1, IDH2, JAK2, KIT, KRAS, MPL, NPM1, NRAS, PHF6, RUNX1, SF3B1, SRSF2, TET2, TP53, U2AF1, and WT1. 46% had a mutation in at least one gene 25% had mutations in prognostically significant genes (based on Bejar et al., N Engl J Med. 2011;364: ): ASXL1, ETV6, EZH2, RUNX1, TP53 Kohlmann et al., ASH 2013, Abstract 1547

25 Estimated Cost Costs Compared to Sanger Approximate Billed Cost per kb Sequenced (CAP/CLIA Laboratory) $35,000 $30,000 $25,000 $20,000 $15,000 $10,000 NGS $5,000 $ kb of Sequence Courtesy of Eric Duncavage, MD

26 Next Generation Sequencing Numerous sequencing reactions run in parallel resulting in short reads that have to be mapped back to a reference genome

27 Clinical Next Generation Sequencing Clinical NGS usually involves 3 steps: Target Enrichment Sequencing Bioinformatic analysis

28 Step 1 - Enrichment Amplicon Based Enrichment Single step enrichment and library prep Fast (~4h) Less expensive Limited to ~50kb of area Difficult to detect larger indels, Translocations, CNV As little as 10ng of input DNA Great for rapid hotspot cancer panels Capture Based Enrichment Requires separate library prep step Takes ~3 days More expensive Unlimited capture area Requires >200ng of DNA Can detect full spectrum of mutations Great for larger multi-gene panels Courtesy of Eric Duncavage, MD

30 Step 2 - Sequencing Sequencers come in all shapes and sizes Illumina MiSeq, HiSeq, NextSeq Life Technologies Ion Torrent, Ion Proton SOLID Roche 454 Pacific Biosciences Oxford Nanopore MinION eduncavage@path.wustl.edu Courtesy of Eric Duncavage, MD

31 Next generation sequencing: Illumina

32 Next generation sequencing: Ion Torrent

33 Step 3 Bioinformatic Analysis Reference Genome ACTACTGACTAGCTACTCTTAACTACGTACTAAACTATCTATCTATCCTAGGCATCTACGTATCGATCGATTATCCCTACTACGATCTAGGGCTAGCTAGCTAGC TAACTACG CTAGGCAT Alignment and Mapping ACTACGTA TACGTACT CGTACTAA AGGCGTCT GCGTCTAC ATCTACGT SNV Variant Calling 2 A, 2G TTAACTACGTACTAAACTATCTATCTATCCTAGGCGTCTACGTAT Coverage Courtesy of Eric Duncavage, MD

34 Variant classification for mutations in cancer Level 1: Mutation is predictive or prognostic in patient s tumor type Level 2: Mutation is predictive or prognostic in another tumor type Level 3: Mutation has been reported as a somatic mutation in cancer Level 4: Novel variant of unknown significance Level 5: Known polymorphism Hagemann et al. Cancer Genet Dec;206(12):420-31

35 Level 1 mutations in AML/MDS Case 1 Case 2 Case 3 Case 4 Case 5 Case 6 Case7 Case 8 Case 9 Case 10 Case 11 Case 12 Case 13 Case 14 Case 15 TET2 TET2 ASXL1 ASXL1 DNMT3A DNMT3A DNMT3A IDH1 IDH1 IDH1 RUNX1 RUNX1 RUNX1 RUNX1 NPM1 NPM1 NPM1 NPM1 CEBPa CEBPa CEBPa CEBPa FLT3 KIT (cis) DNMT3A FLT3 DNMT3A 1 KIT (cis) TP53 TP53 Courtesy of Bevan Tandon, MD

36 Recurrent AML 37 y M CBC: WBC 10.0 Hb 10.9 MCV 98.3 Plt 115 Cytogenetics: 47,XY,+add(1)(p13),t(11;19)(q 23;p13.3)[3]/47,idem,t(3;12)(p 13;q24.1)[17]

37 Recurrent AML: ASXL1 mutation

38 Bone marrow with dysplastic changes and normal cytogenetics 75 y F CBC: WBC 2.1 Hb 13.1 MCV Plt 47 Cytogenetics: Normal

39 Bone marrow with dysplastic changes and normal cytogenetics: TET2 mutation

40 Summary Driver gene mutations are present in a majority of AML and MDS cases. Gene groups involved include receptor tyrosine kinases, transcription factors, DNA modifiers, histone modifiers, RNA splicing factors, and others. Identifying gene mutations in AML and MDS is useful in: Diagnosis Subclassification Prognostication Follow up Treatment NGS is increasingly becoming the tool of choice for identifying mutations in myeloid malignancies in the clinical setting

Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia

Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia Subarna Sinha PhD Department of Computer Science Principal Investigator: David Dill Daniel