In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA."

Transcription

1 In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

2 For each student: Science notebook Reproducible Master 6, Cooking Up a Protein For the class: Computer with large-screen monitor or projector that is connected to the Internet For each team: 5 different colors of 1.5 x 2 sticky notes Roll of thermal calculator paper, 2¼ wide meters of yarn Several copies of Reproducible Master 7, Amino Acids Computer with Internet access Set up a projector or a large-screen monitor and make sure that you have an Internet connection that will allow you to show the videos (the DNA Learning Center videos below, and the Scientific American video Genes vs. DNA vs. Chromosomes Instant Egghead #19 [https://youtu.be/c8ol1mtbgpu]). Preview the following videos from the DNA Learning Center, and determine whether the Basic or Advanced set is more appropriate for your class: o Basic DNA Transcription: https://www.youtube.com/watch?v=5mfsynityvg o Basic mrna Translation: https://www.youtube.com/watch?v=8dstvbaumvw o Advanced DNA Transcription: https://www.youtube.com/watch?v=smtwvdbfhlo o Advanced mrna Translation: https://www.youtube.com/watch?v=tfyf_rpwudy Make a key that represents each base as a particular color of sticky note. You should have one sticky note color for each of the following bases: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U). Make two displays: one for DNA that shows A, C, G, and T, and a second for RNA that shows A, C, G, and U. Bookmark the Cystic Fibrosis Mutation database (http://www.genet.sickkids.on.ca/genomicdnasequencepage.html) on the class computers.

3 Photocopy the reproducible master, making several additional copies of page 4 for each team (students will cut the names of the amino acids from this page).

4 1. Remind students of the CFTR protein they explored in the previous session. Ask, What do you think is the connection between CFTR and our genes? 2. Keep track of students responses on chart paper or on the board. Students will likely understand that genes hold coded instructions to build organisms, though their level of understanding may vary. 3. Show the Scientific American video Genes vs. DNA vs. Chromosomes Instant Egghead #19 (https://youtu.be/c8ol1mtbgpu) to the class. 4. Ask students to describe and explain the connection between DNA, genes, chromosomes, and proteins. 5. Explain that students will work in teams to explore how the genetic code of DNA is turned into proteins. Explain that some teams will be given a DNA sequence that codes for a normal protein, while others will be given a sequence that codes for an abnormal protein. It will be each team s job to transcribe and translate their sequence to determine whether they ve gotten a working or a non-working protein. 6. Pass out Reproducible Master 6, Cooking Up a Protein, to each student. Ask students to gather in their teams to discuss how they will undertake the activity. 7. Tell students that they will access the Cystic Fibrosis Mutation database online (http://www.genet.sickkids.on.ca/genomicdnasequencepage.html). Assign each team an exon sequence to explore. Tell teams to copy their exon sequences, translate them into mrna, and then create chains of amino acids based on the genetic sequences they have been given. 8. Give teams time to create their sequence of amino acids. 9. Have teams combine their sequences (in the proper order) with the sequences made by other teams. Display the partial protein that the class created somewhere in the classroom. 10. Referring to the partial protein that the class made, ask students, How much of the full protein did we create? You may want to give them a hint that they could base their estimate on the fraction of the exons they ve translated and transcribed. 11. Explain that you re going to show some videos that are computer models of the actual processes of transcription and translation. Show the two videos you chose: Basic DNA Transcription: https://www.youtube.com/watch?v=5mfsynityvg Basic mrna Translation: https://www.youtube.com/watch?v=8dstvbaumvw Advanced DNA Transcription: https://www.youtube.com/watch?v=smtwvdbfhlo Advanced mrna Translation: https://www.youtube.com/watch?v=tfyf_rpwudy

5 12. Ask students what they thought was interesting about the process and what questions they have about the process. Keep track of students responses on the board or on a piece of chart paper. 13. Discuss the Think About It questions. These questions should prompt students to start thinking about mutations, which they will explore in depth in the next lesson. What would happen to your amino acid chain if only one base was substituted? Does a substitution always lead to an incorrect amino acid? What would happen to your amino acid chain if a few base pairs were deleted? How do you think that might affect the protein?

6 Computer with Internet access Five different colors of sticky notes Roll of thermal calculator paper, 2¼ wide Yarn Scissors Tape or stapler Copies of Reproducible Master 7, Amino Acids DNA carries the genetic code of almost all organisms. It is found in the nucleus of each cell in your body. DNA is organized into chromosomes. Humans have 23 pairs of chromosomes, each with many genes that hold the instructions for many different traits. Your genetic makeup is stored in a genetic code made up of four chemical bases: adenine (A), cytosine (C), guanine (G), and thymine (T). The sequence of these four bases in your DNA is a code that holds the instructions for making and maintaining an organism. DNA consists of two complementary strands that form a long spiraling ladder shape called a double helix. Each base pairs with another: adenine with thymine, and cytosine with guanine. Each base is attached to a sugar molecule and a phosphate molecule that form the rails of the ladder. Source of graphic: U.S. National Library of Medicine (http://ghr.nlm.nih.gov/handbook/basics/dna)

7 When a cell divides, DNA is duplicated by splitting the ladder into two rails, with new, complementary rails forming for each original rail. This allows cells to divide and to each contain the full complement of DNA. Genes are made up of more than just the DNA that codes for their particular protein. In fact, some of the DNA in a gene doesn t code for anything. This part of the DNA is called an intron sequence. The part that codes for a protein is called an exon sequence. The gene that codes for the CFTR protein is on chromosome 7. When a protein is made, the DNA ladder splits into two rails, just like it does when it is being duplicated. However, during protein synthesis, the gene sequence is copied (transcribed) into messenger RNA (mrna). The intron sequences are then removed in a process called splicing, leaving only the exons, which code for the protein. The mrna then leaves the nucleus and is translated in a cellular organelle called the ribosome (found in the cytoplasm of the cell) into a protein made up of a series of amino acids. 1. Determine what exon your team has been assigned, and write that number here: 2. Go to the Cystic Fibrosis Mutation Database (http://www.genet.sickkids.on.ca/genomicdnasequencepage.html) and find your exon. Click on the exon; you ll see that a red box appears on the CFTR gene that is represented, and a DNA sequence will appear below. Your exon is represented by capital letters in the sequence. 3. Collect the materials you will need to make your exon from your teacher. You will need a roll of paper and five different colors of sticky notes. 4. Consult the key for DNA that your teacher made. Roll out a length of paper and begin to construct your exon. Start at least six bases before the exon starts and continue at least six bases after it ends. Be sure to mark the start and end points of your exon on the paper roll. 5. It s now time to transcribe your exon. Roll out another piece of paper and mark it mrna. Transcribe your DNA by making a complementary strand of mrna with this

8 length of paper. Remember, in mrna, A pairs with U (uracil), T pairs with A, and G pairs with C. Your mrna starts at the start point of your exon and ends at the end point. 6. Now you have messenger RNA! The code of your mrna will be translated into a string of amino acids that will become the CFTR protein by a ribosome, which is an organelle in the cell. 7. Use the Amino Acid Wheel below or the Amino Acid Chart on the next page to create your part of the CFTR protein. If you are using the wheel, start in the center and work outward (for example, AAG codes for Lysine). Amino Acid Wheel

9 Amino Acid Chart 1 st 2 nd 3 rd U C A G U C A G UUU UCU UAU UGU U Phenylalanine Tyrosine Cysteine UUC UCC UAC UGC C Serine UUA UCA UAA UGA STOP A Leucine STOP UUG UCG UAG UGG Trytophane G CUU CCU CAU CGU U Histidine CUC CCC CAC CGC C Leucine Proline Arginine CUA CCA CAA CGA A Glutamine CUG CCG CAG CGG G AUU ACU AAU AGU U Asparagine Serine AUC Isoleucine ACC AAC AGC C AUA ACA Threonine AAA AUG Start Methionine AGA Lysine Arginine ACG AAG AGG G GUU GCU GAU Aspartic GGU U GUC GCC GAC Acid GGC C Valine Alanine Glycine GUA GCA GAA Glutamic GGA A GUG GCG GAG Acid GGG G A 8. As you identify each amino acid, cut out a paper version of it from Reproducible Master 7, Amino Acids and attach it to a piece of yarn using tape or a stapler. Make a chain of your amino acids. 9. Join your amino acid chain with the chains of other teams in the class (in the proper order, of course!). 1. What would happen to your amino acid chain if only one base was substituted? Does a substitution always lead to an incorrect amino acid? 2. What would happen to your amino acid chain if a few base pairs were deleted? How do you think that might affect the protein?

10 Phenylalanine Serine Tyrosine Cysteine Leucine Trytophane Leucine Proline Histidine Arginine Glutamine Isoleucine Threonine Asparagine Serine Lysine Arginine Methionine Valine Alanine Aspartic Acid Glycine Phenylalanine Serine Tyrosine Cysteine Leucine Trytophane Leucine Proline Histidine Arginine Glutamine Isoleucine Threonine Asparagine Serine Lysine Arginine Methionine Valine Alanine Aspartic Acid Glycine Phenylalanine Serine Tyrosine Cysteine Leucine Trytophane Leucine Proline Histidine Arginine Glutamine Isoleucine Threonine Asparagine Serine Lysine Arginine Methionine Valine Alanine Aspartic Acid Glycine

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations By Beatriz Gonzalez beatriz.gonzalez@sfcollege.edu Associate Professor, Santa Fe College, Gainesville, Florida In this exercise,

More information

The Structure and Function of DNA

The Structure and Function of DNA Chapter 0 The Structure and Function of PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

Transcription and Translation. Chapter Ten

Transcription and Translation. Chapter Ten Transcription and Translation Chapter Ten Central Dogma DNA Transcription RNA Translation Protein Definitions Transcription To copy down, within the same language Language = Nucleic Acids DNA to RNA Translation

More information

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene.

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene. Biology 12 DNA Functions Practice Exam - KEY A. DNA Structure 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Chapter 1: Bio Primer

Chapter 1: Bio Primer Chapter 1: Bio Primer 1.1 Cell Structure; DNA; RNA; transcription; translation; proteins Prof. Yechiam Yemini (YY) Computer Science Department Columbia University COMS 4761 --2007 Overview Cell structure

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill. [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Email: kurkjiancj@gmail.com Twitter: @Cate_Kurkjian Image from: http://icsjournal.org/2015/03/02/dna-building-blocks-of-nanotechnology/

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Gene Translation:RNA -> Protein

Gene Translation:RNA -> Protein Gene Translation:RN -> Protein How does a particular sequence of nucleotides specify a particular sequence of amino acids? The answer: by means of transfer RN molecules, each specific for one amino acid

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. NAME: PERIOD: From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 i This activity will help

More information

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 1 This activity will help you to learn

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2010 1 In this activity you will learn how

More information

7.012 Practice Quiz

7.012 Practice Quiz MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel 7.012 Practice Quiz 2 2004 Actual Quiz 2 (closed book)

More information

Cambridge International Examinations Cambridge International Advanced Level

Cambridge International Examinations Cambridge International Advanced Level Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is.

1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is. 1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is. 3) Translation is terminated when the ribosome encounters. 4) Nucleic acid chains are synthesized in the to direction.

More information

Unit 8 DNA Structure, Replication, and Protein Synthesis

Unit 8 DNA Structure, Replication, and Protein Synthesis Unit 8 DNA Structure, Replication, and Protein Synthesis Objective 3.01 Analyze the molecular basis of heredity including DNA replication, protein synthesis, and gene regulation 1. Which series is arranged

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information

Biology DNA Protein Synthesis and Fingerprinting. Spring 2009

Biology DNA Protein Synthesis and Fingerprinting. Spring 2009 Biology DNA Protein Synthesis and Fingerprinting Spring 2009 Chains of amino acids 20 named types Create/build structure within organisms Function as important biochemicals Ex: hair, skin, tissues in organs,

More information

Review of Central Dogma; Simple Mendelian Inheritance

Review of Central Dogma; Simple Mendelian Inheritance . Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 (not for credit): Problems 1-18 test your knowledge of the central dogma. The remaining problems are related

More information

Prep Time: 1 hour. Class Time: 45 minutes

Prep Time: 1 hour. Class Time: 45 minutes ACTIVITY OVERVIEW Abstract: Students use edible models of the DNA molecule to transcribe an mrna sequence, then translate it into a protein. Module: The Basics and Beyond Prior Knowledge Needed: A basic

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

Introduction to Molecular Genetics

Introduction to Molecular Genetics Introduction to Molecular Genetics I. Introduction: A. ave you thought much about why you are like your parents, and your kids are (will be) like you? 1. Inherited traits result from the transfer of specific

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

RNA and Protein Synthesis Biology Mr. Hines

RNA and Protein Synthesis Biology Mr. Hines RNA and Protein Synthesis 12.3 Biology Mr. Hines Now we know how DNA (genes) are copied. But how is it used to make a living organism? Most of the structures inside of a cell are made of protein - so we

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

DNA Proccesses. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

DNA Proccesses. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: DNA Proccesses Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Mutations within a DNA sequence are a. natural processes that produce

More information

Solution Key Problem Set

Solution Key Problem Set Solution Key- 7.013 Problem Set 3-2013 Question 1 You are analyzing the following human pedigree for a disease. Please note: The filled squares or circles represent the abnormal phenotype. The disease

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

(DNA) 2 = = RNA - DNA

(DNA) 2 = = RNA - DNA Genetics and Cellular Function Genes and nucleic acids Protein synthesis and secretion DNA replication and the cell cycle Chromosomes and heredity Organization of the Chromatin Threadlike chromatin = chromosomes

More information

Supplemental Material CBE Life Sciences Education. et al.

Supplemental Material CBE Life Sciences Education. et al. Supplemental Material CBE Life Sciences Education SSS Couch SSSSS et al. Supplemental Material 1. The Molecular Biology Capstone Assessment (MBCA) The number to the left of each T/F statement represents

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Figure During transcription, RNA nucleotides base-pair one by one with DNA

Figure During transcription, RNA nucleotides base-pair one by one with DNA Objectives Describe the process of DNA transcription. Explain how an RNA message is edited. Describe how RNA is translated to a protein. Summarize protein synthesis. Key Terms messenger RNA (mrna) RNA

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE SEAC ML ENGMAN, MD Vice President and Chief Medical Director BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE UNDERWRITING SLEEP

More information

Biology Genes

Biology Genes Slide 1 / 111 Slide 2 / 111 Biology Genes www.njctl.org Slide 3 / 111 Vocabulary Click on each word below to go to the definition. P site 3' end polymerase chain reaction 5' end parent strand A site promoter

More information

Genes DNA Replication

Genes DNA Replication Genes DNA Replication Classwork 1. Explain why it is necessary to be able to replicate DNA in order to sustain life. 2. What is the appropriate scientific term used to describe a series of bases that code

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Worksheet: Mutations Practice

Worksheet: Mutations Practice Worksheet: Mutations Practice There are three ways that DNA can be altered when a mutation (change in DNA sequence) occurs. 1. Substitution one base-pairs is replaced by another: Example: G to C or A to

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

Biology 3 Transcription, Translation, and Mutations

Biology 3 Transcription, Translation, and Mutations Biology 3 Transcription, Translation, and Mutations Dr. Terence Lee Overview 1. DNA and RNA structure 2. DNA replication 3. Transcription makes RNA 4. Translation makes protein James Watson, Francis Crick,

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

Global aspects in the algebraic approach to the genetic code

Global aspects in the algebraic approach to the genetic code PHYSICAL REVIEW E VOLUME 56, NUMBER 6 DECEMBER 1997 Global aspects in the algebraic approach to the genetic code Michael Forger Departamento de Matemática Aplicada, Instituto de Matemática e Estatística,

More information

Protein Synthesis. Contents. Introduction. DNA Transcription

Protein Synthesis. Contents. Introduction. DNA Transcription Protein Synthesis Contents Introduction... 1 DNA Transcription... 1 The Primary Transcript... 4 Translation... 7 Protein Structure... 11 References... 11 Resources... 11 Introduction The genetic message

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis

Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis Biology - Student Reader & Workbook Unit 3, Chapter 4: Molecular Genetics - DNA Structure and Protein Synthesis UNIT 3, CHAPTER 4: MOLECULAR GENETICS: DNA STRUCTURE AND... 3 PROTEIN SYNTHESIS... 3 LESSON

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

16 Protein Synthesis: Transcription and Translation

16 Protein Synthesis: Transcription and Translation 16 Protein Synthesis: Transcription and Translation Ge n e s c a r r y t h e information that, along with environmental factors, determines an organism s traits. How does this work? Although the complete

More information

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928 Name: Period: Date: = passing on of characteristics from parents to offspring How?...! I. DNA, Chromosomes, Chromatin, and Genes = blueprint of life (has the instructions for making an organism) = uncoiled

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information