Next-Generation Sequencing Strategies Enable Routine. Detection of Balanced Chromosome Rearrangements. for Clinical Diagnostics and Genetic Research

Transcription

1 Supplemental Data American Journal of Human Genetics, Volume 88 Next-Generation Sequencing Strategies Enable Routine Detection of Balanced Chromosome Rearrangements for Clinical Diagnostics and Genetic Research Michael E. Talkowski, Carl Ernst, Adrian Heilbut, Colby Chiang, Carrie Hanscom, Amelia Lindgren, Andrew Kirby, Shangtao Liu, Bhavana Muddukrishna, Toshiro K. Ohsumi, Yiping Shen, Mark Borowsky, Mark J. Daly, Cynthia C. Morton, and James F. Gusella

2 Table S1. Captured regions and alignment statistics Subject Region Chr Length (bp) Mean Coverage Repeat Masked Mean Coverage Unmasked % masked % Masked Aligned % Unmasked Aligned % No Coverage (Masked) % No Coverage (Unmasked) Subject % 83.6% 96.3% 12.2% 3.7% Subject % 88.5% 93.2% 10.6% 6.8% Subject % 9.3% 3.9% 90.7% 96.1% Subject % 94.5% 100.0% 2.8% 0.0% Subject % 91.3% 99.1% 7.2% 0.6% Subject % 73.3% 84.1% 20.4% 15.9% Subject % 94.5% 100.0% 3.3% 0.0% Subject % 97.0% 99.7% 2.4% 0.3% Subject % 91.0% 99.8% 4.8% 0.2% Subject % 93.6% 98.6% 2.7% 1.4% Subject % 94.9% 98.9% 3.7% 1.1% Results for capture and alignment performance for each region provided. As discussed, the majority of bases within the chr 5 region of Subject 8 could not be uniquely aligned. Capture statistics were calculated from all other regions. Masked refers to regions designated as repetitive by RepeatMasker. Overall, 40.4% of reads mapped to the targeted regions (2,528,280 total bases captured), with an average read depth of 42 reads per base within the targeted regions and reads per base in non-targeted regions. Our analysis suggests 90.7% of repeat-masked bases in targeted regions were theoretically mappable by 75 bp reads, roughly corresponding to our estimated genome-wide mappability rate of 90.3%.

3 Figure S1. Sequencing results for Subject 3 shows five reads supporting an inversion of chromosome 5 (46,XX,inv(5)(p14.2q14.3)) derived from a single lane of Illumina GAIIx sequencing using the Illumina mate-pair protocol (Illumina, Inc). By contrast, a translocation between chromosomes 3 and 18 was easily delineated from thirty-two supporting reads using our EcoP15I custom barcoded jumping libraries.

4 Figure S2. Despite the low breakpoint coverage, PCR and FISH analysis of Subject 3 confirms the presence of a pericentric inversion of chromosome 5 with breakpoints localized to 5p14.2 and 5q14.3.

5

6

7

8

9

10

11 Figure S3. Capture performance of each subject shown in the UCSC browser. The Y-axis read depth is set at 10X, not the actual read depth for a given base (average depth per base was 42x). Subject number and region is shown to the left of the Y-axis. CRG 75 bp alignability data and UCSC Repeat- Masker track is shown below the alignability data. Targeted Capture Library Protocols Samples were processed using the NEBNext DNA Sample Prep Master Mix Set 1 (New England Biolabs, Inc.) sample preparation kits described above, custom PCR primers for Solexa technology described previously 9, and Illumina adapter oligos following the Illumina standard paired-end library formation procedures described above with the exception of additional PCR steps prior to and following each hybridization step, per manufacturer s instructions (Agilent Technologies, Inc.). Chips were processed according to manufacturer s instructions using commercially supplied reagents. To increase specificity based on previous studies 11, we included 50 ul of C o T1 (Invitrogen, Inc.), 50 ul blocking buffer, and 5 ul each of sense and antisense blocking oligos to Illumina specific adaptors (200 um). Eluate from the initial hybridization was extracted, concentrated to 50 ul, and eight 18 cycle PCR reactions were performed using 5 ul aliquots of DNA. Purified DNA was then re-applied to the chip for a second hybridization, a technique previously found to increase sensitivity and specificity of the experiment 5, followed by another round of PCR. Approximately 5% of each captured library was cloned using a pcr-blunt II-TOPO vector. DNA was extracted for colonies and Sanger sequenced to determined capture specificity (Zero Blunt TOPO PCR Cloning Kit, Invitrogen, Inc.).

12 Jumping Library Protocol and Reagent List Hydroshear R from Genomic Solutions Cat# X Low TE buffer Qiaquick PCR purification kit from Qiagen Cat# MinElute reaction clean up kit from Qiagen Cat# Qiaquick R gel purificaiton kit from Qiagen Cat# Agilent lab chip kit from Agilent Cat# End-It TM DNA End-Repair Kit Epicentre Cat# ER0720 Cap adaptor oligos(hplc purified): 5 Phos/ACAGCAG 3 3 ACTGTCTGC/Phos 5 Quick Ligation kit from NEB Cat#: M2200s Nuclease-free water from Ambion Cat#: AM9930 Seakem LE Agarose from Lonza Cat# kb ladder from NEB Cat#3272S SYBR Gold nucleic acid gel stain from Invitrogen Cat# S11494 Internal adaptor oligos (HPLC purified); T*=biotin labeled position 5 Phos/CGTACAT*CCGCCTTGGCCGT 3 3 TGGCATGTAGGCGGAACCGG/Phos 5 ATP (25mM) 10X Plasmid-safe buffer Plasmid-safe DNase (10U/ul) 100X BSA from NEB Cat# B9001S EcoP15I, 10U/ul from NEB Cat# R0646L Sinefungin from Sigma Cat# S8559 Buffer 3 from NEB Cat# Klenow DNA polymerase from NEB Cat# M0210S Tris-HCl 500mM NaCl 5M EDTA 500mM Triton X-100 Tween 20 Streptavidin Myone C1Beads from Invitrogen Cat# D

13 NEBNext da-tailing Module: NEB (Cat# E6053s) 2X Phusion mastermix NuSieve 3:1 Agarose from Lonza Cat# TrackIt 25bp ladder from Invitrogen Cat# Methods based on Applied Biosystems Mate-Pair library formation method (Applied Biosystems, Inc.), with modifications listed. 1. Fragment genomic DNA by Hydroshear or Covaris Equipment and Reagents: 1X Low TE buffer Qiaquick PCR purification kit from Qiagen MinElute reaction clean up kit from Qiagen Agilent labchip kit from Agilent Process: Shear ug of genomic DNA (gdna) diluted with 1X low TE to desired fragments (~ kb in this study) according to manufacturer s instructions on the Hydroshear or Covaris (Covaris used in these studies). Collect the sheared gdna sample and perform Qiagen cleanup following the manufacturer s manual, elute with total 203ul EB buffer. Perform QC with an Agilent Bioanalyzer. 2. End Repair Reagents: End-It TM DNA End-Repair Kit Epicentre MinElute reaction clean up kit from Qiagen a) Combine and mix the following components in a microcentrifuge tube: Component Volume(ul) Sheared DNA X End-It Buffer 30 End-It ATP(10mM) 30

14 End-It dntps(2.5mm) 30 End-It Enzyme Mix 10 Total 300 Set up 50ul reaction per 5ug DNA material (protocol here assuming 30ug gdna starting material) b) Incubate the mixture at room temperature for 30 mins. c) Clean up the reaction with Qiagen kit and elute with100ul EB buffer. d) Quantify the DNA with Pico assay or Nanodrop. 3. EcoP15I Cap adaptors ligation Reagents: Cap adaptor oligos( from IDT, HPLC purified:50um): 5 Phos/CTGCTGT AC 3 3 GACGACA/Phos 5 Quick Ligation kit from NEB Nuclease-free water from Ambion MinElute reaction clean up kit from Qiagen a) Combine and mix the following components in a microcentrifuge tube: Component Volume(ul) Cap adaptor(ds) 50uM Y 2X Quick Ligase Buffer 150 Quick Ligase 7.5 DNA 100 Nuclease free H 2 O Variable Total 300 Keep the fragment to cap adaptor molecule ratio 1:100. Xpmol DNA= (ug DNA)*10^6/660 / average fragment length(bp) Y(ul )adapter needed= 100*X/50

15 b) Incubate the mixture at room temperature for 10mins. c) Clean up the reaction with Qiagen kit and elute with102ul EB buffer. 4. Gel-size Selection Reagents: Seakem LE Agarose from Lonza Qiaquick gel purificaiton kit from Qiagen 1kb ladder from NEB SYBR Gold nucleic acid gel stain from Invitrogen a) Prepare a 0.8% agarose gel in 1XTAE buffer b) Load all materials from step 3. Use multiple lanes if necessary. Include a lane with 1 kb or 1 kb Plus ladder. c) Run the gel at 120v until the yellow dye in the marker is close to the bottom of the gel. d) Stain the gel with SYBR for 30mins. e) Excise the desired insert size range of the gel with a clean razor blade. f) Process gel purification following the manufacturer s instructions (dissolve the gel piece in QG buffer at room temperature). g) Quantify Pico Green and Agilent Bioanalyzer assay. 5. DNA Circularization and DNase Treatment Reagents: Internal adaptor oligos (from IDT, HPLC purified: 2uM) Positions in fuschia can be used for index sequence T*=biotin labeled position 5 Phos/CGTACAT*CCGCCTTGGCC GT 3 3 TGGCATGTAGGCGGAACCGG/Phos 5 T*=biotin labeled position Quick Ligation kit from NEB Nuclease-free Water from Ambion MinElute reaction clean up kit from Qiagen Dilute of ligation reaction to achieve intra-molecular ligation J=63.4/ (DNA size in kb) 1/2 I= (J/0.95 J) =ug/ml for dilution of ligation reaction

16 I is the desired final [DNA] in the circularization reaction in a) below: a) Combine and mix the following components in a micro centrifuge tube: Component Volume(ul) Internal adaptor(ds) 2uM X 2X Quick Ligase Buffer 250 Quick Ligase 12.5 DNA variable Total (use Nuclease-free H 2 O) 500 Keep the fragment to internal adaptor molecule ratio 1:3; Circularize all material from last step, set up more reactions as necessary and keep the DNA dilution of ligation reaction. X(ul)=1.5*10^6*(DNA-ug)/660/fragment length. b) Incubate the mixture at room temperature for 10mins. c) Clean up the reaction with Qiagen kit and elute with 60ul EB buffer total. d) Combine and mix the following components: Component Volume(ul) ATP (25mM) 5 10X Plasmid-safe buffer 10 Plasmid-safe DNase (10U/ul) Y DNA 60 Nuclease-free H 2 O Variable Total 100 1ul DNase enzyme will be needed per 3ug DNA material. e) Incubate the reaction at 37 0 C for 40mins. f) Clean up the reaction with Qiagen kit and elute in 30ul EB buffer. 6. Digest the circularized DNA with EcoP15I and End repair Reagents: 100X BSA from NEB EcoP15I kit, 10U/ul from NEB

17 Sinefungin from Sigma Klenow DNA polymerase from NEB a) Combine and mix the following components b) Incubate at 37 o C overnight (16 hour minimum). c) Add 1ul of 10mM Sinefungin, 2ul of 10XATP and 0.5ul of EcoP15I to the 100ul reaction (103.5ul total). d) Incubate the reaction mixture at 37 o C for 1 hour. e) Denature the enzyme at 65 o C for 20mins and chill on ice for 5 mins. f) Perform end repair in the same tube to conserve sample. Add 1.5ul of dntp mix (25mM each) and 1ul Klenow large fragment to the 103.5ul reaction (106ul total). g) Incubate the reaction at room temperature for 30mins. h) Denature the enzyme at 65 o C for 20 mins and chill on ice for 5 mins. i) Add 200ul 2X streptavidin binding buffer and 94ul nuclease free H 2 O to the reaction (400ul total). Component Volume(ul) Circularized DNA 30 10X Buffer XBSA 10 Sinefungin(10mM) 1 10X ATP(25mM) 20 EcoP15I (10U/ul) X Nuclease-free H 2 O variable Total ul to 5ul EcoP15I enzyme needed per ug DNA (2-6kb). 7. Bind the library molecules to Streptavidin beads Reagents: Tris-HCl 500mM NaCl 5M EDTA 500mM Triton X-100 Tween 20 Streptavidin Myone C1 Beads from Invitrogen a) Prepare the 2X streptavidin bead binding buffer

18 Components Volume(ul) Tris-HCl 500mM PH= NaCl 5M 200 EDTA 500mM 1 Nuclease free H 2 O 289 Total 500 b) Prepare 1X BSA solution Component Volume(ul) 100X BSA 5 Nuclease free H 2 O 495 Total 500 c) Prepare 1X Bead Wash buffer Components Volume(ul) Triton X Tween EDTA 500mM 20 Nuclease free H 2 O 940 Total 1000 d) Vortex the bottle of Dynal MyOne C1 streptavidin beads and transfer 90ul into a lowbind tube. e) Add 500ul 1X bead wash buffer and vortex for 15 seconds, then pulse-spin. f) Place the tube in a magnetic rack for at least 1min. After the solution clears, discard the supernatant. g) Add 500ul of 1XBSA and vortex for 15 seconds, then pulse-spin. h) Place the tube in a magnetic rack for at least 1 min. After the solution clears, discard the supernatant. i) Add 500ul 1X bead binding buffer and vortex for 15 seconds, then pulse-spin/ j) Place the tube in a magnetic rack for at least 1 min. After the solution clears, discard the supernatant k) Add the entire 400ul solution of library molecules in Streptavdin bead binding buffer to the pre-washed beads and vortex.

19 l) Mix by rotation at room temperature for 30 mins to 1 hour, then pulse-spin. m) Place the tube in a magnetic rack for at least 1 min. After the solution clears, discard the supernatant. n) Resuspend the beads in 500ul of 1XBead Wash buffer and vortex for 15 seconds, then pulse-spin. o) Place the tube in a magnetic rack for at least 1min. After the solution clears, discard the supernatant. p) Resuspend the beads in 500ul of 1X bead wash buffer and transfer beads to a new Lowbind tube. Vortex for 15 seconds, then pulse-spin. q) Place the tube in a magnetic rack for at least 1min. After the solution clears, discard the supernatant. r) Resuspend the beads in 500ul of 1X da tailing reaction buffer and transfer beads to a new Lowbind tube. Vortex for 15 seconds, then pulse-spin. s) Place the tube in a magnetic rack for at least 1min. After the solution clears, discard the supernatant. t) Set up da tailing reaction immediately as follows. 8. da tailing, Illumina adaptor ligation and PCR enrichment Reagents: NEBNext da-tailing Module Quick Ligation kit: NEB Adapter: ligate Illumina PE adapters or custom designed adapters from Bentley et al., 2008 (Bentley et al., Nature, 2008 Nov 6; 456(7218):53-9. PMID: Component Volume (ul) DNA On beads 10X reaction buffer 5ul Klenow (exo - ) 3ul H 2 O 42ul Total 50ul Incubate the reaction on rotator at 37 o C for 30mins. Clean up the reaction following steps m) to t) of section 7 above with the following modifications: Step r): 500ul 1X Quick ligation buffer instead of 1X da tailing buffer; Step t): set up adaptor ligation instead of da tailing Adapter ligation Component Volume (ul)

20 DNA On beads 2X ligation buffer 25ul Quick ligase 2.5ul Adapters(15uM) 10ul H2O 12.5ul Total 50ul Incubate the reaction on rotator at room temperature for 10mins. Clean up the reaction following steps m) to t) of part 7 above with these modifications. Step r): 500ul EB buffer instead of 1X Quick ligase buffer. Step t): Resuspend the beads in 30ul EB buffer PCR enrich library molecules Component Volume (ul) DNA 10ul Primer 1 1ul Primer 2 1ul 2X Phusion mastermix 25ul H2O 13ul Total 50ul Amplify all 30ul DNA material to get high complexity library with fewer PCR cycles. Usually 8 to 12 cycles is enough to get PCR product dependent on starting material and how much loss during the whole process. PCR Program (98 o C 30s; 98 o C 10s, 65 o C 30s, 72 o C 30s; repeat 8 to 12 cycles; 72 o C 5min; 10 o C hold) Purify the PCR product with MinElute column: a) Pool all of PCR reactions into 1.5ml Lowbind tube. b) Place the tube of beads in a magnetic rack and transfer the supernatant to a fresh tube. c) Perform the clean up following the manufacturer s manual. d) Elute the DNA with 30ul EB.

21 9. Gel purify the final library and QC Reagents: NuSieve 3:1 Agarose from Lonza Qiaquick gel purificaiton kit from Qiagen TrackIt 25bp ladder from Invitrogen SYBR Gold nucleic acid gel stain from Invitrogen a) Prepare a 2% agarose gel in 1XTAE buffer b) Load 25bp ladder to the left well, skip a well, and load all materials from last step evenly among one or multiple wells. c) Run the gel at 90V until the yellow dye in the marker is close to the bottom of the gel. d) Stain the gel with SYBR Gold for 30mins. e) Exercise the ~200 bp band with a clean razor blade. f) Process gel purification following the manufacturer s manual. g) QC the final library molecules with Pico/Bioanalyzer/qPCR.