Catherine Technical Product Specialist

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Catherine Technical Product Specialist"

Transcription

1 量 PCR 理 Catherine Technical Product Specialist

2 Traditional Quantitative System StepOne Real-Time PCR System Northern Blots Analysis Competitive PCR RT-PCR followed by South blots Disadvantages Labor intensive, many manual steps Semi-quantitative Low Resolution Limited dynamic Low throughput 2 Date AB CONFIDENTIAL

3 量 PCR 量 (GMO) 量 量 : HBV, HCV,HPV Quantifier Detection mirna -- SNP 聯 3 Date AB CONFIDENTIAL

4 Real-time PCR is sequence detection in a closed-tube Y=X(1+e) n Log [DNA] Plateau lens cap PCR vessel thermal block Geometric Y=X2 n Cycle # sample 4 Date AB CONFIDENTIAL

5 Amplification plot features 0.90 Normalised reporter fluorescence (R n ) Threshold Baseline region Sample No Template control Lower expression level C T PCR cycle number Geometric Phase 5 Date AB CONFIDENTIAL Y= N0 2 n, CT 度 數

6 High StepOne ThroughPut Real-Time PCR System Nucleotide Quantitation System -2 PCR 96 PCR Amplification Curves 量 Pipette Samples StepOne / 7300 / 7500 / 7500fast / 7900 fluorescent signal Read Results real-time PCR amplification 10,000 20,000 PCR cycles Standard curve Relative quantitation 6 Date AB CONFIDENTIAL

7 ABI Real Time PCR StepOne Real-Time PCR System Total Solutions for you! ABI TaqMan Chemistry & Real-Time PCR 理論 ABI 量 & Ct 念 ABI 量 PCR efficiency 100% Genomic Assays for SNP & Gene Expression HUMAN and MOUSE 來 High Throughput Multi Channels Speed ABI 7700 ABI 7900HT 量 PCR ABI Date AB CONFIDENTIAL 2000 理量 ABI ABI 7500 StepOne

8 易 8 Date AB CONFIDENTIAL

9 Basic Operation Soft power button on the LCD touchscreen 9 Date AB CONFIDENTIAL

10 The StepOne Real-Time PCR System Introduction 48 well 0.1 ml tube Single LED excitation 3 color System (FAM / SYBR Green, VIC /JOE, ROX dyes) Fast and Standard ramping in the same block (1-100%) Standalone or co-located Remote monitoring, LAN 10 Date AB CONFIDENTIAL

11 StepOne Real-Time PCR System: The Basics One block, Two speeds Fast cycling: 40 cycles in under 40 minutes Standard cycling: 40 cycles in under 2 hours 48-wells 10-30µl reaction volume 4 11 Date AB CONFIDENTIAL

12 StepOne Real-Time PCR System: The Basics Supported consumables: 48-well plates with optical adhesive cover 48-well plates with caps Fast tubes Fast 8-tube strips 12 Date AB CONFIDENTIAL

13 Networkability: Remote Monitoring, Notification or LAN 13 Date AB CONFIDENTIAL

14 Summary 路 便 : 48 well plate or Single tube - 精 PCR : Peltier technology 兩 Sample ramp rate --- 不 更 Block - Standard mode 40 cycles 2hr - Fast mode 40 cycles 40min 14 Date AB CONFIDENTIAL

15 Chemistry Comparison TaqMan Probe SYBR Green 1 Dye Specificity Flexibility Optimization 15 Date AB CONFIDENTIAL Primer binding Probe hybridization PCR conditions Multiple Targets per tube SNP Detection +/- Application Universal guidelines Primer binding - PCR conditions Universal guidelines Check Primer dimer formation

16 Fluorogenic 5' Nuclease Assay R 5 3 Q Forward Primer R FRET Q 5 5 *FRET= Fluorescence Resonance Energy Transfer Reverse Primer Date AB CONFIDENTIAL

17 Fluorogenic 5' Nuclease Assay Displacement during Polymerization 5 3 Forward Primer R Q 5 5 R Reverse Primer 3 5 Cleavage Q Date AB CONFIDENTIAL

18 PCR Reaction Monitored in Real-Time Generating Amplification Curves Fluorescent signal is proportional to the amount of PCR product amplifying in the tube. 18 Date AB CONFIDENTIAL

19 next-generation chemistry: TaqMan MGB Probes R AGGCCTTGAGAGATAT (non-fluorescent quencher) NFQ Q Q MGB (minor groove binder) R AGGCCTTGAGAGATAT Q GCTACACAGTCCGGAACTCTCTATAGCATCACAC All probes will be short (13-20-mers) 19 Date AB CONFIDENTIAL High resolution, Low Background

20 TaqMan StepOne Real-Time chemistry PCR System Noiseless data due to the second level of specificity provided by the probe Multiplex compatible 行兩 量 each probe can be differently coloured and thereby mixed with others Signal proportional to product 度 signal related to amount of amplified product (not mass/length) Optimized assays available Assays on Demond (AoD), Assays by Design (AbD), PDAR 20 Date AB CONFIDENTIAL

21 Signal Generation with SYBR Green 1 dye SYBR Green 1 dye binds to the minor groove of ds DNA Detects specific and unspecific products 21 Date AB CONFIDENTIAL

22 SYBR Green I Dye Double Stranded DNA: Dye will fluoresce when bound to minor grove Denaturation: No Signal Chemistry reports the accumulation of dsdna in PCR Need to verify target specific amplification by other means 22 Date AB CONFIDENTIAL

23 Specificity check SYBR Green 1 dye How? When? Gel or Real-Time PCR System Post PCR Analysis add Melting Curve stage 178bp T m =77ºC Gel electrophoresis to determine PCR product size Melt Analysis to determine PCR product Tm (performed on the Real-Time PCR instrument). 23 Date AB CONFIDENTIAL

24 SYBR StepOne Green Real-Time PCR I System Chemistry 省 Probe 理 Primer Dimer PCR 離 multiplex PCR Compatible with dissociation curve analysis 利 dissociation curve assay PCR 24 Date AB CONFIDENTIAL

25 _master mix StepOne Real-Time PCR System All Chemlink Hot start (5~ 15 min) Carry over protection, UNG Real Master Mix, all in one 4 0 C, ROX ROX normalize 25 Date AB CONFIDENTIAL

26 All in One Features 量 Absolute Quantification - Standard curve 量 Realtive Quantification Ct study 量 Realtive Quantification - Relative standard curve Melting Curve Analysis SNP Genotyping Assay Presence/Absence 26 Date AB CONFIDENTIAL

27 量 ( Absolute Quantitation) - 量 - StepOne Real-Time PCR System The well contains 400 target copies Y= mx+b Ct s Ct values 27 Date AB CONFIDENTIAL Log copy number

28 量 Relative Quantification Analysis Methods Standard Curve Gene A Gene B Heart Liver Lung Brain Date AB CONFIDENTIAL Comparative C t 2 - ( Ct) Relative Quantity of Expression t = 0 t = 1 h t = 6 h t = 24 h

29 Relative Quantitation theory 量 the C T a measure of the ratio of one target to another 29 Date AB CONFIDENTIAL

30 C T is a constant value more total RNA less total RNA relative fluorescence B A threshold B A threshold C T =5 cycle number C T =5 When the PCR efficiency of both systems is the same the C T remains constant 30 Date AB CONFIDENTIAL

31 Converting C T into a ratio A (target gene) / B (endogenous gene) = 2 C T e.g. if the C T between mrna species A & B = 5 cycles (i.e. it took 5 more cycles to see amplification of A) then there is: 2 5 = 1 / 2 5 = 1 / 32 as much A as B 31 Date AB CONFIDENTIAL

32 Ct Definition Ct = Ct (Unknown) - Ct (Control) Xrel = (1+E) - Ct If Efficiency = ~100 %, Relative Quantity = 2 - Ct 32 Date AB CONFIDENTIAL

33 Relative Quantification Calibrator The sample used as the basis for comparative results t =0 t=12 t=24 t=48 time Convert purified total RNA to cdna [GOI] [GOI] [GOI] [GOI] [ENDO] [ENDO] [ENDO] [ENDO] Control for sample variability 33 Date AB CONFIDENTIAL

34 C t Calculations (Comparative C t ) IL-2 18S DC t DDC t 2 -DDCt T=0 (calibrator) T=12hr T=24hr T=48hr Relative Quantity of Expression t = 0 t = 1 h t = 6 h t = 24 h 0 34 Date AB CONFIDENTIAL

35 The Application of SNP Genotyping on Real Time PCR System

36 Genotyping competing probes discriminating alleles and single nucleotide polymorphisms Allele A Allele B FAM Q VIC Q VIC Q FAM Q Mismatch Mismatch FAM = homozygous allele A VIC = homozygous allele B FAM & VIC = heterozygous (A & B) 36 Date AB CONFIDENTIAL

37 Delta Tm ( T m ) or Mismatch Probe Stabilization MGB T m =65 T m =49 ( Tm = 17 C) 70 C 65 C 60 C 55 C 50 C T m = T m of perfectly matched probe - T m of mismatched Discrimination of alleles is achieved by using an annealing/ extension temperature within the T m window 37 Date AB CONFIDENTIAL

38 allelic discrimination (SNP) data StepOne Real-Time PCR System Homozygous Allele 2 (FAM colour signal) Heterozygotes (FAM + VIC signal) NTC s (no template controls) Homozygous Allele 1 (VIC colour signal) 38 Date AB CONFIDENTIAL

39 StepOne Software Introduction

40 All in One Features 量 Absolute Quantification - Standard curve 量 Realtive Quantification Ct study 量 Realtive Quantification - Relative standard curve Melting Curve Analysis SNP Genotyping Assay Presence/Absence 40 Date AB CONFIDENTIAL

41 Software Wizard 41 Date AB CONFIDENTIAL

42 Automatic StepOne Real-Time PCR plate Systemlayout in the Design wizard Real Time PCR 42 Date AB CONFIDENTIAL

43 Run Module 易 43 Date AB CONFIDENTIAL

44 Reaction Protocol Setup 44 Date AB CONFIDENTIAL

45 Additional New Features in the Software Absolute & Relative Standard Curve Relative Quantification can read Absolute Quantification Data 不 45 Date AB CONFIDENTIAL

46 Genotyping Assay ( Real-Time data collected in the same file as pre- and post-read) Amplification plot 易 troubleshooting 46 Date AB CONFIDENTIAL

47 Result: Export to Excel, PowerPoint, or save as JPEG 47 Date AB CONFIDENTIAL

48 48 Date AB CONFIDENTIAL

49 StepOne 不 精靈 易 - reaction condition setup 不 data 都 不 failed export to Excel, Power Point JPEG Remote Monitoring, Notification data 49 Date AB CONFIDENTIAL

50 Can the StepOne System be used as a conventional thermal cycler? You can create a thermal cycler protocol on the touchscreen and use the StepOne System as a thermal cycler. 50 Date AB CONFIDENTIAL

51 Performance specifications customers have come to expect with AB instruments - High Precision : 2- fold discrimination with 99.7% confidence - High Sensitivity : 10 copies per 30 ul - Broad Dynamic Range : 9 logs - Dual Reporter and Single Reporter Uniformity 51 Date AB CONFIDENTIAL

52 RNAse P Instrument Verification Plate 5K population SD= K population SD= Date AB CONFIDENTIAL

53 9-Log Dynamic Range Dilution series of gdna using 18S TaqMan probes and primers 53 Date AB CONFIDENTIAL

54 Dual Reporter in Fast Mode 18S SD=0.088 TGFβ SD=0.080 Multiplexed 18S VIC-labeled and TGFβ FAM-labeled TaqMan probes and primers 54 Date AB CONFIDENTIAL

55 Summary!! 便 : 48 well plate or Single tube - 精 PCR : Peltier technology - No Gradient!! 度 兩 Sample ramp rate --- 不 更 Block - Standard mode 40 cycles 2hr - Fast mode 40 cycles 40min data - (download data monitor experiment process) 了 Real-Time PCR PCR 55 Date AB CONFIDENTIAL

56 Applied StepOne Real-Time Biosystems PCR SystemIntegrated Solution on Genomic Assays Assay Development TaqMan Gene Expression Assays TaqMan SNP Genotyping Assays Custom TaqMan GX & SNP Assays mirna assays Custom Primers/Probe Design Software Universal PCR Condition on Applied Biosystems Real Time PCR System Automatic Data Analysis Auto-clustering in SNP Genotyping Gene Expression: automatic Constructing standard curve Automatic relative quantitation Data analysis 56 Date AB CONFIDENTIAL

57 Real-Time PCR

58 Two-Step StepOne Real-Time PCR System RT (High Capacity cdna Archive Kit P/N ) PCR: cdna template or gdna Probe Reagent TaqMan Probe Systems 20 x probe/ primer mix (TaqMan Gene Expression Assay) (Custom TaqMan Gene Expression Assay) Or Primer Express software design (300 nm primer nm probe) P/N (200 Rx) + 2x TaqMan Universal PCR Master Mix SYBR Green I Systems Primer Express software design 行 (optimized primer conc.) P/N (200 Rx) + 2x SYBR Green I PCR Master Mix 58 Date AB CONFIDENTIAL

59 One-step StepOne Real-Time RT-PCR: System RNA template Probe Reagent TaqMan Probe Systems 20 x probe/ primer mix P/N (200 Rx) TaqMan One-Step RT-PCR Master Mix Reagents (TaqMan Gene Expression Assay) Kit (Custom TaqMan Gene Expression Assay) Or Or Primer Express software design (300 nm primer nm probe) N (200 Rx) TaqMan EZ RT PCR core Reagents SYBR Green I Systems Primer Express software design 行 (optimized primer conc.) P/N SYBR Green RT-PCR Reagent (P/N N ) 59 Date AB CONFIDENTIAL

60 Performance of Power SYBR Green Master Mix 60 Date AB CONFIDENTIAL

61 All include ROX as the internal passive reference 61 Date AB CONFIDENTIAL

62 StepOne Real Real-Time PCR System Time PCR Reverse Transcription : High Capacity cdna archive Kit Real Time PCR: TaqMan Chemistry 2x TaqMan Master Mix 1x 12.5 ul 20x Probe/primer Assay Mix 1.25 ul Water NA cdna ng 5-10 ul Component 10x Reverse Transscription Buffer 25x dntp 10x Random Primer RT Enzyme 50U/uL RNA (0.1~10 ug) H2O 25 ul SYBR Chemistry 2x SYBR Master Mix 1x 12.5 ul F Primer optimized NA R Primer optimized NA Water NA cdna ng 5-10 ul 25 ul 62 Date AB CONFIDENTIAL

63 Applied Biosystems, Taiwan Accelerate the Pace of Discovery, Enable Sciences for Life :

StepOne Plus Real-Time PCR Solution Introduction. StepOnePlus Real-Time PCR System: The Basics. StepOnePlus Real-Time PCR System: The Basics

StepOne Plus Real-Time PCR Solution Introduction. StepOnePlus Real-Time PCR System: The Basics. StepOnePlus Real-Time PCR System: The Basics Total Solutions for Real-Time PCR Applications Sample Preparation Gene Expression Assay TaqMan Gene Expression Assay TLDA-Gene Signature Panel TaqMan PreAmp Assay TaqMan MicroRNA Assay TLDA- mirna Panel

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Fundamentals of Real-Time PCR. Poupak Farahani, Ph.D. Senior Product Specialist

Fundamentals of Real-Time PCR. Poupak Farahani, Ph.D. Senior Product Specialist Fundamentals of Real-Time PCR Poupak Farahani, Ph.D. Senior Product Specialist Polymerase Chain Reaction (PCR) Unamplified DNA Strand Denaturation Primer annealing PCR Primer extension Dreischrittreaktion

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Absolute Quantification Getting Started Guide

Absolute Quantification Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction

More information

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Michael Wakem M.Sc Bio-Rad Laboratories Canada Ltd (800) 268-0213 Ext 3360 michael_wakem@bio-rad.com Overview Fundamentals

More information

Reference Dye N/A ROX & ROX II (as separate tubes) ROX & ROX II (as separate tubes)

Reference Dye N/A ROX & ROX II (as separate tubes) ROX & ROX II (as separate tubes) Comparison of TaKaRa s and qrt-pcr Kits SYBR Premix Ex Taq (Tli RNase H+) Premix Ex Taq (Probe qpcr) SYBR Premix Ex Taq II (Tli RNase H+) Cat.# RR420A RR390A RR820A Reactions/Kit 200 (50 µl reaction size)

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Considerations for standardizing qpcr assays.

Considerations for standardizing qpcr assays. Considerations for standardizing qpcr assays. qpcr Satellite Symposium BioCity Leipzig March 10-11, 11, 2005 Reinhold Mueller, PhD Senior Staff Scientist Outline: Introduction Controls, references and

More information

Real-Time PCR Systems

Real-Time PCR Systems specification sheet StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Remarkably Simple Systems. Simply Remarkable Results. Common System Features:

More information

The AB7900Fast and Principles of Real Time PCR

The AB7900Fast and Principles of Real Time PCR The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications

More information

Absolute Quantitation Using Standard Curve Getting Started Guide

Absolute Quantitation Using Standard Curve Getting Started Guide Applied Biosystems 7900HT Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started Guide Introduction Designing an AQ Experiment Preparing the Samples and Reaction Plate Creating

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

SYBR Premix Ex Taq (Tli RNaseH Plus)

SYBR Premix Ex Taq (Tli RNaseH Plus) Cat. # RR420A For Research Use SYBR Premix Ex Taq (Tli RNaseH Plus) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Materials Required but not Provided...

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

T08-003A. Figure 1: The Results Editor home screen.

T08-003A. Figure 1: The Results Editor home screen. Technical Note Dissociation Curve Analysis T08-003A General Introduction to Data Analysis The aim of this Technical Note is to explain the principle of dissociation curve analysis and to guide you through

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

7900HT. Applied Biosystems 7900HT Fast Real-Time PCR System The complete solution for real-time PCR

7900HT. Applied Biosystems 7900HT Fast Real-Time PCR System The complete solution for real-time PCR GENE EXPRESSION AND GENOTYPING 7900HT Fast Real-Time PCR System 7900HT Applied Biosystems 7900HT Fast Real-Time PCR System The complete solution for real-time PCR A real asset to any disease research program.

More information

SybGREEN qpcr Primers and Standards

SybGREEN qpcr Primers and Standards SybGREEN qpcr Primers and Standards Tools for RT-PCR Application Guide Table of Contents Package Contents and Storage Conditions... 1 Introduction... 3 SybGREEN qpcr Primer Pairs... 3 Gene Specific qpcr

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication

More information

Realtime PCR Master Mix

Realtime PCR Master Mix Instruction manual Realtime PCR Master Mix 0810 F0923K Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol 1. TaqMan assay

More information

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at:

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at: REAL- TIME POLYMERASE CHAIN REACTION: This technology has all but replaced Northern blots for determining gene expression in tissues, cells, and organisms with more accuracy and more quantitative capabilities

More information

StepOne and StepOnePlus Real-Time PCR Systems

StepOne and StepOnePlus Real-Time PCR Systems PRODUCT BROCHURE Real-Time PCR Systems StepOne and StepOnePlus Real-Time PCR Systems Remarkably Simple Systems. Simply Remarkable Results. Step Up To High Performance Real-Time PCR Remarkably Simple Systems

More information

PERSONAL PRECISION R E A L-T I M E P C R

PERSONAL PRECISION R E A L-T I M E P C R PERSONAL PRECISION R E A L-T I M E P C R The MyGo Mini is the world s most compact real-time PCR instrument, with no moving parts, enabling silent operation and maximum reliability. It provides users with

More information

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BB BioBank control cdna

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BB BioBank control cdna BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign

More information

PrimeScript RT Master Mix (Perfect Real Time) Sample

PrimeScript RT Master Mix (Perfect Real Time) Sample Cat. # RR036Q For Research Use PrimeScript RT Master Mix (Perfect Real Time) Sample Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided...

More information

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems Technical Manual Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems INSTRUCTIONS FOR USE OF PRODUCTS A4011, A4021, A4031, A4041, A4051 AND

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September

More information

Quantitative Real Time PCR Protocol. Stack Lab

Quantitative Real Time PCR Protocol. Stack Lab Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that

More information

Introduction to Quantitative PCR

Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770

More information

Methods and Application Guide. Introduction to Quantitative PCR

Methods and Application Guide. Introduction to Quantitative PCR Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Absolute Quantitation Using Standard Curve Getting Started Guide

Absolute Quantitation Using Standard Curve Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started

More information

LightCycler 480 Real-Time PCR System: Innovative Solutions for High-Throughput PCR

LightCycler 480 Real-Time PCR System: Innovative Solutions for High-Throughput PCR LightCycler 480 Real-Time PCR System: Innovative Solutions for High-Throughput PCR Options for High-Throughput PCR Robotics Automated plate loading Ready-to-use and stable reagents Increasing throughput

More information

LightCycler 480 Instrument Quick Guide

LightCycler 480 Instrument Quick Guide LightCycler 480 Instrument Quick Guide For life science research use only. Not for use in diagnostic procedures. This page intentionally left blank. General Information The contents of this document, including

More information

Bioer Real-Time PCR Detection Systems

Bioer Real-Time PCR Detection Systems Bioer Real-Time PCR Detection Systems LineGene 9600 qpcr Performance with Ease Flexibility Reliability About Bioer Technology Company Bioer Technology Company (Bioer) evolved from the R&D department of

More information

Plus/Minus Assay. Applied Biosystems 7300/7500 Real Time PCR System. Getting Started Guide. Introduction. Designing a Plus/Minus Experiment

Plus/Minus Assay. Applied Biosystems 7300/7500 Real Time PCR System. Getting Started Guide. Introduction. Designing a Plus/Minus Experiment Getting Started Guide Plus/Minus Assay Applied Biosystems 7300/7500 Real Time PCR System Introduction Designing a Plus/Minus Experiment Setting Up the Reaction Performing a Plus/Minus Pre-Read Run Generating

More information

Precision TM FAST and Precision TM Mastermix

Precision TM FAST and Precision TM Mastermix Precision TM FAST and Precision TM Mastermix Instructions for use of PrimerDesign Precision TM Mastermix and Precision TM FAST Mastermix MM MasterMix Contents Introduction 3 Kit Contents 5 Recommended

More information

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental

More information

Super One-step RT-PCR Kit for Virus Detection

Super One-step RT-PCR Kit for Virus Detection Super One-step RT-PCR Kit for Virus Detection For fast and sensitive one-step RT-PCR with highly specificity www.tiangen.com/en SD121221 Super One-step RT-PCR Kit Kit Contents Contents Cat. no. SD103 SD103

More information

Highly specific and sensitive quantitation

Highly specific and sensitive quantitation PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System 5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing

More information

Precision OneStep TM qrt-pcr Mastermix

Precision OneStep TM qrt-pcr Mastermix Precision OneStep TM qrt-pcr Mastermix Instructions for use of Primerdesign Precision OneStep TM Mastermix for real-time RT-PCR ONE OneStep MasterMix Contents Introduction 3 Kit Contents 5 Recommended

More information

Real-time PCR handbook

Real-time PCR handbook Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time

More information

Novel In-process Monitoring Tools for Improving Accuracy and Reproducibility of RT-qPCR Results. Dirk Schacht, Global Product Manager, June 2015

Novel In-process Monitoring Tools for Improving Accuracy and Reproducibility of RT-qPCR Results. Dirk Schacht, Global Product Manager, June 2015 Novel In-process Monitoring Tools for Improving Accuracy and Reproducibility of RT-qPCR Results Dirk Schacht, Global Product Manager, June 2015 In-process monitoring tools for RT-qPCR 1 4-Part webinar

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

Critical Factors for Successful Real-Time PCR

Critical Factors for Successful Real-Time PCR Integrated Solutions Real-Time PCR Applications Critical Factors for Successful Real-Time PCR New CT 40 35 30 25 20 15 4 Slope = 3.59 2 0 2 Log ng total RNA 3.0 Rn 2.0 1.0 0.5 0 0 10 20 30 40 50 Cycle

More information

CFX96 Real-Time PCR Detection System

CFX96 Real-Time PCR Detection System Real-Time PCR: CFX96 System CFX96 Real-Time PCR Detection System Designed for the Way You Work The CFX96 System Designed for the Way You Work Bio-Rad s 00-series PCR instruments meet all your PCR needs

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.

Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4. TECHNICAL MANUAL Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.0 Instruc ons for use of Products A4011,

More information

User Bulletin #2 ABI PRISM 7700 Sequence Detection System

User Bulletin #2 ABI PRISM 7700 Sequence Detection System User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 (updated 10/2001) SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be

More information

PrecisionPLUS TM PrecisionFAST TM Precision TM Mastermix

PrecisionPLUS TM PrecisionFAST TM Precision TM Mastermix PrecisionPLUS TM PrecisionFAST TM Precision TM Mastermix Instructions for use of PrimerDesign Precision TM Mastermix/Precision Plus TM Precision TM FAST Mastermix Mastermix and MM MasterMix Contents Introduction

More information

StepOne and StepOnePlus Real-Time PCR Systems. Remarkably Simple Systems. Simply Remarkable Results.

StepOne and StepOnePlus Real-Time PCR Systems. Remarkably Simple Systems. Simply Remarkable Results. StepOne and StepOnePlus Real-Time PCR Systems Remarkably Simple Systems. Simply Remarkable Results. Step Up to High-Performance Real-Time PCR Remarkably Simple Systems Applied Biosystems, a leader in technology

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

Genomics. BETTER SYSTEMS. BRILLIANT RESULTS. Agilent Real-Time PCR Solutions AGILITY PRECISION SPEED

Genomics. BETTER SYSTEMS. BRILLIANT RESULTS. Agilent Real-Time PCR Solutions AGILITY PRECISION SPEED SPEED AGILITY PRECISION BETTER SYSTEMS. BRILLIANT RESULTS. Agilent Real-Time PCR Solutions Genomics TOTAL CONFIDENCE qpcr Built on Stratagene s legacy of excellence, Agilent Technologies provides a simplified

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

Quantitative PCR Systems

Quantitative PCR Systems QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE FULL-FEATURED FLEXIBLE

More information

Scott Reierstad. Field Applications Scientist

Scott Reierstad. Field Applications Scientist Real-time PCR Training Scott Reierstad Field Applications Scientist Topics we ll cover Quick introduction to real-time PCR ABI-supported real-time chemistries Instrumentation Quantitation via Standard

More information

Sample Preparation and Reaction Set-up

Sample Preparation and Reaction Set-up Sample Preparation and Reaction Set-up Important aspects of sample preparation and reaction setup Sampling Sample storage RNA / DNA Extraction and quality RNA / cdna / DNA storage Primer and probes formulation

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information

miracle mirna qpcr Instruction Manual Store at -20 Version 3.0 (Aug.2013)

miracle mirna qpcr Instruction Manual Store at -20 Version 3.0 (Aug.2013) miracle mirna qpcr Instruction Manual Store at -20 Version 3.0 (Aug.2013) Contents I. PRODUCT INTRODUCTION 1 A. OVERVIEW 1 B. KIT CONTENTS 1 1. REAGENT KITS 1 2. PRIMER SETS 3 3. MIRACLE ON CALL SCREEN

More information

Relative Quantitation Using Comparative C T Getting Started Guide

Relative Quantitation Using Comparative C T Getting Started Guide Applied Biosystems 7900HT Fast Real-Time PCR System Relative Quantitation Using Comparative C T Getting Started Guide Introduction N Designing an RQ Experiment Preparing Samples and Reaction Plates Creating

More information

Eco TM 48 Real Time PCR System. Fastest block-based qpcr. Four colour multiplexing. Supports all chemistries. Fast cycling protocols

Eco TM 48 Real Time PCR System. Fastest block-based qpcr. Four colour multiplexing. Supports all chemistries. Fast cycling protocols A Bibby Scientific Company Eco TM 48 Real Time PCR System Fast cycling Fastest block-base HRM functionality Four colour multiplexing MIQE compliant Easy to use software Supports all chemistries Small footprint

More information

Megaplex Pools For microrna Expression Analysis

Megaplex Pools For microrna Expression Analysis Megaplex Pools For microrna Expression Analysis Protocol Copyright 2008, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document

More information

QuantStudio 3 and QuantStudio 5 Real-Time PCR Systems. Connect to your data anytime, anywhere

QuantStudio 3 and QuantStudio 5 Real-Time PCR Systems. Connect to your data anytime, anywhere QuantStudio 3 and QuantStudio 5 Real-Time PCR Systems Connect to your data anytime, anywhere Connect with your future The modern laboratory is undergoing a technological revolution. Today s scientific

More information

Quando si parla di PCR quantitativa si intende:

Quando si parla di PCR quantitativa si intende: Quando si parla di PCR quantitativa si intende: A. Una PCR che produce grandi quantità di DNA B. Una PCR che emette quanti di luce C. Una PCR che quantifica il numero di molecole stampo presenti all inizio

More information

Introduction to Gene Expression. Getting Started Guide

Introduction to Gene Expression. Getting Started Guide Introduction to Gene Expression Getting Started Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without

More information

AriaDx REAL-TIME PCR INSTRUMENT ORDERING INFORMATION. Trusted Answers. Together. IVD

AriaDx REAL-TIME PCR INSTRUMENT ORDERING INFORMATION. Trusted Answers. Together. IVD ORDERING INFORMATION Category Part # Description Quantity Instrumentation K8930AA AriaDx Real-Time PCR instrument 1 Option 101 SYBR/FAM Optical Cartridge Option 102 ROX Optical Cartridge Option 103 HEX

More information

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,

More information

Relative Quantitation Using Comparative C T Getting Started Guide

Relative Quantitation Using Comparative C T Getting Started Guide Applied Biosystems 7900HT Fast Real-Time PCR System Relative Quantitation Using Comparative C T Getting Started Guide Introduction N Designing an RQ Experiment Preparing Samples and Reaction Plates Creating

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Rotor-Gene Q Pure Detection

Rotor-Gene Q Pure Detection Rotor-Gene Q Pure Detection Now with even more applications! Sample & Assay Technologies Outstanding performance in real-time PCR The Rotor-Gene Q for your success Quantitative, real-time PCR is a precision

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

TaqMan Copy Number Assays. Protocol

TaqMan Copy Number Assays. Protocol TaqMan Copy Number Assays Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. Life Technologies

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Chemistry Guide Copyright 2005 Applied Biosystems. All rights reserved. For Research Use Only.

More information

Real-Time Quantitative PCR Instruments and Consumables

Real-Time Quantitative PCR Instruments and Consumables Index Page Sequence Detection Systems 2 Sequence Detection Systems Accessories and Softwares 3 Sequence Detection PCR Reagent Kits 4 Sequence Detection PCR Reagents 9 Sequence Detection Systems Disposables

More information

Quantifiler Kits Quantifiler Human DNA Quantification Kit and Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Kits Quantifiler Human DNA Quantification Kit and Quantifiler Y Human Male DNA Quantification Kit Quantifiler Kits Quantifiler Human DNA Quantification Kit and Quantifiler Y Human Male DNA Quantification Kit User s Manual Applied Biosystems Quantifiler Kits Quantifiler Human DNA Quantification Kit

More information

Fast SYBR Green Master Mix. Protocol

Fast SYBR Green Master Mix. Protocol Fast SYBR Green Master Mix Protocol Copyright 2007, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to

More information

LightCycler 96 Real-Time PCR System Super Capabilities Are Now Within Your Reach

LightCycler 96 Real-Time PCR System Super Capabilities Are Now Within Your Reach LightCycler 96 Real-Time PCR System Super Capabilities Are Now Within Your Reach Discover the new LightCycler 96 Real-Time PCR System A compact and smart device that s the perfect companion for qpcr newbies

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

GMO specific real-time PCR system

GMO specific real-time PCR system GMO specific real-time PCR system Protocol for event-specific quantitation of Bt11 in maize Method development: National Veterinary Institute (Norway) and INRA (France) Method Validation: European Commission

More information

Getting Started Guide

Getting Started Guide Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering

More information

Brilliant II QRT-PCR Master Mix with ROX, 1-Step

Brilliant II QRT-PCR Master Mix with ROX, 1-Step Brilliant II QRT-PCR Master Mix with ROX, 1-Step Instruction Manual Catalog #600838 (Brilliant II QRT-PCR High ROX Master Mix, 1-Step) #600837 (Brilliant II QRT-PCR Low ROX Master Mix, 1-Step) #600842

More information

Quantitative Telomerase Detection Kit (QTD Kit)

Quantitative Telomerase Detection Kit (QTD Kit) Quantitative Telomerase Detection Kit (QTD Kit) Catalog No. MT3010, MT3011, MT3012 For Research Use Only. Not for use in diagnostic procedures 1 Table of Contents 1. Introduction Background Product Overview

More information

Put the odds in your favor

Put the odds in your favor Reverse Transcription Put the odds in your favor SuperScript III Reverse Transcriptase Reverse Transcription Engineered for performance SuperScript III Reverse Transcriptase (RT) is engineered for reduced

More information

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Chemistry Guide Copyright 2004 Applied Biosystems. All rights reserved. For Research Use Only.

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

All-in-One mirna qrt-pcr Detection System Handbook

All-in-One mirna qrt-pcr Detection System Handbook All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)

More information

Applications Guide. Real-Time PCR Applications Guide

Applications Guide. Real-Time PCR Applications Guide Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time

More information