DNA. Form and Function

Save this PDF as:

Size: px
Start display at page:

Download "DNA. Form and Function"


1 DNA Form and Function

2 DNA: Structure and replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork for understanding the principles of heredity R R 0 R0 R0 0 R0 R0 R 0 R RR R0 0 R0 00 Understanding DNA structure and replication is a prerequisite for understanding/using the principal tools of molecular biology

3 DNA: Structure and replication Three features of DNA makes it an ideal genetic material 1. Faithful replication 2. Information content 3. Capable of change

4 The building blocks of DNA Nucleotides overall structure

5 The building blocks of DNA Nucleotides bases

6 The building blocks of DNA Nucleotides - bases

7 The building blocks of DNA Nucleotides + nucleotides = polynucleotides

8 The building blocks of DNA Complementary base pairing and the double helix

9 DNA replication is semiconservative

10 Requirements for DNA synthesis 1. DNTPs: datp, dgtp, dttp, and dctp 2. Template DNA (a pre-existing single strand) 3. DNA polymerase 1

11 Requirements for DNA synthesis 2. Template DNA (a pre-existing single strand) ATCGGTCAACGTTAAAGTTAGCGG

12 Requirements for DNA synthesis 3. DNA polymerase(s) 1. There are multiple forms of DNA polymerase 2. The different polymerases have different activities those with direct roles in replication are called replicases. Others have secondary roles in replication and/or repair synthesis. 3. In DNA replication polymerases catalyze the polymerization of deoxyribonucleotides into a DNA chain via the formation of a phosphodiester bond between the 3'-OH of the deoxyribose on the last nucleotide and the 5' phosphate of the dntp precursor.

13 Requirements for DNA synthesis 3. DNA polymerase(s) (continued) 4. Polymerase is bound to the DNA and moves along template the strand as polynucleotide chain grows. Thus, the dntp precursor is identified that can base pair with the nucleotide on the template DNA. The frequency of error is low, but errors can occur. 5. Polymerases can have exonuclease activity (they can remove nucleotides from the 3' end of the chain). This is a proofreading mechanism. The presence of an unpaired nucleotide from the 3'OH end of the growing chain triggers exonuclease activity: the unpaired nucleotide is cleaved from the end of the growing chain by the polymerase.

14 The essentials of DNA synthesis: Point: replication is 5' to 3'

15 The essentials of DNA synthesis: Point: replication is 5' to 3'

16 The essentials of DNA synthesis: Point: replication is 5' to 3'

17 The essentials of DNA synthesis: Point: replication is 5' to 3'

18 The essentials of DNA synthesis: Point: replication is 5' to 3'

19 The essentials of DNA synthesis: Point: replication is 5' to 3'

20 Details of DNA replication 1. Replication begins at a fixed point, called the origin, and proceeds bi-directionally. In a higher plant chromosome there are thousands of origins. Consider The size of the genome The rate of DNA replication The length of the S phase

21 Details of DNA replication: Origins

22 Details of DNA replication: Origins

23 Details of DNA replication: Origins

24 Details of DNA replication: Origins

25 Details of DNA replication 2. Unwinding: The DNA helix needs to be opened up. This is accomplished by helicase enzymes, which break the hydrogen bonds holding the two strands of the helix together. 3. Stabilization: The unwound DNA is stabilized by a protein (single strand binding protein (SSB)).

26 4. Priming: DNA polymerases can extend a chain, but they cannot start one. The RNA primers are later removed by exonuclease activity of a polymerase and replaced with DNA.

27 4. Leading and lagging strands: DNA polymerases synthesize new chains only from 5' to 3', yet the DNA molecule is antiparallel and DNA synthesis is semi-conservative. Therefore, DNA synthesis is continuous on one strand (the leading strand) and discontinuous on the other strand (the lagging strand). The DNA on the lagging strand is thus formed in fragments, called Okazaki fragments.

28 Leading and lagging strands

29 Leading and lagging strands

30 Leading and lagging strands

31 Leading and lagging strands

32 Leading and lagging strands

33 Leading and lagging strands

34 Leading and lagging strands

35 6. Editing: Some polymerases have 3'-5' exonuclease activity. This allows these enzymes to "search" for mismatched bases that were incorrectly added during polymerization and removes them. This proofreading function occurs at the 3' end of the growing strand and proceeds 3' 5'.

36 Summary of DNA replication...and more on RNA primers In the lagging strand the DNA Pol I exonuclease removes the RNA Primers. The gaps are closed by DNA Polymerase (adds complementary nucleotides to the gaps) and DNA Ligase (adds phosphate in the remaining gaps of the phosphate - sugar backbone).

37 Summary of DNA replication...and telomere shortening Termination of DNA Replication When DNA Polymerase reaches the end of the template lagging strand removal of the RNA primer leaves a gap that DNA Polymerase cannot fill. Therefore, with each replication event, the chromosome shortens Telomeres are at the ends of chromosomes, therefore telomeres shorten with each cell division. Unless there is telomerase..

38 The telomerase solution

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg UNIT 3: Molecular Genetics Chapter 6: DNA: Hereditary Molecules of Life pg. 268-6.4: DNA Replication and Repair pg. 282-290 The DNA molecule is capable of replicating on its own. This is important for

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics SBI4U1 Molecular Genetics Recall: mitosis requires that each daughter cell has an exact copy of parent DNA. Ms. Ponvia The Watson-Crick model suggests how this occurs: Parent DNA molecule unzips, creating

More information

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 2. True or False? Dideoxy sequencing is a chain initiation method of DNA sequencing. False

More information

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp),

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), deoxyguanosine triphosphate (dgtp), deoxycytidine triphos-phate (dctp),

More information


DNA AND IT S ROLE IN HEREDITY DNA AND IT S ROLE IN HEREDITY Lesson overview and objectives - DNA/RNA structural properties What are DNA and RNA made of What are the structural differences between DNA and RNA What is the structure of

More information

CHAPTER 3 Molecular Genetics DNA Replication

CHAPTER 3 Molecular Genetics DNA Replication CHAPTER 3 Molecular Genetics DNA Replication Watson and Crick DNA model implies a mechanism for replication: a. Unwind the DNA molecule. b. Separate the two strands. c. Make a complementary copy for each

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

DNA Replication. (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy. Sequence Complexity in the Genome

DNA Replication. (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy. Sequence Complexity in the Genome DNA Replication (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy Sequence Complexity in the Genome 60-70% of human DNA fragments are unique DNA sequences 1 What are the structural features

More information

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct.

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct. Lectures 19 and 20 Chapter 12: DNA Replication and Recombination DNA Replication is semiconservative Meselson-Stahl experiment: 15 N-labeling and CsCl density gradient centrifugation. Problem set 3A: due

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information


I) DNA STRUCTURE AND REPLICATION B) DNA REPLICATION I) DN SRUURE ND REPLIION B) DN REPLIION I) DN Structure and Replication DN Replication for mitosis and meiosis to occur the DN must make an exact copy itself first (S Phase) this is called DN replication

More information

DNA: Structure and Replication

DNA: Structure and Replication 7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for

More information

DNA replication (Lecture 28,29)

DNA replication (Lecture 28,29) DNA replication (Lecture 28,29) 1. DNA replication and the cell cycle 2. DNA is Reproduced by Semiconservative Replication 2.1 Conservation of the Original Helix 2.2 The Meselson-Stahl Experiment 2.3 Semiconservative

More information

During DNA replication, a cell uses a variety of proteins to create a new copy of its genome.

During DNA replication, a cell uses a variety of proteins to create a new copy of its genome. Principles of Biology contents 45 DNA Replication During DNA replication, a cell uses a variety of proteins to create a new copy of its genome. DNA replication is a set of timed processes involving many

More information

2. Why did biologists used to think that proteins are the genetic material?

2. Why did biologists used to think that proteins are the genetic material? Chapter 16: DNA: The Genetic Material 1. What must genetic material do? 2. Why did biologists used to think that proteins are the genetic material? 3. Describe Griffith s experiments with genetic transformation

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini DNA REPLICATION This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. DNA Replication In both

More information

Chapter 4.2 (textbook: Molecular Cell Biology 6 ed, Lodish section: ) DNA Replication, Repair, and Recombination

Chapter 4.2 (textbook: Molecular Cell Biology 6 ed, Lodish section: ) DNA Replication, Repair, and Recombination Chapter 4.2 (textbook: Molecular Cell Biology 6 ed, Lodish section: 4.5-4.6) DNA Replication, Repair, and Recombination Cell division - mitosis S-phase is tightly regulated by kinases Mitosis can be divided

More information

Some comments on biochemistry

Some comments on biochemistry BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 13: DNA replication and repair http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Some comments on biochemistry The last

More information

Appendix C DNA Replication & Mitosis

Appendix C DNA Replication & Mitosis K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:

More information


MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

2. The work of Messelson & Stahl showed semi-conservative replication. 4. Cairn's experiments showed chromosomes are semi-conservatively replicated.

2. The work of Messelson & Stahl showed semi-conservative replication. 4. Cairn's experiments showed chromosomes are semi-conservatively replicated. BIOLOGY 207 - Dr.McDermid Lecture#2/3 DNA Structure & Replication Readings: Griffiths et al, 7 th Edition: Ch. 8 pp 243-259 (corrected) Problems: Griffiths et al, 7 th Edition: Ch. 8 Tier 1: # 2,3,5,9,13

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information


TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin.

More information

The Watson-Crick Proposal. DNA Replication. Semiconservative DNA replication

The Watson-Crick Proposal. DNA Replication. Semiconservative DNA replication Cell and Molecular Biology The Watson-Crick Proposal DNA Replication DNA strands are complementary Nucleotides are lined up on templates according to base pair rules Kanokporn Boonsirichai ksatima@live.com

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Chromosome Mapping by Recombination

Chromosome Mapping by Recombination Chromosome Mapping by Recombination Genes on the same chromosome are said to be linked. Crossing over: the physical exchange of homologous chromosome segments A given crossover generates two reciprocal

More information

POGIL Cell Biology Activity 6 DNA Replication MODEL 1: "Replication Bubble"

POGIL Cell Biology Activity 6 DNA Replication MODEL 1: Replication Bubble POGIL Cell Biology Activity 6 DNA Replication MODEL 1: "Replication Bubble" The circle is an E. coli chromosome at the beginning of DNA synthesis. The original DNA strands are called "parental strands".

More information

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)? 1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The

More information

DNA Structure and Replication. Chapter Nine

DNA Structure and Replication. Chapter Nine DNA Structure and Replication Chapter Nine 2005 We know: DNAis the hereditary material DNAhas a double helix structure Made of four bases; A,T,C,G Sugar-Phosphate backbone DNAreplication is semi-conservative

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information

Reminder. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA.

Reminder. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA. DNA Replication Genes are DNA. Reminder DNA is a double-stranded molecule. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA. 1 10 20 30 40 50 60 70 80 90 100 AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC

More information

Chapter 16: DNA Structure & Replication

Chapter 16: DNA Structure & Replication hapter 16: DN Structure & Replication 1. DN Structure 2. DN Replication 1. DN Structure hapter Reading pp. 313-318 enetic Material: Protein or DN? Until the early 1950 s no one knew for sure, but it was

More information

DNA Replication. Introduction... 1 The Mechanism of Replication... 2 DNA Replication Rates... 4 References... 5

DNA Replication. Introduction... 1 The Mechanism of Replication... 2 DNA Replication Rates... 4 References... 5 DNA Replication Contents Introduction... 1 The Mechanism of Replication... 2 DNA Replication Rates... 4 References... 5 Introduction In their report announcing the structure of the DNA molecule, Watson

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

Chapter 25 Homework Assignment

Chapter 25 Homework Assignment Chapter 25 Homework Assignment The following problems will be due once we finish the chapter: 4, 5, 8, 9, 11 Minimal Coverage of Section 25.3 Chapter 25 1 Chapter 25 DNA Metabolism DNA Polymerase III 1

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

Part III. Genetic information replication and flow

Part III. Genetic information replication and flow Part III Genetic information replication and flow Chapter 16 DNA Biosynthesis and Recombination The biological function of DNA Store genetic information Replicate genetic information Express genetic information

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

The Structure, Replication, and Chromosomal Organization of DNA

The Structure, Replication, and Chromosomal Organization of DNA Michael Cummings Chapter 8 The Structure, Replication, and Chromosomal Organization of DNA David Reisman University of South Carolina History of DNA Discoveries Friedrich Miescher Isolated nuclein from

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information


OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information


INTRODUCTION TO DNA Replication INTRODUCTION TO DNA Replication - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Chapter 13 covers a descriptive explanation of Deoxyribose nucleic Acid

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information


STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure Chapter 11 DNA replication, repair and recombination Overview Brief introduction DNA replication DNA repair DNA recombination DNA replication is essential for life Introduction Cells divide and make copies

More information

Frederick Griffith Dna Is The Genetic Material 11/24/2015. Important Scientists in the Discovery of DNA

Frederick Griffith Dna Is The Genetic Material 11/24/2015. Important Scientists in the Discovery of DNA hapter 16 P. 305-324 16.1 Dna Is he enetic Material.H Morgan s group: showed that genes are located along chromosomes. wo chemical components of chromosomes are DN and protein. Little was known about nucleic

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Lecture 9 DNA Structure & Replication

Lecture 9 DNA Structure & Replication Lecture 9 DNA Structure & Replication What is a Gene? Mendel s work left a key question unanswered: What is a gene? The work of Sutton and Morgan established that genes reside on chromosomes But chromosomes

More information


DNA to Protein BIOLOGY INSTRUCTIONAL TASKS BIOLOGY INSTRUCTIONAL TASKS DNA to Protein Grade-Level Expectations The exercises in these instructional tasks address content related to the following science grade-level expectations: Contents LS-H-B1

More information

Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay

Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay (Refer Slide Time: 00:29) Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay Lecture No. # 02 Central Dogma:

More information

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928

I. DNA, Chromosomes, Chromatin, and Genes. II. DNA Deoxyribonucleic Acid Located in the of the cell Codes for your - discovered DNA in 1928 Name: Period: Date: = passing on of characteristics from parents to offspring How?...! I. DNA, Chromosomes, Chromatin, and Genes = blueprint of life (has the instructions for making an organism) = uncoiled

More information

Copyright 2012 Nelson Education Ltd. Chapter 6: DNA Hereditary Molecules of Life 6-2

Copyright 2012 Nelson Education Ltd. Chapter 6: DNA Hereditary Molecules of Life 6-2 Chapter 6 Review, pages 304 309 Knowledge 1. c 2. d 3. b 4. c 5. b 6. d 7. b 8. a 9. b 10. c 11. c 12. d 13. a 14. False. Bacteria do not possess membrane-bound organelles to store their DNA. 15. False.

More information


NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-02 CENTRAL DOGMA: BASICS OF DNA, RNA AND PROTEIN TRANSCRIPT Welcome to the proteomics of course. Today we will talk about central dogma: basics of DNA, RNA and proteins. So lecture outline is,

More information

Module 14 Nucleic Acids Lecture 36 Nucleic Acids I

Module 14 Nucleic Acids Lecture 36 Nucleic Acids I TEL Biotechnology Cell Biology Module 1 ucleic cids Lecture 6 ucleic cids I ucleic acids are targets of many important drugs, including several anticancer agents. There are two types of nucleic acids:

More information

DNA Structure and Replication

DNA Structure and Replication Why? DNA Structure and Replication How is genetic information stored and copied? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life. For organisms to grow

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

Nucleic Acids and DNA Replication. I. Biological Background

Nucleic Acids and DNA Replication. I. Biological Background Lecture 14: Nucleic Acids and DNA Replication I. Biological Background A. Types of nucleic acids: 1. Deoxyribonucleic acid (DNA) a. Makes up genes that indirectly direct protein synthesis b. Contain information

More information

Chapter 6: Cell Growth and Reproduction Lesson 2: Chromosomes and DNA Replication

Chapter 6: Cell Growth and Reproduction Lesson 2: Chromosomes and DNA Replication Chapter 6: Cell Growth and Reproduction Lesson 2: Chromosomes and DNA Replication Cell reproduction involves a series of steps that always begin with the processes of interphase. During interphase the

More information


LEVEL TWO BIOLOGY: GENE EXPRESSION LEVEL TWO BIOLOGY: GENE EXPRESSION Protein synthesis DNA structure and replication Polypeptide chains and amino acids Mutations Metabolic pathways Protein Synthesis: I can define a protein in terms of

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Semiconservative DNA replication. Meselson and Stahl

Semiconservative DNA replication. Meselson and Stahl DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis

More information

The Molecular Basis of Inheritance

The Molecular Basis of Inheritance Chapter 16 The Molecular Basis of Inheritance Lecture Outline Overview: Life s Operating Instructions In April 1953, James Watson and Francis Crick shook the scientific world with an elegant double-helical

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

Bio Factsheet. How Science Works: Meselson and Stahl s Classic Experiment. Number 207.

Bio Factsheet. How Science Works: Meselson and Stahl s Classic Experiment. Number 207. Number 207 How Science Works: Meselson and Stahl s lassic Experiment n 1953 James Watson and Francis rick built their model of the structure of DNA, which is still accepted today: DNA is an anti-parallel

More information

Mice die Mice live Mice live Mice die

Mice die Mice live Mice live Mice die Module 3E DA Structure and Replication In this module, we will examine: the molecular structure of the genetic material how the genetic material replicates how damage to the genetic material is repaired

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Semiconservative DNA replication (Meselson-Stahl experiment)

Semiconservative DNA replication (Meselson-Stahl experiment) DNA replication Semiconservative DNA replication (Meselson-Stahl experiment) Replication of DNA 3 5 3 3-5 3 5 3 5 Hartl New nucleotides are added to DNA only during replication in the 5-3 direction DNA

More information

7. 3. replication. Unit 7: Molecular biology and genetics

7. 3. replication. Unit 7: Molecular biology and genetics 7. 3 DN replication he fact that DN is a self-replicating molecule and can make copies of itself is the basis of all life forms. It is the essence of what life is. Indeed, according to Richard Dawkins

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

These machines catalyze some of the most rapid and accurate processes that take place within cells and Their mechanisms clearly demonstrate the

These machines catalyze some of the most rapid and accurate processes that take place within cells and Their mechanisms clearly demonstrate the DNA Replication: The ability of cells to maintain a high degree of order in a chaotic universe depends upon the accurate duplication of vast quantities of genetic information carried in chemical form as

More information

1. In the experiments of Griffith, the conversion of nonlethal R-strain bacteria to lethal S- strain bacteria:

1. In the experiments of Griffith, the conversion of nonlethal R-strain bacteria to lethal S- strain bacteria: Name Chapter 12: DNA: The Carrier of Genetic Information Mrs. Laux AP Biology Take home test #10 on Chaps. 12 and 13 DUE: MONDAY, DECEMBER 14, 2009 MULTIPLE CHOICE QUESTIONS 1. In the experiments of Griffith,

More information

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why?

Unit 9: DNA, RNA, and Proteins. Pig and elephant DNA just don t splice, but why? Unit 9: DNA, RNA, and Proteins Pig and elephant DNA just don t splice, but why? BONUS - History of DNA Structure of DNA 3.3.1 - Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and

More information

Choose the response which best answers the question or completes the statement.

Choose the response which best answers the question or completes the statement. Choose the response which best answers the question or completes the statement. 1. The process of transformation in bacteria involves (1.) transfer of genes for making a capsule. (2.) infection with a

More information

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond 11 Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Structural Components of Nucleotides Base Sugar Phosphate Glycosidic bond H NUCLEOTIDE H 1 RNA DNA Table 3-1 Nucleic acid polymer

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information


DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence Lecture 10 Analysis of Gene Sequences Anatomy of a bacterial gene: Promoter Coding Sequence (no stop codons) mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA,

More information

The Central Dogma. Replication as a Process. DNA Replication is Semi-discontinuous!

The Central Dogma. Replication as a Process. DNA Replication is Semi-discontinuous! The Central Dogma DNA structure and DNA replication DNA replication (continued) RNA Synthesis rotein synthesis rof. David McConnell Smurfit Institute of Genetics DNA an emblem of the 20 th century. 1.!

More information

DNA, genes and chromosomes

DNA, genes and chromosomes DNA, genes and chromosomes Learning objectives By the end of this learning material you would have learnt about the components of a DNA and the process of DNA replication, gene types and sequencing and

More information

DNA Replication Replication begins simultaneously on several chromatin threads & continues until all DNA has been replicated. Steps in DNA Replication

DNA Replication Replication begins simultaneously on several chromatin threads & continues until all DNA has been replicated. Steps in DNA Replication DNA Replication Replication begins simultaneously on several chromatin threads & continues until all DNA has been replicated Steps in DNA Replication 1) 2) 3) 4) 5) 6) DNA helices unwind from the nucleosomes

More information

DNA (Deoxyribonucleic Acid)

DNA (Deoxyribonucleic Acid) DNA (Deoxyribonucleic Acid) Genetic material of cells GENES units of genetic material that CODES FOR A SPECIFIC TRAIT Called NUCLEIC ACIDS DNA is made up of repeating molecules called NUCLEOTIDES Phosphate

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

(DNA) 2 = = RNA - DNA

(DNA) 2 = = RNA - DNA Genetics and Cellular Function Genes and nucleic acids Protein synthesis and secretion DNA replication and the cell cycle Chromosomes and heredity Organization of the Chromatin Threadlike chromatin = chromosomes

More information

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another?

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another? INTRODUCTION TO DNA You've probably heard the term a million times. You know that DNA is something inside cells; you probably know that DNA has something to do with who we are and how we get to look the

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

DNA is a double helix with two sugar phosphate backbones and nucleotide bases bridging the two chains.

DNA is a double helix with two sugar phosphate backbones and nucleotide bases bridging the two chains. BENG 100 Frontiers of Biomedical Engineering Professor Mark Saltzman Chapter 3 SUMMARY Nucleic acids are linear polymers made up of monomer units called nucleotides. Each nucleotide is composed of a pentose

More information

Ch 16 and Introduction of Ch 17. This PowerPoint is posted. Replication Transcription Translation Protein!

Ch 16 and Introduction of Ch 17. This PowerPoint is posted. Replication Transcription Translation Protein! Ch 16 and Introduction of Ch 17 This PowerPoint is posted. Replication Transcription Translation Protein! In the start of things lin the 1950 s scientists knew that chromosomes carry hereditary material

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information