DNA. Form and Function

Transcription

1 DNA Form and Function

2 DNA: Structure and replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork for understanding the principles of heredity R R 0 R0 R0 0 R0 R0 R 0 R RR R0 0 R0 00 Understanding DNA structure and replication is a prerequisite for understanding/using the principal tools of molecular biology

3 DNA: Structure and replication Three features of DNA makes it an ideal genetic material 1. Faithful replication 2. Information content 3. Capable of change

4 The building blocks of DNA Nucleotides overall structure

5 The building blocks of DNA Nucleotides bases

6 The building blocks of DNA Nucleotides - bases

7 The building blocks of DNA Nucleotides + nucleotides = polynucleotides

8 The building blocks of DNA Complementary base pairing and the double helix

9 DNA replication is semiconservative

10 Requirements for DNA synthesis 1. DNTPs: datp, dgtp, dttp, and dctp 2. Template DNA (a pre-existing single strand) 3. DNA polymerase 1

11 Requirements for DNA synthesis 2. Template DNA (a pre-existing single strand) ATCGGTCAACGTTAAAGTTAGCGG

12 Requirements for DNA synthesis 3. DNA polymerase(s) 1. There are multiple forms of DNA polymerase 2. The different polymerases have different activities those with direct roles in replication are called replicases. Others have secondary roles in replication and/or repair synthesis. 3. In DNA replication polymerases catalyze the polymerization of deoxyribonucleotides into a DNA chain via the formation of a phosphodiester bond between the 3'-OH of the deoxyribose on the last nucleotide and the 5' phosphate of the dntp precursor.

13 Requirements for DNA synthesis 3. DNA polymerase(s) (continued) 4. Polymerase is bound to the DNA and moves along template the strand as polynucleotide chain grows. Thus, the dntp precursor is identified that can base pair with the nucleotide on the template DNA. The frequency of error is low, but errors can occur. 5. Polymerases can have exonuclease activity (they can remove nucleotides from the 3' end of the chain). This is a proofreading mechanism. The presence of an unpaired nucleotide from the 3'OH end of the growing chain triggers exonuclease activity: the unpaired nucleotide is cleaved from the end of the growing chain by the polymerase.

14 The essentials of DNA synthesis: Point: replication is 5' to 3'

15 The essentials of DNA synthesis: Point: replication is 5' to 3'

16 The essentials of DNA synthesis: Point: replication is 5' to 3'

17 The essentials of DNA synthesis: Point: replication is 5' to 3'

18 The essentials of DNA synthesis: Point: replication is 5' to 3'

19 The essentials of DNA synthesis: Point: replication is 5' to 3'

20 Details of DNA replication 1. Replication begins at a fixed point, called the origin, and proceeds bi-directionally. In a higher plant chromosome there are thousands of origins. Consider The size of the genome The rate of DNA replication The length of the S phase

21 Details of DNA replication: Origins

22 Details of DNA replication: Origins

23 Details of DNA replication: Origins

24 Details of DNA replication: Origins

25 Details of DNA replication 2. Unwinding: The DNA helix needs to be opened up. This is accomplished by helicase enzymes, which break the hydrogen bonds holding the two strands of the helix together. 3. Stabilization: The unwound DNA is stabilized by a protein (single strand binding protein (SSB)).

26 4. Priming: DNA polymerases can extend a chain, but they cannot start one. The RNA primers are later removed by exonuclease activity of a polymerase and replaced with DNA.

27 4. Leading and lagging strands: DNA polymerases synthesize new chains only from 5' to 3', yet the DNA molecule is antiparallel and DNA synthesis is semi-conservative. Therefore, DNA synthesis is continuous on one strand (the leading strand) and discontinuous on the other strand (the lagging strand). The DNA on the lagging strand is thus formed in fragments, called Okazaki fragments.

28 Leading and lagging strands

29 Leading and lagging strands

30 Leading and lagging strands

31 Leading and lagging strands

32 Leading and lagging strands

33 Leading and lagging strands

34 Leading and lagging strands

35 6. Editing: Some polymerases have 3'-5' exonuclease activity. This allows these enzymes to "search" for mismatched bases that were incorrectly added during polymerization and removes them. This proofreading function occurs at the 3' end of the growing strand and proceeds 3' 5'.

36 Summary of DNA replication...and more on RNA primers In the lagging strand the DNA Pol I exonuclease removes the RNA Primers. The gaps are closed by DNA Polymerase (adds complementary nucleotides to the gaps) and DNA Ligase (adds phosphate in the remaining gaps of the phosphate - sugar backbone).

37 Summary of DNA replication...and telomere shortening Termination of DNA Replication When DNA Polymerase reaches the end of the template lagging strand removal of the RNA primer leaves a gap that DNA Polymerase cannot fill. Therefore, with each replication event, the chromosome shortens Telomeres are at the ends of chromosomes, therefore telomeres shorten with each cell division. Unless there is telomerase..

38 The telomerase solution