N. Lannoy and C. Hermans FIX VIII FVIII FIX X X. Fig. 1. II Yekaterinburg
|
|
- Cornelius Watts
- 7 years ago
- Views:
Transcription
1 N Lannoy and C Hermans Centre de Génétique humaine; and Service d hématologie, Cliniques universitaires Saint-Luc, Brussels, Belgium 20 1 VIII FVIII A IX FIX B 1991 II FIX 4 B 20 II FIX X VIII FVIII IX FIX X X FVIII FIX Correspondence: Professor Cedric Hermans, MD, MRCP (UK), PhD, Haemostasis and Thrombosis Unit, Haemophilia Clinic, Division of Haematology, St-Luc University Hospital, Avenue Hippocrate 10, 1200 Brussels, Belgium Tel: ; fax: ; cedrichermans@uclouvainbe Haemophilia (2010), 16, Blackwell Publishing Ltd Fig XIII II Yekaterinburg 20
2 A B Albert of Saxe-Coburg I 1 2 II Edward VII Alice 4 5 Louis IV of Hesse Alfred 6 Helen 7 Louise 8 Arthur 9 Leopold Queen 10 Helena of Waldeck 11 Beatrice III English Royal Family Elisabeth Irène Henri de Ernest Frédéric Alexandra Prusse Nicolas II (tsar) Alexandre Alice (Espagne) 12 Henry of Battenberg Léopold Maurice IV Waldemar Henri Alexis Maurice Ruprecht Alphonse Beatriz Maria Cristina Juan Gonzalo Hemophilic male Carrier female Normal female Prussian Royal Family Russian Imperial Family Spanish Royal Family Normal male Elisabeth II Juan Carlos Fig 1 Queen, grandmother of Europe XIII XIII XIII II II A B Beatriz Fig 1 IV-14 IV II Yekaterinburg 21
3 Full Translation: N Lannoy and C Hermans DNA DNA 2 DNA DNA DNA DNA mtdna 2 Gill 1 DNA ,000 DNA mtdna II 3 Fig 2 II 2 DNA II 1 II 2 II = 3 mtdna II DNA II C/T T II mtdna Louise of Hesse-Kassel Queen Grand Duke George Czar Nicolas II Czarina Alexandra Duke of Fife Xenia Sfiris Olga Tatiana Maria Alexis Anastasia Prince Philip Duke of Edinburgh Study of mitochondrial DNA markers by Gill et al [1] allowing identification of the imperial couple and their three children Study of mitochondrial DNA markers by Gill et al [1] in the Romanov family and confirmed by AFDIL [3] Study of mitochondrial DNA markers by Ivanov et al [2] to establish the authenticity of the remains of Czar Nicolas II Study of mitochondrial DNA markers by AFDIL [3] allowing identification of the Grand Duchess Maria and the Czarevitch Alexis Fig 2 Mitochondrial DNA study in the Romanov family 22
4 A B II Evgeny Rogaev DNA Russian Academy of Sciences University of Massachusetts Armed Forces DNA Iden ti fica tion Laboratory Gregor Mendel Institute mtdna DNA Y Edouard Rossel II DNA DNA Rogaev Russian Academy of Medical Sciences 5 DNA 117 bp Illumina Genome Analyzer FVIII 26 FIX 8 32 PCR 180 FVIII 22 1 DNA FIX 4 3 bp A > G - IVS3-3A > G Fig 3 DNA RNA RNA mrna 5,500 mrna 9998 B FIX 1 B X X 23
5 Full Translation: N Lannoy and C Hermans (a) (c) (b) Fig 3 Presence of a mutation at the splice acceptor site of exon 4 (a) Schematic representation of the eight exons of the F9 gene, as well as the localization of primers having allowed the amplification of exons coding for the gene (b) Detail of the intron/exon junction of exon 4 In position 3 as compared to the beginning of the exon 4 sequence on the 5 3 fragment, in the DNA of Czarevitch Alexis, the A nucleotide normally present has been replaced by a G This substitution creates a new cryptic splice acceptor site which produces an aberrant frameshift transcript that results in a stop 11 codons downstream (c) Among the Imperial coupleõs four daughters, the IVS-3A > G genetic anomaly is found at the heterozygote state only in Anastasia, confirming that she was a haemophilia carrier DNA FIX B References 1 Gill P, Ivanov PL, Kimpton C et al Identification of the remains of the Romanov family by DNA analysis Nat Genet 1994; 6: Ivanov PL, Wadhams MJ, Roby RK, Holland MM, Weedn VW, Parsons TJ Mitochondrial DNA sequence heteroplasmy in the Grand Duke of Russia Georgij Romanov establishes the authenticity of the remains of Tsar Nicholas II Nat Genet 1996; 12: Report_26_Feb_09 AFDIL_pdf Accessed February 26, Rogaev EI, Grigorenko AP, Moliaka YK et al Genomic identification in the historical case of the Nicholas II royal family Proc Natl Acad Sci USA 2009; 106: Rogaev EI, Grigorenko AP, Faskhutdinova G, Kittler EL, Moliaka YK Genotype analysis identifies the cause of the royal disease Science 2009; 326: 817 [Epub 8 October 2009] 6 =SUSTITUTION Accessed March 23, version 13,
Hemophilia: The Royal Disease
Hemophilia: The Royal Disease by Yelena Aronova-Tiuntseva and Clyde Freeman Herreid University at Buffalo State University of New York Hemophilia is an X-linked recessive disorder characterized by the
More informationRecovering the Romanovs
Recovering the Romanovs ACTIVITY 1 The Romanov Family: Screen #4 Inheritance of a Sex-linked Trait Key: H=normal allele; h=hemophilia allele; X=X chromosome; Y=Y chromosome 1. Use a Punnett square to show
More informationRecovering the Romanovs
Recovering the Romanovs Description of activity Recovering the Romanovs is an excellent opening to any unit on human genetics. To complete the three parts of this module, approximately three 40-minute
More informationName: 4. A typical phenotypic ratio for a dihybrid cross is a) 9:1 b) 3:4 c) 9:3:3:1 d) 1:2:1:2:1 e) 6:3:3:6
Name: Multiple-choice section Choose the answer which best completes each of the following statements or answers the following questions and so make your tutor happy! 1. Which of the following conclusions
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationMitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More informationDNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
More informationTwo copies of each autosomal gene affect phenotype.
SECTION 7.1 CHROMOSOMES AND PHENOTYPE Study Guide KEY CONCEPT The chromosomes on which genes are located can affect the expression of traits. VOCABULARY carrier sex-linked gene X chromosome inactivation
More informationAP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationDNA Profiling in Forensic Science
DNA Profiling in Forensic Science Peter Gill, Forensic Science Service, Birmingham, UK Rebecca Sparkes, Forensic Science Service, Birmingham, UK Gillian Tully, Forensic Science Service, Birmingham, UK
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationGene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationGenetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationThe NF1-gene a hotspot for de novo Alu- and L1-insertion?
The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationsomatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
More informationTest Two Study Guide
Test Two Study Guide 1. Describe what is happening inside a cell during the following phases (pictures may help but try to use words): Interphase: : Consists of G1 / S / G2. Growing stage, cell doubles
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationSICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationUsefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers
J. Appl. Genet. 44(3), 2003, pp. 419-423 Short communication Usefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers Bohdan GÓRSKI,
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationY Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
More informationProtein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
More informationRules for conducting ISAG Comparison Tests (CT) for animal DNA testing.
Rules for conducting ISAG Comparison Tests (CT) for animal DNA testing. DEFINITIONS Society = ISAG Secretary Executive Committee Conferences Workshops Standing Committee Chair Institutional members Reference
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationUsing Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More informationGene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationValidation and Replication
Validation and Replication Overview Definitions of validation and replication Difficulties and limitations Working examples from our group and others Why? False positive results still occur. even after
More informationAlpha-1 Antitrypsin Deficiency A future NBS candidate?
Alpha-1 Antitrypsin Deficiency A future NBS candidate? Robert A. Sandhaus, MD, PhD Alpha-1 Antitrypsin Deficiency Condition: Alpha-1 antitrypsin deficiency, alpha-1 proteinase inhibitor deficiency, Alpha-1,
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationUse of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application
Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville
More informationSEQUENCING INITIATIVE SUOMI (SISU) SYMPOSIUM SPEAKERS August 26, 2014
SEQUENCING INITIATIVE SUOMI (SISU) SYMPOSIUM SPEAKERS August 26, 2014 Professor Aarno Palotie Professor Aarno Palotie is the Research Director of the Human Genomics program at the Finnish Institute for
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More informationLuísa Romão. Instituto Nacional de Saúde Dr. Ricardo Jorge Av. Padre Cruz, 1649-016 Lisboa, Portugal. Cooper et al (2009) Cell 136: 777
Luísa Romão Instituto Nacional de Saúde Dr. Ricardo Jorge Av. Padre Cruz, 1649-016 Lisboa, Portugal Cooper et al (2009) Cell 136: 777 PTC = nonsense or stop codon = UAA, UAG, UGA PTCs can arise in a variety
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationDifficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
More informationThe Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins
The Future of the Electronic Health Record Gerry Higgins, Ph.D., Johns Hopkins Topics to be covered Near Term Opportunities: Commercial, Usability, Unification of different applications. OMICS : The patient
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationDevelopment of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
More informationSanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationDesign of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationSequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction
Sequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction Michael Motz*, Gregor Sagner 1, Svante PaÈaÈbo and Christian Kilger 2 Nucleic Acids Research, 2003, Vol.
More informationReverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationInformation leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel
Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design
More informationCoordination entre réplication et transcription: organisation du génome humain
Coordination entre réplication et transcription: organisation du génome humain Claude Thermes Centre de Génétique Moléculaire, CNRS, Gif-sur-Yvette, FRANCE 23/09/2009 REPLICATION AND GENOME ORGANIZATION
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationD-Loop-BASE is online now Central European database of mitochondrial DNA
International Congress Series 1239 (2003) 505 509 D-Loop-BASE is online now Central European database of mitochondrial DNA Holger Wittig a, *, Mike Koecke b, Kai-Uwe Sattler b, Dieter Krause a a Institute
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationFlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
More informationBasic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
More information