EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN
|
|
- Isaac Kelley
- 7 years ago
- Views:
Transcription
1 DATA SUPPLEMENT EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN EARLY SQUAMOUS CELL CARCINOMA OF THE LUNG María J. Pajares et al. PATIENTS AND METHODS Validation of antibody specificities 1) Normal IgG (from the same species as the primary antibodies) or omission of the primary antibody was used as a negative control in the immunohistochemical technique. 2) Adsorption controls with the homologous VEGF and VEGFR1 antigens. Solutions containing specific antiserum (anti-vegfa and anti-vegfr1) were pre-incubated with the respective peptides (VEGFA: A-20 sc-152-p; and VEGFR1: C-17 sc-316-p, Santa Cruz Biotechnology) and applied to the sample instead of the primary antiserum. Subsequently, the immunohistochemistry procedure was performed. The adsorption control for VEGFR2 was not performed since the peptide was not commercially available. 3) Validation of the patterns of VEGF, VEGFR1, and VEGFR2 expression using different antibodies. For each marker, immunohistochemical techniques using different antibodies were performed in 30 randomly selected samples (10% of the tumors from the EUELC series). The validation antibodies were anti-vegfa (Ab-3 JH121, mouse monoclonal IgG, 1:100; Neomarkers,
2 Freemon, CA, USA), anti-vegfr1 (Ab-1, rabbit polyclonal IgG, 1:25; Neomarkers) and anti-vegfr2 (Ab-1, rabbit polyclonal IgG, 1:50; Neomarkers). The immunohistochemical method was identical to that previously described aside from the antigen retrieval. For VEGF, the antigen immunoreactivity was enhanced by microwaving the sections in a solution of ethylenediaminetetraacetic acid (1 mm EDTA, ph 8) for 2 x 10 min. For VEGFR1 and VEGFR2, antigen retrieval was performed in citrate buffer (10 mm, ph 6) for 2 x 15 min. 4) Western blot analysis. Proteins were extracted from tumor tissue blocks in the immediate vicinity of those studied by immunohistochemistry. Immunoblotting experiments were performed with the same antibodies used for immunostaining. Dilution of the primary antibodies was 1:200. To ensure equal loading and transfer of proteins, the membranes were subsequently probed with a polyclonal anti-actin antibody (1:500; Sigma-Aldrich). 5) sirna inhibition. Lung cancer cell lines were transfected with sirnas for VEGF, VEGFR1, and VEGFR2 (Dharmacon). The sequences of the sirnas were: VEGF: GAUCUCAUCAGGGUACUCCUU UGUCUUGCUCUAUCUUUCUUU VEGFR1: UAACAUGAAACCCAUUUGGUU UAACCAUACAACUUCCGGCUU, VEGFR2: UAGCUUGCAAGAGAUUUCCUU UAAAUGGAGAUCUGUAAUCUU Downregulation of the proteins was demonstrated by Western blot analysis and immunohistochemistry.
3 6) Validation of the immunohistochemical and quantification methods. Automatic immunohistochemical and semiquantification procedures were crossvalidated in 10% of the cases by an independent investigator (EB). RESULTS The vascular staining of VEGFR1 and 2 was used as an internal positive control (Figure S1). The specificity of antibodies used for immunohistochemistry was assessed using different technologies. Experiments with omission of the primary antibodies or incubation of samples with species and isotype-matched antibodies were performed in tumor samples in parallel with regular antibody incubation. These controls demonstrated no immunoreactivity (data not shown). Also, adsorption controls for VEGF and VEGFR1 rendered no staining (Figure S2). In order to verify the staining pattern of the antibodies, 10% of the tumor samples (30 patients) were stained with antibodies developed by another company (Neomarkers). This analysis revealed concordance greater than 80% for VEGF, VEGFR1, and VEGFR2 expression. Moreover, Western blot analysis was performed to confirm the molecular weight of the detected proteins. We found that the anti-vegf antibody recognized the three most common isoforms of VEGF (VEGF 121, VEGF 165 and VEGF 189 ) (Figure S3A), as previously reported 1. The antibody for VEGFR1 recognized a unique band of 180 kda (Figure S3B). In the case of VEGFR2, the antibody detected the unglycosylated form at 150 kda, the partially glycosylated form at 200 kda, and the fully glycosylated mature form at 230 kda (Figure S3C). Finally, sirna technology was used to validate our antibodies. VEGF, VEGFR1, and VEGFR2 were downregulated with specific sirnas and the expression of these proteins was
4 assessed by immunohistochemical and Western blot analysis. Low VEGF, VEGFR1, and VEGFR2 expression was demonstrated in the sirna transfected cells compared with the cells transfected with a scramble sirna, using both immunohistochemistry (Figure S4) and immunoblotting analysis (Figure S5). All of the controls strongly supported the specificity of the antibodies used in this study. Moreover, the immunohistochemical procedure and the semiquantification method were cross-validated in 10% of the cases. Concordance greater than 85% was found for all of the markers.
5 FIGURES Figure S1: Stromal (arrows) and endothelial cells (arrowheads) showed immunoreactivity for VEGFR1 and VEGFR2 in ADC (A, B) and SCC (C, D). The vascular staining of the VEGF receptors was used as an internal positive control for the immunohistochemical technique. Scale bar: 50 µm.
6 Figure S2: The specificity of the antibodies used for immunohistochemistry was demonstrated by adsorption controls. Immunoreactivity for VEGF (A) and VEGFR1 (C) was assessed in sections of tumor samples. Adsorption controls for VEGF and VEGFR1 were carried out in serial sections by preincubation (overnight at 4 ºC) of the primary antiserum at optimal dilution with the corresponding peptide: VEGF: A-20 sc-152-p (B), or VEGFR1: C-17 sc-316 P (D). Scale bar: 50 µm.
7 A. VEGF B. VEGFR1 C. VEGFR Figure S3: Western blot analysis in lung tumor samples demonstrated the specificity of the antibodies. (A) Western blotting for VEGF detected VEGF 121, VEGF 165 and VEGF 189 isoforms (B) The antibody for VEGFR1 recognized a unique band of 180 kda. (C) Western blot analysis for VEGFR2 showed 3 immunoreactive bands corresponding to the fully glycosylated mature form of VEGFR2 (230 kda), the partially glycosylated form (200 kda) and the unglycosylated form (150 kda).
8 A B C D E F Figure S4: sirna inhibition of VEGF, VEGFR1 and VEGFR2 was demonstrated by immunohistochemistry. VEGF (A-B), VEGFR1 (C-D), and VEGFR2 (E-F) expression was evaluated in NSCLC cells transfected with sirna targeting VEGF (NCI-H157), VEGFR1 (NCI-H727) and VEGFR2 (NCI-H358), respectively. Scale bar: 50 µm.
9 A. VEGF scr sirna B. VEGFR2 scr sirna Figure S5: Western blot analysis using the specific antibodies showed the downregulation of VEGF (A) and VEGFR2 (B) in sirna treated NSCLC cells (NCI-H157 and NCI-H358 respectively). Scr: scramble.
10 TABLES Table S1: Biomarker risk factors of disease progression for the EUELC series DF PD Median Cutoff No. of Patients % No. of Patients % Hazard Ratio* 95% CI P VEGF > to VEGFR > to VEGFR > to VSS > to MVD > to * Fine and Gray hazard ratio and P value for disease progression risk adjusted by pt, pn and smoking duration. CI, confidence interval; DF, disease-free; HR, hazard ratio; MVD, microvessel density; PD, progression disease; VSS, VEGF signaling score.
11 Table S2: Biomarker risk factors of disease progression for Stage I SCC patients of the EUELC series DF PD Median Cutoff No. of Patients % No. of Patients % Hazard Ratio* 95% CI P VEGF > to VEGFR > to VEGFR > to VSS > to MVD > to *Fine and Gray hazard ratio and P value for disease progression risk adjusted by smoking duration. CI: confidence interval; DF: disease-free; HR: hazard ratio; MVD: microvessel density; PD: progression disease; VSS: VEGF signaling score.
12 Table S3: Biomarker risk factors of disease progression for Stage I SCC patients of the MD Anderson series. Multivariate analysis of prognostic factors. DF PD Median Cutoff No. of Patients % No. of Patients % Hazard Ratio* 95% CI P VEGF > to VEGFR > to VEGFR > to VSS > to * Fine and Gray hazard ratio and P value for disease progression risk adjusted by pn, pt, sex, age and smoking status. CI: confidence interval; DF: disease-free; HR: hazard ratio; MVD: microvessel density; PD: progression disease; VSS: VEGF signaling score.
13 REFERENCES 1. Catena R, Larzabal L, Larrayoz M, et al: VEGF 121 b and VEGF 165 b are weakly angiogenic isoforms of VEGF-A. Molecular cancer 9: , 2010
CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy
CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy Joseph M. Tuscano, Jason Kato, David Pearson, Chengyi Xiong, Laura Newell, Yunpeng Ma, David R. Gandara,
More informationInflammatory Cytokine-induced Expression of Vasohibin-1 by Rheumatoid Synovial Fibroblasts
9 6 6 958 Inflammatory Cytokine-induced Expression of Vasohibin- by Rheumatoid Synovial Fibroblasts a b c a a a a d e a* a a b c d e 5 6 6 9 5 56 67 7 ʼ ʼ ʼ ʼ ʼ ʼ ʼ ʼ 5 6 6 ʼ 5 75 989 6 69 8 95 56 56896
More informationAPPLICATION FOCUS. Application Solutions for Western Blotting
APPLICATION FOCUS Application Solutions for Western Blotting WESTERN BLOTTING Companion Products Solutions for consistently better blotting. Companion products from Cell Signaling Technology (CST) are
More informationSUPPLEMENTARY DATA 1
SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut
More informationhydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1
SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5
More informationChapter 2 Antibodies. Contents. Introduction
Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining
More informationProtein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western).
Western Blot SOP Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Date: 8/16/05, 10/31/05, 2/6/06 Author: N.Oganesyan, R. Kim Edited by: R. Kim Summary:
More informationWestern Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
More informationHigh Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B. PEPperPRINT GmbH Heidelberg, 06/2014
High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B PEPperPRINT GmbH Heidelberg, 06/2014 Introduction This report describes the epitope mapping of autoimmune sera
More informationPROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 www.mitosciences.com
PROTOCOL Western Blotting Transfer and Detection Procedure 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 02-11 DESCRIPTION Western Blotting Transfer and Detection Procedure ADDITIONAL MATERIALS REQUIRED
More informationSuperior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
More informationWestern Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com
Western Blotting All steps are carried out at room temperature unless otherwise indicated. Recipes for all solutions highlighted bold are included at the end of the protocol. SDS-PAGE 1. Construct an SDS-PAGE
More informationApproaches that can be used to study expression of specific proteins
Approaches that can be used to study expression of specific proteins Receptors and transporters Homogenate binding studies Receptor autoradiography Radiochemical Western blotting Immunohistochemistry/cytochemistry
More informationCustom Antibody Services
prosci-inc.com Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading
More informationChIP TROUBLESHOOTING TIPS
ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-
More informationOptimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,
More informationHumoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth
Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth Kouki Hidaka *1, Chihiro Miyamoto *2, Satoko Wada-Takahashi
More informationTHE His Tag Antibody, mab, Mouse
THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI
More information1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages
1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly
More informationProteomics Research with BIOCHAIN
Proteomics Research with IOCHIN Protein Extraction CNMCS Compartmental Protein Extraction Kit Cytoplasmic, Nuclear, Membrane, and Cytoskeleton Protein One kit isolates four different proteins sequentially
More informationProduct Datasheet and Instructions for Use
Product Code: MP-378-CMK01 (0.1ml conc) MP-378-CMK05 (0.5ml conc) MP-378-PM6 (6ml RTU) Product Description: CD141 (Thrombomodulin) Concentrated and Prediluted Monoclonal Antibody Control Number: 901-378-071709
More informationSupplemental Information. McBrayer et al. Supplemental Data
1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were
More informationCustom Antibodies Services. GeneCust Europe. GeneCust Europe
GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 6 rue Dominique Lang L-3505 Dudelange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com
More informationThe Value of Thyroid Transcription Factor-1 in Cytologic Preparations as a Marker for Metastatic Adenocarcinoma of Lung Origin
Anatomic Pathology / TTF-1 IN CYTOLOGY OF BODY FLUIDS The Value of Thyroid Transcription Factor-1 in Cytologic Preparations as a Marker for Metastatic Adenocarcinoma of Lung Origin Jonathan L. Hecht, MD,
More informationHypoxyprobe -1 Plus Kit Kit contents:
Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated
More informationElabscience Biotechnology Co.,Ltd
Biotechnology Co.,Ltd Your one-stop custom antibody service Antibody is a kind of protein that is the most widely used in the fields of biology and medicine. Antibodies, as the preparations for disease
More informationUpdate on Mesothelioma
November 8, 2012 Update on Mesothelioma Intro incidence and nomenclature Update on Classification Diagnostic specimens Morphologic features Epithelioid Histology Biphasic Histology Immunohistochemical
More informationAntibodies Against Fluorescent Proteins
Antibodies Against Fluorescent Proteins Section C - A collection of antibodies for the detection of Evrogen Fluorescent Proteins in different applications. Contents Overview............................................
More informationHow To Get A Cell Print
QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH
More informationCD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry
CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating
More informationSupplemental Fig. S1. The schematic diagrams of the expression constructs used in this study.
1 Supplemental data Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. Supplemental Fig. S2. Ingenuity Pathway Analysis (IPA) of the 56 putative caspase substrates
More informationWESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE
WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TIPS FOR SUCCESSFUL WESTERB BLOTS TROUBLESHOOTING GUIDE 1. Suboptimal protein transfer. This is the most common complaint with western blotting and could
More informationRapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1
Supporting Online Material for Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1 Birgit Schulze, Tobias Mentzel, Anna Jehle,
More informationCovalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105
Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Background Gold nanoparticle conjugates have been widely used in biological research and biosensing applications.
More informationPrinciples of Immunohistochemistry Queen s Laboratory For Molecular Pathology
Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Table of Contents POLYCLONAL VERSUS MONOCLONAL ANTIBODIES...PAGE 3 DIRECT & INDIRECT ASSAYS.PAGE 4 LABELS..PAGE 5 DETECTION...PAGE
More informationAntibody Production Price List
Antibody Production Price List Presenting Insight Biotechnology s price list for custom polyclonal and monoclonal antibody production services. We are happy to tailor individual packages towards the specific
More informationAviva Systems Biology
Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein
More informationCUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation
CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.
More informationWESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB)
WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB) WESTERN BLOT FOR ANALYSIS ON LICOR ODYSSEY SCANNER. 1) The Licor Odyssey protein marker is optimal as it is visible on channel 700 (2ul is enough
More informationSupporting Information
Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).
More informationJ. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material
Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all
More informationNotch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
More informationACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46. Cell Signaling. Ki-67 Clon MIB-1 from Dako. AntiBrdU (B2531), α Tubulin
Supplemental materials and methods Antibodies and reagents ACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46 (#9459), pakt Ser473 (#4051), pampk Thr172 (#2535), pacc Ser79 (#3661),
More informationMAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project
Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production
More informationProtocol for Western Blotting
Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol
More informationP4 Distribution of Cetuximab in Models of Human Lung Cancer
Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, University of Tübingen, Robert Bosch Foundation Stuttgart, Germany FORSYS Partner Project Predictive Cancer Therapy Project Meeting 14.10.09
More informationKMS-Specialist & Customized Biosimilar Service
KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal
More informationKinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues,
Kinexus Bioinformatics Corporation is seeking to map and monitor the molecular communications networks of living cells for biomedical research into the diagnosis, prognosis and treatment of human diseases.
More informationELITE Custom Antibody Services
ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to
More informationChapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions
Chapter 6 Antigen-Antibody Interactions: Principles and Applications Antigen-Antibody Properties You must remember antibody affinity (single) VS avidity (multiple) High affinity: bound tightly and longer!
More informationHow To Use Calretinin
Product Code: MP-092-CR01 (0.1ml concentrate) MP-092-CR05 (0.5ml concentrate) MP-092-CR1 (1ml concentrate) MP-092-PR6 (6ml RTU) Product Description: Calretinin Concentrated and Prediluted Polyclonal Antibody
More informationNormal values of IGF1 and IGFBP3. Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A.
Normal values of IGF1 and IGFBP3 Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A. Agenda of the presentation IGF1 and IGFBP3 basic characteristic Why normal values Groups of the persons and
More information510 (k) Summary DESCRIPTION OF DEVICE: Intended Use
510 (k) Summary Asymmetm, Inc. 117 Senate Brook Drive Arnston, CT 06231 (860) 716-8888 Contact Person: Maria McKeon Date Summary Prepared: February 4,2005 Name of Device: 1. ProprietaryITrade Name: Prostate-63
More informationBio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services
Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production Life Science Products and Services Since 2002, Biomatik has provided worldwide researchers in life science discovery
More informationGeniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody
Geniron Custom Antibody Services Serum services Antibody Monoclonal Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Poly Y WE PROVIDE OUR SERVICES TO With Expertise
More informationMethionine Sulfoxide Immunoblotting Kit
Methionine Sulfoxide Immunoblotting Kit Item No. 600160 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions
More informationECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015.
Technical Manual ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. PRINTED IN USA. 6/09 ECL Western Blotting Substrate All technical literature is available on the Internet
More informationAviva Systems Biology
Aviva Custom Antibody Services and Prices Rabbit Polyclonal Antibody Service Package Number Description Package Contents Time Price Polyclonal package 1 (From protein to antiserum) Polyclonal package 2
More informationPredict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%)
Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :
More informationBiology 309 Lab Notebook
Name: Biology 309 Lab Notebook This is a guided lab notebook for you to keep well-organized notes about procedures and record experimental data for experiments as they are performed. It is guided because,
More informationP R O D U C T S CATALOG 2011-2012
P R O D U C T S CATALOG 2011-2012 INSTITUTE FOR THE APPLICATION OF NUCLEAR ENERGY - INEP Banatska 31b 11080 Zemun Belgrade Serbia Tel: (+381 11) 2619 252, 2618 696, 2199 949 Fax: (+381 11) 2618 724 www.inep.co.rs
More informationProduct name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930
SDS-PAGE and western blot for low molecular weight proteins (2-20kDa) Merav Marom Shamur, Smart Assays Aim: Analysis of low molecular weight proteins by SDS-PAGE and western blot under reducing conditions.
More information20 Diagnostic Cytopathology, Vol 36, No 1 ' 2007 WILEY-LISS, INC.
Utility of WT-1, p63, MOC31, Mesothelin, and Cytokeratin (K903 and CK5/6) Immunostains in Differentiating Adenocarcinoma, Squamous Cell Carcinoma, and Malignant Mesothelioma in Effusions Robert T. Pu,
More informationCustom Antibodies & Recombinant Proteins
Custom Antibodies & Recombinant Proteins INTRODUCTION Custom services to meet your research and development requirements Improvements in health, medicine and diagnostics over the past century can be largely
More informationProtein Analysis. -Detection and quantification. Toby M Holmes
Protein Analysis -Detection and quantification Toby M Holmes Clinical Research Unit UCD school of Medicine and Medical Sciences Mater Misericordiae University Hospital Dublin Protein structure General
More informationDetection and staging of recurrent prostate cancer is still one of the important clinical problems in prostate cancer. A rise in PSA or biochemical
Summary. 111 Detection and staging of recurrent prostate cancer is still one of the important clinical problems in prostate cancer. A rise in PSA or biochemical recurrence (BCR) is the first sign of recurrent
More informationTissue Cross-Reactivity of QRX-111 with Human, Cynomolgus Monkey and Rat Tissues in Vitro
Nova Pathology, PC Tissue Cross-Reactivity Pathology Report Tissue Cross-Reactivity of QRX-111 with Human, Cynomolgus Monkey and Rat Tissues Nova Pathology Study Number: NP-12-S-004 Testing Facility Study
More informationAdvanced BioDesign Outlines Solutions. Antibody Overview. by Advanced BioDesign. Project Start. Immunogenicity. Selecting Your Antigen
Advanced BioDesign Outlines Solutions by Advanced BioDesign Antibody Overview Launching an immunisation programme is an important experimental step that needs care. With Advanced BioDesign, you may develop
More informationProtein immunoblotting
Protein immunoblotting (Western blotting) Dr. Serageldeen A. A. Sultan Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt seaas@lycos.com Western blotting -It is an analytical technique used to
More informationLANCE Eu-labeled antibodies for serine/threonine kinase assays
AD0078P-1 (en) 1 LANCE Eu-labeled antibodies for serine/threonine kinase assays For Research Use Only These instructions for use apply to the following reagents: AD0094 LANCE Eu-W1024 phospho-threonine
More informationTECHNICAL BULLETIN. FluoroTag FITC Conjugation Kit. Product Number FITC1 Storage Temperature 2 8 C
FluoroTag FITC Conjugation Kit Product Number FITC1 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description The FluoroTag FITC Conjugation Kit is suitable for the conjugation of polyclonal and
More informationChanges in Breast Cancer Reports After Second Opinion. Dr. Vicente Marco Department of Pathology Hospital Quiron Barcelona. Spain
Changes in Breast Cancer Reports After Second Opinion Dr. Vicente Marco Department of Pathology Hospital Quiron Barcelona. Spain Second Opinion in Breast Pathology Usually requested when a patient is referred
More informationTherapeutic Systems Immunology
Therapeutic Systems Immunology Coordination: Robert Preissner, Charité, Berlin 13 Partners from Berlin (7) Göttingen (1) Heidelberg (1) Rostock (2) Tübingen (1) Overview Intro / Mission Partners Systems
More informationAnti-ATF6 α antibody, mouse monoclonal (1-7)
Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.
More informationPeak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion
Supplemental table 1. The completeness of trypsin digestion of the signature peptides with native flanking sequence. The signature peptides with native flanking sequence were digested with trypsin as described
More informationChromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
More informationWestern BLoT Immuno Booster
Cat. # T7111A For Research Use Western BLoT Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Materials Required but Not Provided... 3 V. Precautions... 3 VI.
More informationFluorescein Isothiocyanate (FITC)- conjugated Antibodies
USER GUIDE Fluorescein Isothiocyanate (FITC)- conjugated Antibodies Catalog Numbers R933-25, R953-25, R963-25 Document Part Number 25-0376 Publication Number MAN0000194 Revision 2.0 For Research Use Only.
More informationDesigning Assays for the TaqMan Protein Assay
Designing Assays for the TaqMan Protein Assay Antibody Selection...2 Assay Design...2 Antibody Search...3 Biotinylated Antibodies...3 Working with pre-biotinylated antibodies...4 Working with non-biotinylated
More informationChapter 3 Contd. Western blotting & SDS PAGE
Chapter 3 Contd. Western blotting & SDS PAGE Western Blot Western blots allow investigators to determine the molecular weight of a protein and to measure relative amounts of the protein present in different
More informationWESTERN BLOT DETECTION KIT Buffers and detection reagents for up to ten 10 x 10 cm 2 blots. Fluorescent detection via: Goat anti-mouse SureLight P3
WESTERN BLOT DETECTION KIT Buffers and detection reagents for up to ten 10 x 10 cm 2 blots Fluorescent detection via: Goat anti-mouse SureLight P3 Cat. #: WK-P112 6440 Dobbin Road, Suite D Phone (443)
More informationFAK phospho S732 Antibody, Rabbit Polyclonal Antibody
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Tel: (858)458-0866 Fax: (858)458-0833 sales@genwaybio.com FAK phospho S732 Antibody, Rabbit Polyclonal Antibody Catalog Number: 18-272-197354
More informationImmunohistochemistry. Services & Products. Indivumed GmbH Falkenried 88, Bldg. D 20251 Hamburg Germany
Services & Products Indivumed GmbH Falkenried 88, Bldg. D 20251 Hamburg Germany Phone Europe: +49-40-41 33 83-0 Fax Europe: +49-40-41 33 83-14 Phone USA: +1-301-588-4650 info@indivumed.com www.indivumed.com
More informationPreparation of a phosphotyrosinylated protein standard for 2D gel western blotting
Preparation of a phosphotyrosinylated protein standard for 2D gel western blotting Nancy Kendrick, Matt Hoelter, Andrew Koll, and Jon Johansen Kendrick Labs, Inc, Madison, WI www.kendricklabs.com Introduction
More informationA 6-Antibody Panel for the Classification of Lung Adenocarcinoma Versus Squamous Cell Carcinoma
RESEARCH ARTICLE A 6-Antibody Panel for the Classification of Lung Adenocarcinoma Versus Squamous Cell Carcinoma David Tacha, PhD,* Charie Yu, MD,* Ryan Bremer, PhD,* Weiman Qi, PhD,* and Thomas Haas,
More informationTargeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma
The Use of Kinase Inhibitors: Translational Lab Results Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma Sheelu Varghese, Ph.D. H. Richard Alexander, M.D.
More informationSupplemental Information for
Supplemental Information for Mechanism of Retinoic acid-induced transcription: histone code, DNA oxidation and formation of chromatin loops Candida Zuchegna 1, Fabiana Aceto 2, Alessandra Bertoni 3, Antonella
More informationImmunoblotting (Western blotting)
Immunoblotting (Western blotting) HIV Transfer to NC membrane membrane gel support buffer Dissociate in SDS Incubate with 1ary antiserum Separate by SDS-PAG Incubate w/ labeled 2nd ab Immunoblotting :
More informationInstructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
More informationClinical Histology Procedure Histo03.01 Automated Immunohistochemical Staining Utilizing the Ventana Benchmark Instrument
Clinical Histology Procedure Histo03.01 Automated Immunohistochemical Staining Utilizing the Ventana Benchmark Instrument Final Approval: May 2010 Effective: May 2010 Next Review Date: May 2012 List all
More informationPfizer Forms Global Alliance with Merck KGaA, Darmstadt, Germany to Accelerate Presence in Immuno-Oncology. November 17, 2014
Pfizer Forms Global Alliance with Merck KGaA, Darmstadt, Germany to Accelerate Presence in Immuno-Oncology November 17, 2014 Forward-looking statements Our discussions during this conference call will
More informationBasics of Immunology
Basics of Immunology 2 Basics of Immunology What is the immune system? Biological mechanism for identifying and destroying pathogens within a larger organism. Pathogens: agents that cause disease Bacteria,
More informationAnalysis of the adaptive immune response to West Nile virus
Analysis of the adaptive immune response to West Nile virus Jonathan Bramson (PI) Robin Parsons Alina Lelic Galina Denisova Lesley Latham Carole Evelegh Dmitri Denisov Strategy for characterizing T cell
More information竞 争 性 分 析 Epitope Mapping 实 验 方 法
竞 争 性 分 析 Epitope Mapping 实 验 方 法 ABSTRACT The simplest way to determine whether two monoclonal antibodies bind to distinct sites on a protein antigen is to carry out a competition assay. The assay can
More informationPharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE
Pharmaceutical Biotechnology Recombinant DNA technology Western blotting and SDS-PAGE Recombinant DNA Technology Protein Synthesis Western Blot Western blots allow investigators to determine the molecular
More information1st NordiQC Conference on Standardization in Applied Immunohistochemistry 2013 1
Hotel Hvide Hus, Aalborg, 4 th 7 th June 2013 Prof. Mogens Vyberg, NordiQC director Serial sections stained for Estrogen receptor Breast cancers stained for Estrogen receptor Why? 5 6 2013 1 Breast cancers
More informationWhite paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical
More informationTitering Antibodies INTRODUCTION Materials Procedure for titering antibodies to extracellular antigens A. Directly conjugated antibodies
C.C. Stewart, S.J. Stewart, Titering Antibodies. In: Current Protocols in Cytometry, (J.P. Robinson, Z. Darzynkiewicz, P. Dean. L. Dressler, P.Rabinovitch, C. Stewart, H. Tanke, L. Wheeless, eds.) J.Wiley
More informationDELFIA assays bring convenience in monoclonal antibody development
DELFIA DELFIA assays bring convenience in monoclonal development INTRODUCTION The DELFIA system provides a method of discovering specific, high-affinity monoclonal antibodies (Mabs) even in low concentrations
More informationAbout the Kits...2 Description 2 Components 2
Table of Contents About the Kits...2 Description 2 Components 2 Thrombin Cleavage...3 Small scale optimization 3 Scale-up 4 Factors that affect thrombin activity 4 Monitoring cleavage 5 Biotinylated Thrombin
More information