Size: px
Start display at page:



1 DATA SUPPLEMENT EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN EARLY SQUAMOUS CELL CARCINOMA OF THE LUNG María J. Pajares et al. PATIENTS AND METHODS Validation of antibody specificities 1) Normal IgG (from the same species as the primary antibodies) or omission of the primary antibody was used as a negative control in the immunohistochemical technique. 2) Adsorption controls with the homologous VEGF and VEGFR1 antigens. Solutions containing specific antiserum (anti-vegfa and anti-vegfr1) were pre-incubated with the respective peptides (VEGFA: A-20 sc-152-p; and VEGFR1: C-17 sc-316-p, Santa Cruz Biotechnology) and applied to the sample instead of the primary antiserum. Subsequently, the immunohistochemistry procedure was performed. The adsorption control for VEGFR2 was not performed since the peptide was not commercially available. 3) Validation of the patterns of VEGF, VEGFR1, and VEGFR2 expression using different antibodies. For each marker, immunohistochemical techniques using different antibodies were performed in 30 randomly selected samples (10% of the tumors from the EUELC series). The validation antibodies were anti-vegfa (Ab-3 JH121, mouse monoclonal IgG, 1:100; Neomarkers,

2 Freemon, CA, USA), anti-vegfr1 (Ab-1, rabbit polyclonal IgG, 1:25; Neomarkers) and anti-vegfr2 (Ab-1, rabbit polyclonal IgG, 1:50; Neomarkers). The immunohistochemical method was identical to that previously described aside from the antigen retrieval. For VEGF, the antigen immunoreactivity was enhanced by microwaving the sections in a solution of ethylenediaminetetraacetic acid (1 mm EDTA, ph 8) for 2 x 10 min. For VEGFR1 and VEGFR2, antigen retrieval was performed in citrate buffer (10 mm, ph 6) for 2 x 15 min. 4) Western blot analysis. Proteins were extracted from tumor tissue blocks in the immediate vicinity of those studied by immunohistochemistry. Immunoblotting experiments were performed with the same antibodies used for immunostaining. Dilution of the primary antibodies was 1:200. To ensure equal loading and transfer of proteins, the membranes were subsequently probed with a polyclonal anti-actin antibody (1:500; Sigma-Aldrich). 5) sirna inhibition. Lung cancer cell lines were transfected with sirnas for VEGF, VEGFR1, and VEGFR2 (Dharmacon). The sequences of the sirnas were: VEGF: GAUCUCAUCAGGGUACUCCUU UGUCUUGCUCUAUCUUUCUUU VEGFR1: UAACAUGAAACCCAUUUGGUU UAACCAUACAACUUCCGGCUU, VEGFR2: UAGCUUGCAAGAGAUUUCCUU UAAAUGGAGAUCUGUAAUCUU Downregulation of the proteins was demonstrated by Western blot analysis and immunohistochemistry.

3 6) Validation of the immunohistochemical and quantification methods. Automatic immunohistochemical and semiquantification procedures were crossvalidated in 10% of the cases by an independent investigator (EB). RESULTS The vascular staining of VEGFR1 and 2 was used as an internal positive control (Figure S1). The specificity of antibodies used for immunohistochemistry was assessed using different technologies. Experiments with omission of the primary antibodies or incubation of samples with species and isotype-matched antibodies were performed in tumor samples in parallel with regular antibody incubation. These controls demonstrated no immunoreactivity (data not shown). Also, adsorption controls for VEGF and VEGFR1 rendered no staining (Figure S2). In order to verify the staining pattern of the antibodies, 10% of the tumor samples (30 patients) were stained with antibodies developed by another company (Neomarkers). This analysis revealed concordance greater than 80% for VEGF, VEGFR1, and VEGFR2 expression. Moreover, Western blot analysis was performed to confirm the molecular weight of the detected proteins. We found that the anti-vegf antibody recognized the three most common isoforms of VEGF (VEGF 121, VEGF 165 and VEGF 189 ) (Figure S3A), as previously reported 1. The antibody for VEGFR1 recognized a unique band of 180 kda (Figure S3B). In the case of VEGFR2, the antibody detected the unglycosylated form at 150 kda, the partially glycosylated form at 200 kda, and the fully glycosylated mature form at 230 kda (Figure S3C). Finally, sirna technology was used to validate our antibodies. VEGF, VEGFR1, and VEGFR2 were downregulated with specific sirnas and the expression of these proteins was

4 assessed by immunohistochemical and Western blot analysis. Low VEGF, VEGFR1, and VEGFR2 expression was demonstrated in the sirna transfected cells compared with the cells transfected with a scramble sirna, using both immunohistochemistry (Figure S4) and immunoblotting analysis (Figure S5). All of the controls strongly supported the specificity of the antibodies used in this study. Moreover, the immunohistochemical procedure and the semiquantification method were cross-validated in 10% of the cases. Concordance greater than 85% was found for all of the markers.

5 FIGURES Figure S1: Stromal (arrows) and endothelial cells (arrowheads) showed immunoreactivity for VEGFR1 and VEGFR2 in ADC (A, B) and SCC (C, D). The vascular staining of the VEGF receptors was used as an internal positive control for the immunohistochemical technique. Scale bar: 50 µm.

6 Figure S2: The specificity of the antibodies used for immunohistochemistry was demonstrated by adsorption controls. Immunoreactivity for VEGF (A) and VEGFR1 (C) was assessed in sections of tumor samples. Adsorption controls for VEGF and VEGFR1 were carried out in serial sections by preincubation (overnight at 4 ºC) of the primary antiserum at optimal dilution with the corresponding peptide: VEGF: A-20 sc-152-p (B), or VEGFR1: C-17 sc-316 P (D). Scale bar: 50 µm.

7 A. VEGF B. VEGFR1 C. VEGFR Figure S3: Western blot analysis in lung tumor samples demonstrated the specificity of the antibodies. (A) Western blotting for VEGF detected VEGF 121, VEGF 165 and VEGF 189 isoforms (B) The antibody for VEGFR1 recognized a unique band of 180 kda. (C) Western blot analysis for VEGFR2 showed 3 immunoreactive bands corresponding to the fully glycosylated mature form of VEGFR2 (230 kda), the partially glycosylated form (200 kda) and the unglycosylated form (150 kda).

8 A B C D E F Figure S4: sirna inhibition of VEGF, VEGFR1 and VEGFR2 was demonstrated by immunohistochemistry. VEGF (A-B), VEGFR1 (C-D), and VEGFR2 (E-F) expression was evaluated in NSCLC cells transfected with sirna targeting VEGF (NCI-H157), VEGFR1 (NCI-H727) and VEGFR2 (NCI-H358), respectively. Scale bar: 50 µm.

9 A. VEGF scr sirna B. VEGFR2 scr sirna Figure S5: Western blot analysis using the specific antibodies showed the downregulation of VEGF (A) and VEGFR2 (B) in sirna treated NSCLC cells (NCI-H157 and NCI-H358 respectively). Scr: scramble.

10 TABLES Table S1: Biomarker risk factors of disease progression for the EUELC series DF PD Median Cutoff No. of Patients % No. of Patients % Hazard Ratio* 95% CI P VEGF > to VEGFR > to VEGFR > to VSS > to MVD > to * Fine and Gray hazard ratio and P value for disease progression risk adjusted by pt, pn and smoking duration. CI, confidence interval; DF, disease-free; HR, hazard ratio; MVD, microvessel density; PD, progression disease; VSS, VEGF signaling score.

11 Table S2: Biomarker risk factors of disease progression for Stage I SCC patients of the EUELC series DF PD Median Cutoff No. of Patients % No. of Patients % Hazard Ratio* 95% CI P VEGF > to VEGFR > to VEGFR > to VSS > to MVD > to *Fine and Gray hazard ratio and P value for disease progression risk adjusted by smoking duration. CI: confidence interval; DF: disease-free; HR: hazard ratio; MVD: microvessel density; PD: progression disease; VSS: VEGF signaling score.

12 Table S3: Biomarker risk factors of disease progression for Stage I SCC patients of the MD Anderson series. Multivariate analysis of prognostic factors. DF PD Median Cutoff No. of Patients % No. of Patients % Hazard Ratio* 95% CI P VEGF > to VEGFR > to VEGFR > to VSS > to * Fine and Gray hazard ratio and P value for disease progression risk adjusted by pn, pt, sex, age and smoking status. CI: confidence interval; DF: disease-free; HR: hazard ratio; MVD: microvessel density; PD: progression disease; VSS: VEGF signaling score.

13 REFERENCES 1. Catena R, Larzabal L, Larrayoz M, et al: VEGF 121 b and VEGF 165 b are weakly angiogenic isoforms of VEGF-A. Molecular cancer 9: , 2010

Data Presentation: the importance of transparency. Roger J. Colbran Associate Editor. Credit: Amanda Fosang, Associate Editor

Data Presentation: the importance of transparency. Roger J. Colbran Associate Editor. Credit: Amanda Fosang, Associate Editor Data Presentation: the importance of transparency Roger J. Colbran Associate Editor Credit: Amanda Fosang, Associate Editor Why Improve Transparency? Irreproducibility of pre-clinical studies Negative

More information

Inflammatory Cytokine-induced Expression of Vasohibin-1 by Rheumatoid Synovial Fibroblasts

Inflammatory Cytokine-induced Expression of Vasohibin-1 by Rheumatoid Synovial Fibroblasts 9 6 6 958 Inflammatory Cytokine-induced Expression of Vasohibin- by Rheumatoid Synovial Fibroblasts a b c a a a a d e a* a a b c d e 5 6 6 9 5 56 67 7 ʼ ʼ ʼ ʼ ʼ ʼ ʼ ʼ 5 6 6 ʼ 5 75 989 6 69 8 95 56 56896

More information

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Product Datasheet DARC Antibody NB100-2421 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and Images at:

More information

Production and purification of monoclonal and polyclonal antibodies. Human S100A8,

Production and purification of monoclonal and polyclonal antibodies. Human S100A8, Supplementary Data Methods Production and purification of monoclonal and polyclonal antibodies. Human SA8, SA9 and SA mouse monoclonal antibodies (mab) were generated using the ClonaCell H hybridoma cloning

More information

CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy

CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy CD22 Antigen Is Broadly Expressed on Lung Cancer Cells and Is a Target for Antibody-Based Therapy Joseph M. Tuscano, Jason Kato, David Pearson, Chengyi Xiong, Laura Newell, Yunpeng Ma, David R. Gandara,

More information

Anti-HIV TAT specific factor 1 antibody [EPR9105(B)] HeLa and Jurkat cell lysates. Human colon tissue. HepG2 cells.

Anti-HIV TAT specific factor 1 antibody [EPR9105(B)] HeLa and Jurkat cell lysates. Human colon tissue. HepG2 cells. Product datasheet Anti-HIV TAT specific factor 1 antibody [EPR9105(B)] ab134921 7 Images Overview Product name Anti-HIV TAT specific factor 1 antibody [EPR9105(B)] Description Rabbit monoclonal [EPR9105(B)]

More information

1 Abreviews 7 References 4 Images

1 Abreviews 7 References 4 Images Product datasheet Anti-Myelin Basic Protein antibody - Oligodendrocyte Marker ab2404 1 Abreviews 7 References 4 Images Overview Product name Description Specificity Tested applications Species reactivity

More information

APPLICATION FOCUS. Application Solutions for Western Blotting

APPLICATION FOCUS. Application Solutions for Western Blotting APPLICATION FOCUS Application Solutions for Western Blotting WESTERN BLOTTING Companion Products Solutions for consistently better blotting. Companion products from Cell Signaling Technology (CST) are

More information


SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut

More information

The Journal of Experimental Medicine

The Journal of Experimental Medicine [ID]FIGS1[/ID] [ID]FIGS2[/ID] [ID]FIGS3[/ID] [ID]FIGS4[/ID] [ID]FIGS5[/ID] [ID]FIGS6[/ID] [ID]TBLS1[/ID] [ID]TBLS2[/ID] SUPPLEMENTAL MATERIAL Wolf et al.,

More information

BOR-Papers in Press. Published as DOI: /biolreprod

BOR-Papers in Press. Published as DOI: /biolreprod Lorenzon-Ojea et al., Supplemental Figure S1: Diagram of human placenta. The illustration indicates in black squares the placental regions dissected for this study: villi, decidua/basal plate, chorionic

More information

High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B. PEPperPRINT GmbH Heidelberg, 06/2014

High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B. PEPperPRINT GmbH Heidelberg, 06/2014 High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B PEPperPRINT GmbH Heidelberg, 06/2014 Introduction This report describes the epitope mapping of autoimmune sera

More information

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1 SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5

More information

General western blot protocol. Guidance for running an efficient and accurate experiment

General western blot protocol. Guidance for running an efficient and accurate experiment blot protocol Guidance for running an efficient and accurate experiment Contents Introduction Solution and reagents Sample lysis Sample preparation Loading and running the gel Antibody staining Useful

More information

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western).

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Western Blot SOP Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Date: 8/16/05, 10/31/05, 2/6/06 Author: N.Oganesyan, R. Kim Edited by: R. Kim Summary:

More information

High-resolution MALDI-FT-ICR MS Imaging for the in-situ Analysis of Metabolites from Intact Tissues. Axel Walch. Research Unit Analytical Pathology

High-resolution MALDI-FT-ICR MS Imaging for the in-situ Analysis of Metabolites from Intact Tissues. Axel Walch. Research Unit Analytical Pathology High-resolution MALDI-FT-ICR MS Imaging for the in-situ Analysis of Metabolites from Intact Tissues Axel Walch Research Unit Analytical Pathology Neuherberg, 2016-10-12 Molecular Tissue Analysis by MALDI

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Immunocytochemistry and immunofluorescence protocol. Procedure for staining of cell cultures using immunofluorescence

Immunocytochemistry and immunofluorescence protocol. Procedure for staining of cell cultures using immunofluorescence Immunocytochemistry and immunofluorescence protocol Procedure for staining of cell cultures using immunofluorescence ICC and IF protocol Preparing the slide 1. Coat coverslips with polyethylineimine or

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

Western Blotting. USA: UK & Europe: China:

Western Blotting. USA: UK & Europe: China: Western Blotting All steps are carried out at room temperature unless otherwise indicated. Recipes for all solutions highlighted bold are included at the end of the protocol. SDS-PAGE 1. Construct an SDS-PAGE

More information


THE JOURNAL OF CELL BIOLOGY Supplemental Material Goldoni et al., THE JOURNAL OF CELL BIOLOGY Figure S1. Specific high affinity interaction between decorin and Met-Fc. (A) Ligand-binding

More information

Approaches that can be used to study expression of specific proteins

Approaches that can be used to study expression of specific proteins Approaches that can be used to study expression of specific proteins Receptors and transporters Homogenate binding studies Receptor autoradiography Radiochemical Western blotting Immunohistochemistry/cytochemistry

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

Supplemental Information. McBrayer et al. Supplemental Data

Supplemental Information. McBrayer et al. Supplemental Data 1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were

More information

Testing of Kappa and Lambda immunoglobulin light chain antibodies kappa DB037-1 and lambda DB039-1 light chain antibodies, developed by DB Biotech

Testing of Kappa and Lambda immunoglobulin light chain antibodies kappa DB037-1 and lambda DB039-1 light chain antibodies, developed by DB Biotech Testing of Kappa and Lambda immunoglobulin light chain antibodies r. Marian Švajdler, Louis Pasteur University Hospital, epartment of Pathology Košice, Slovakia In this retrospective study, we have tested

More information

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,

More information

Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth

Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth Kouki Hidaka *1, Chihiro Miyamoto *2, Satoko Wada-Takahashi

More information


ChIP TROUBLESHOOTING TIPS ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-

More information

Product Datasheet and Instructions for Use

Product Datasheet and Instructions for Use Product Code: MP-378-CMK01 (0.1ml conc) MP-378-CMK05 (0.5ml conc) MP-378-PM6 (6ml RTU) Product Description: CD141 (Thrombomodulin) Concentrated and Prediluted Monoclonal Antibody Control Number: 901-378-071709

More information

Markers and Regulatory Issues in Breast Cancer Diagnosis

Markers and Regulatory Issues in Breast Cancer Diagnosis Markers and Regulatory Issues in Breast Cancer Diagnosis Ann Thor M.D. International Society of Breast Pathology The primary purpose of the ASCO/CAP guidelines for ER, PgR and Her2 testing in invasive

More information

Frequently Asked Questions (FAQs): Antibodies General

Frequently Asked Questions (FAQs): Antibodies General Frequently Asked Questions (FAQs): Antibodies General Should I choose mab or pab? The production of antibodies involves the immunisation of one or more animals with an antigen in order to elicit an immune

More information

Update on Mesothelioma

Update on Mesothelioma November 8, 2012 Update on Mesothelioma Intro incidence and nomenclature Update on Classification Diagnostic specimens Morphologic features Epithelioid Histology Biphasic Histology Immunohistochemical

More information

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 PROTOCOL Western Blotting Transfer and Detection Procedure 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 02-11 DESCRIPTION Western Blotting Transfer and Detection Procedure ADDITIONAL MATERIALS REQUIRED

More information

1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages

1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages 1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating

More information

Proteomics Research with BIOCHAIN

Proteomics Research with BIOCHAIN Proteomics Research with IOCHIN Protein Extraction CNMCS Compartmental Protein Extraction Kit Cytoplasmic, Nuclear, Membrane, and Cytoskeleton Protein One kit isolates four different proteins sequentially

More information

Supplemental Figure legends Supplemental Figure 1. Smc3 depleted cells enter mitosis despite unrepaired DNA DSBs. HeLa cells were synchronised by double thymidine arrest and were transfected with sirnas

More information

Custom Antibody Services

Custom Antibody Services Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

Hypoxyprobe -1 Plus Kit Kit contents:

Hypoxyprobe -1 Plus Kit Kit contents: Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated

More information

The Value of Thyroid Transcription Factor-1 in Cytologic Preparations as a Marker for Metastatic Adenocarcinoma of Lung Origin

The Value of Thyroid Transcription Factor-1 in Cytologic Preparations as a Marker for Metastatic Adenocarcinoma of Lung Origin Anatomic Pathology / TTF-1 IN CYTOLOGY OF BODY FLUIDS The Value of Thyroid Transcription Factor-1 in Cytologic Preparations as a Marker for Metastatic Adenocarcinoma of Lung Origin Jonathan L. Hecht, MD,

More information

Antibodies Against Fluorescent Proteins

Antibodies Against Fluorescent Proteins Antibodies Against Fluorescent Proteins Section C - A collection of antibodies for the detection of Evrogen Fluorescent Proteins in different applications. Contents Overview............................................

More information

Elabscience Biotechnology Co.,Ltd

Elabscience Biotechnology Co.,Ltd Biotechnology Co.,Ltd Your one-stop custom antibody service Antibody is a kind of protein that is the most widely used in the fields of biology and medicine. Antibodies, as the preparations for disease

More information

What is Prosigna? Indications for Use

What is Prosigna? Indications for Use What is Prosigna? The Prosigna Breast Cancer Prognostic Gene Signature Assay is currently the only FDA-cleared test that provides a risk category and numerical score to assess a patient's risk of distant

More information

ASCO CAP HER2 Test Guideline Recommendations Summary of Guideline 2007 and 2013 Recommendations

ASCO CAP HER2 Test Guideline Recommendations Summary of Guideline 2007 and 2013 Recommendations ASCO CAP HER2 Test Guideline Recommendations Summary of Guideline 2007 and 2013 Recommendations Topic 2007 Recommendation 2013 Recommendation Specimens to be tested algorithm for HER2 testing All primary

More information

Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study.

Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. 1 Supplemental data Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. Supplemental Fig. S2. Ingenuity Pathway Analysis (IPA) of the 56 putative caspase substrates

More information

ASCO-CAP Guidelines for Breast Predictive Factor Testing

ASCO-CAP Guidelines for Breast Predictive Factor Testing ASCO-CAP Guidelines for Breast Predictive Factor Testing M. Elizabeth Hammond MD Pathologist, Intermountain Healthcare Professor of Pathology, University of Utah School of Medicine Agenda Why ASCO-CAP

More information

Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology

Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Table of Contents POLYCLONAL VERSUS MONOCLONAL ANTIBODIES...PAGE 3 DIRECT & INDIRECT ASSAYS.PAGE 4 LABELS..PAGE 5 DETECTION...PAGE

More information



More information

Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105

Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Background Gold nanoparticle conjugates have been widely used in biological research and biosensing applications.

More information



More information

P4 Distribution of Cetuximab in Models of Human Lung Cancer

P4 Distribution of Cetuximab in Models of Human Lung Cancer Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, University of Tübingen, Robert Bosch Foundation Stuttgart, Germany FORSYS Partner Project Predictive Cancer Therapy Project Meeting 14.10.09

More information

Immunohistochemistry PROTOCOLS

Immunohistochemistry PROTOCOLS 1 Immunohistochemistry PROTOCOLS Note: The researcher should optimize the precise conditions for a particular assay. Preparation Of Paraffin-Embedded Tissue Sections 1. Sectioning Tissue sections (5-7

More information

Custom Antibodies Services. GeneCust Europe. GeneCust Europe

Custom Antibodies Services. GeneCust Europe. GeneCust Europe GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 6 rue Dominique Lang L-3505 Dudelange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : Web :

More information

Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1

Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1 Supporting Online Material for Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1 Birgit Schulze, Tobias Mentzel, Anna Jehle,

More information

Immune Checkpoint Inhibitors and Other New Agents in NSCLC. Disclosures

Immune Checkpoint Inhibitors and Other New Agents in NSCLC. Disclosures Winship Cancer Institute of Emory University Immune Checkpoint Inhibitors and Other New Agents in NSCLC Rathi Pillai, MD Disclosures Research Funding: Bristol Myers Squibb and Genentech. 1 Objectives Review

More information

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. is involved at each stage of your project

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. is involved at each stage of your project Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production

More information

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all

More information

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.

More information



More information

Protocol for Western Blotting

Protocol for Western Blotting Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

Normal values of IGF1 and IGFBP3. Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A.

Normal values of IGF1 and IGFBP3. Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A. Normal values of IGF1 and IGFBP3 Kučera R., Vrzalová J., Fuchsová R., Topolčan O., Tichopád A. Agenda of the presentation IGF1 and IGFBP3 basic characteristic Why normal values Groups of the persons and

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

Chapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions

Chapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions Chapter 6 Antigen-Antibody Interactions: Principles and Applications Antigen-Antibody Properties You must remember antibody affinity (single) VS avidity (multiple) High affinity: bound tightly and longer!

More information



More information

Detection and staging of recurrent prostate cancer is still one of the important clinical problems in prostate cancer. A rise in PSA or biochemical

Detection and staging of recurrent prostate cancer is still one of the important clinical problems in prostate cancer. A rise in PSA or biochemical Summary. 111 Detection and staging of recurrent prostate cancer is still one of the important clinical problems in prostate cancer. A rise in PSA or biochemical recurrence (BCR) is the first sign of recurrent

More information

Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues,

Kinexus has an in-house inventory of lysates prepared from 16 human cancer cell lines that have been selected to represent a diversity of tissues, Kinexus Bioinformatics Corporation is seeking to map and monitor the molecular communications networks of living cells for biomedical research into the diagnosis, prognosis and treatment of human diseases.

More information

ELITE Custom Antibody Services

ELITE Custom Antibody Services ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to

More information

Express TM ELISA Kit I. DESCRIPTION. Technical Manual No Version

Express TM ELISA Kit I. DESCRIPTION. Technical Manual No Version Express TM ELISA Kit Technical Manual No. 0239 Version 20070325 I Description... 1 II Kit Contents.. 2 III Related Products 2 IV Key Features. 2 V Storage... 2 VI ELISA Protocol.... 2 VII Examples... 3

More information

Changes in Breast Cancer Reports After Second Opinion. Dr. Vicente Marco Department of Pathology Hospital Quiron Barcelona. Spain

Changes in Breast Cancer Reports After Second Opinion. Dr. Vicente Marco Department of Pathology Hospital Quiron Barcelona. Spain Changes in Breast Cancer Reports After Second Opinion Dr. Vicente Marco Department of Pathology Hospital Quiron Barcelona. Spain Second Opinion in Breast Pathology Usually requested when a patient is referred

More information

ACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46. Cell Signaling. Ki-67 Clon MIB-1 from Dako. AntiBrdU (B2531), α Tubulin

ACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46. Cell Signaling. Ki-67 Clon MIB-1 from Dako. AntiBrdU (B2531), α Tubulin Supplemental materials and methods Antibodies and reagents ACC (#3676), AMPK α1/2 (#2532), AMPKβ1/2 (#4150), Phospho-4E-BP1 Thr37/46 (#9459), pakt Ser473 (#4051), pampk Thr172 (#2535), pacc Ser79 (#3661),

More information

510 (k) Summary DESCRIPTION OF DEVICE: Intended Use

510 (k) Summary DESCRIPTION OF DEVICE: Intended Use 510 (k) Summary Asymmetm, Inc. 117 Senate Brook Drive Arnston, CT 06231 (860) 716-8888 Contact Person: Maria McKeon Date Summary Prepared: February 4,2005 Name of Device: 1. ProprietaryITrade Name: Prostate-63

More information

ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015.

ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. Technical Manual ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. PRINTED IN USA. 6/09 ECL Western Blotting Substrate All technical literature is available on the Internet

More information

Geniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody

Geniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Custom Antibody Services Serum services Antibody Monoclonal Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Poly Y WE PROVIDE OUR SERVICES TO With Expertise

More information

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma The Use of Kinase Inhibitors: Translational Lab Results Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma Sheelu Varghese, Ph.D. H. Richard Alexander, M.D.

More information

Antibody Production Price List

Antibody Production Price List Antibody Production Price List Presenting Insight Biotechnology s price list for custom polyclonal and monoclonal antibody production services. We are happy to tailor individual packages towards the specific

More information

The trial and tribulations of predictive biomarkers in metastatic RCC.

The trial and tribulations of predictive biomarkers in metastatic RCC. The trial and tribulations of predictive biomarkers in metastatic RCC. Professor Thomas Powles Renal cancer lead for London Cancer Barts Cancer Institute and Royal Free Hospital UCL and QMUL. Proportion

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Ubiquitin-dependent endocytosis of NKG2D-DAP10 receptor complexes activates signaling and functions in human NK cells

More information

P R O D U C T S CATALOG 2011-2012

P R O D U C T S CATALOG 2011-2012 P R O D U C T S CATALOG 2011-2012 INSTITUTE FOR THE APPLICATION OF NUCLEAR ENERGY - INEP Banatska 31b 11080 Zemun Belgrade Serbia Tel: (+381 11) 2619 252, 2618 696, 2199 949 Fax: (+381 11) 2618 724

More information

Product name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930

Product name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930 SDS-PAGE and western blot for low molecular weight proteins (2-20kDa) Merav Marom Shamur, Smart Assays Aim: Analysis of low molecular weight proteins by SDS-PAGE and western blot under reducing conditions.

More information

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%)

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 Date :

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein

More information

Diagnostic and prognostic potential of serum mirnas. CDDF Immunotherapy Technology Forum, Wien December 7-8, Heidi Schwarzenbach

Diagnostic and prognostic potential of serum mirnas. CDDF Immunotherapy Technology Forum, Wien December 7-8, Heidi Schwarzenbach Diagnostic and prognostic potential of serum mirnas CDDF Immunotherapy Technology Forum, Wien December 7-8, 2015 Heidi Schwarzenbach Circulating nucleic acids in blood Tumor cells release their nucleic

More information

Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment

Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment Aims of this leaflet This leaflet has been written to help you understand your medicine options after being

More information

Pfizer Forms Global Alliance with Merck KGaA, Darmstadt, Germany to Accelerate Presence in Immuno-Oncology. November 17, 2014

Pfizer Forms Global Alliance with Merck KGaA, Darmstadt, Germany to Accelerate Presence in Immuno-Oncology. November 17, 2014 Pfizer Forms Global Alliance with Merck KGaA, Darmstadt, Germany to Accelerate Presence in Immuno-Oncology November 17, 2014 Forward-looking statements Our discussions during this conference call will

More information

Supporting Information

Supporting Information Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).

More information

Preparation of a phosphotyrosinylated protein standard for 2D gel western blotting

Preparation of a phosphotyrosinylated protein standard for 2D gel western blotting Preparation of a phosphotyrosinylated protein standard for 2D gel western blotting Nancy Kendrick, Matt Hoelter, Andrew Koll, and Jon Johansen Kendrick Labs, Inc, Madison, WI Introduction

More information

20 Diagnostic Cytopathology, Vol 36, No 1 ' 2007 WILEY-LISS, INC.

20 Diagnostic Cytopathology, Vol 36, No 1 ' 2007 WILEY-LISS, INC. Utility of WT-1, p63, MOC31, Mesothelin, and Cytokeratin (K903 and CK5/6) Immunostains in Differentiating Adenocarcinoma, Squamous Cell Carcinoma, and Malignant Mesothelioma in Effusions Robert T. Pu,

More information

Protein immunoblotting

Protein immunoblotting Protein immunoblotting (Western blotting) Dr. Serageldeen A. A. Sultan Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt Western blotting -It is an analytical technique used to

More information

Wieslab Alport's Syndrome kit

Wieslab Alport's Syndrome kit Instruction Wieslab Alport's Syndrome kit Immunohistochemical staining of type IV collagen in Alport's Syndrome Store the kit at +2-8 C Document No. E-23-0175-05 RUO August, 2013 For Research Use Only.

More information

Clinical Histology Procedure Histo03.01 Automated Immunohistochemical Staining Utilizing the Ventana Benchmark Instrument

Clinical Histology Procedure Histo03.01 Automated Immunohistochemical Staining Utilizing the Ventana Benchmark Instrument Clinical Histology Procedure Histo03.01 Automated Immunohistochemical Staining Utilizing the Ventana Benchmark Instrument Final Approval: May 2010 Effective: May 2010 Next Review Date: May 2012 List all

More information

VENTANA ALK Scoring Interpretation Guide for non-small cell lung carcinoma (NSCLC)

VENTANA ALK Scoring Interpretation Guide for non-small cell lung carcinoma (NSCLC) VENTANA ALK Scoring Interpretation Guide for non-small cell lung carcinoma (NSCLC) ALK Scoring Interpretation Guide for VENTANA anti-alk (D5F3) Rabbit Monoclonal Primary Antibody VENTANA ALK Scoring Interpretation

More information

Product Datasheet and Instructions for Use

Product Datasheet and Instructions for Use Product Code: MP-092-CR01 (0.1ml concentrate) MP-092-CR05 (0.5ml concentrate) MP-092-CR1 (1ml concentrate) MP-092-PR6 (6ml RTU) Product Description: Calretinin Concentrated and Prediluted Polyclonal Antibody

More information

Title: HAX-1 overexpression, splicing and cellular localization in tumors.

Title: HAX-1 overexpression, splicing and cellular localization in tumors. Author's response to reviews Authors: Alicja Trebinska ( Alina Rembiszewska ( Karolina Ciosek ( Konrad Ptaszynski (

More information

Tissue Cross-Reactivity of QRX-111 with Human, Cynomolgus Monkey and Rat Tissues in Vitro

Tissue Cross-Reactivity of QRX-111 with Human, Cynomolgus Monkey and Rat Tissues in Vitro Nova Pathology, PC Tissue Cross-Reactivity Pathology Report Tissue Cross-Reactivity of QRX-111 with Human, Cynomolgus Monkey and Rat Tissues Nova Pathology Study Number: NP-12-S-004 Testing Facility Study

More information

Therapeutic Systems Immunology

Therapeutic Systems Immunology Therapeutic Systems Immunology Coordination: Robert Preissner, Charité, Berlin 13 Partners from Berlin (7) Göttingen (1) Heidelberg (1) Rostock (2) Tübingen (1) Overview Intro / Mission Partners Systems

More information

H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md

H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md Major Advances in Cancer Prevention, Diagnosis and Treatment~ Why Mesothelioma Leads the Way H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland

More information

LANCE Eu-labeled antibodies for serine/threonine kinase assays

LANCE Eu-labeled antibodies for serine/threonine kinase assays AD0078P-1 (en) 1 LANCE Eu-labeled antibodies for serine/threonine kinase assays For Research Use Only These instructions for use apply to the following reagents: AD0094 LANCE Eu-W1024 phospho-threonine

More information

Peak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion

Peak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion Supplemental table 1. The completeness of trypsin digestion of the signature peptides with native flanking sequence. The signature peptides with native flanking sequence were digested with trypsin as described

More information