Scorpions Technology for Real Time PCR and Genotyping

Size: px
Start display at page:

Download "Scorpions Technology for Real Time PCR and Genotyping"

Transcription

1 Scorpions Technology for Real Time PCR and Genotyping

2 Outline Origins of Scorpions Principles of Scorpions Performance Applications Conclusions

3 Origins of Scorpions

4 A Bit of History At Zeneca Diagnostics, we made products for human gene based diagnostics Initial technology- PCR + Gels Customers (educated, research-oriented, smart ) customised the tests(!) Split the reagents Added too much DNA Wanted to remove customer from the equation Homogeneous (closed tube) Simplicity

5 Benefits of Homogeneous Simple to Use Automatable Closed tube minimises contamination issues Suitable for both endpoint and Real time

6 Homogeneous options Intercalation Easy to use but not suitable for diagnostic applications Cannot be multiplexed Fluorescence Polarisation Difficult to use with real time PCR Instrumentation (in 1998)

7 Fluorophore/Quencher Technologies Taqman Excellent technology Not commercially available for Diagnostic Use Molecular Beacons Neat Idea Commercially available Amplifluor/Sunrise Neat and effective No third level specificity so not suitable for Diagnostics

8 Molecular Beacons CT G C A A C A C G T T A A T GG G C C T G CG AT GC GC CG F Beacon Q F Q C G G C G A T C C G C G CCTTTCACCTGACAGAAGGGT AACAGTCTAAAGGAAAGTGGACTGTCTTCCCAGCTGACC Beacon + target

9 Issues With Bimolecular Probe Systems Kinetics are slow Energy cost to open stem/loop of probe Bimolecular collision Competition for Molecular Beacon Target site from: PCR product synthesis Target/complement reannealing Target strand folding These problems also apply to other bimolecular (Eclipse) and tri-molecular systems (LightCycler Probes)

10 Principles of Scorpions

11 If the Target Molecule Folds Efficiently Why not stick the probe to the amplicon? Q F

12

13 What s the Blocker for? F Q F Q

14 Prevention of Non-Specific Signals F Q F Q

15

16 Benefits of dual oligo Scorpions Linear molecules for easier synthesis Single labels for more cost effective synthesis Greater separation of fluorophore and quencher gives even stronger signals

17 Summary Scorpions combines probe and primer into a single molecule Two simple formats for presenting quencher Quenched probe ensures low backgrounds The probe sees the extension product of its own primer- unimolecular rearrangement Probing is predicted to be fast and efficient leading to high signals

18 Performance of Scorpions

19 Does it work? Amplicon Detection FAM fluorescecne intensity cycles

20 Strong signals, low backgrounds Scorpion Beacon TaqMan

21 Details of signal generation Intercalation TaqMan FAM Time (s) FAM Time Molecular Beacons Scorpions FAM Time (s) FAM Time

22 10 minute PCR Scorpions vs TaqMan, fast cycling Fluorescence TaqMan B TaqMan B neg Scorpion B Scorpion B neg Cycles

23 PCR Limiting? Very Fast Cycling Cycles FAM Cycles FAM

24 Sensitivity and Specificity 20,000 copies 2 copies

25 Sensitivity and Specificity

26 Short Probes/Quenchers Annealing

27 Summary Scorpions detect amplicons efficiently High signals, low backgrounds Reliable Quantitative data Shorter probes allow greater allelic specificity Scorpions probing is fast PCR is probably the limiting factor

28 Applications Genotyping Q-PCR Others

29 Genotyping Reaction Quencher/Probe Variant A Q F Quencher/Probe Variant B Q R

30 Genotyping Products F Q F Q R F R

31 ARMS Single Tube Genotyping Reaction Scheme A Rox Fam Allele A primer Allele B primer B

32 Genotyping Data 70:30 Polymorphism Processed F/R aa ab bb Sample Number

33 Genotyping data aa ab bb aa+4sd ab+4sd bb+4sd aa-4sd ab-4sd bb-4sd

34 Real Time Genotyping Wild type Sample Cycles Fluorescence WT MUT No Template Control Cycles Fluorescence WT MUT Heterozygote Sample Cycles Fluorescence WT MUT Mutant Sample Cycles Fluorescence WT MUT

35 Reverse Transcription/PCR Tth system (Mn Buffer) In vitro transcript RT for 7 min at 60 C PCR: 95 C 2s, 60 C 10s, 72 C 3s

36 Reverse Transcription & PCR N N 20 NTC N

37 Haplotyping Other Applications Pooled Samples

38 Haplotyping A B F Q

39 Haplotyping Data Rpost-Rpre

40 Accuracy Improves with Larger Pools Observed Allele Frequency Pools of 12 Pools of 48 Pools of 96 Pools of 192 Pools of % accuracy Predicted Allele Frequency

41 Summary Scorpions has proved to be very applicable to Genotyping Endpoint and Real Time ARMS or hybridisation QPCR (+/- reverse transcription) Multiplexing to at least 3 achieved on RT-PCR Haplotyping Determining allele frequency in pooled samples

42 One last thing Scorpions are easy molecules to design (after bit of practice!); but Software for probe design now available from DNA Software Inc

43 Conclusions Scorpions are linked primer/probe molecules with a unimolecular mode of action Benefits of this MOA include Speed Efficiency Reliability Stoichiometry: 1 molecule gives one signal Applications include Genotyping Haplotyping Pooled Genotyping Q-PCR +/- RT

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Methods and Application Guide. Introduction to Quantitative PCR

Methods and Application Guide. Introduction to Quantitative PCR Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A.

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A. Pitfalls in qpcr Primer and probe design and synthesis Mary Span Eurogentec S.A. Steps in qpcr assay Set up experiment statistical relevant # samples/experimental group controls Design and synthesis primers

More information

Introduction to Quantitative PCR

Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental

More information

Applications Guide. Real-Time PCR Applications Guide

Applications Guide. Real-Time PCR Applications Guide Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time

More information

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Absolute Quantification Getting Started Guide

Absolute Quantification Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction

More information

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide Table of Contents qpcr Technical Guide Introduction... 1 Quantitative PCR: How does it work?... 2 qpcr

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

Quantitative Real Time PCR Protocol. Stack Lab

Quantitative Real Time PCR Protocol. Stack Lab Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

DNA Detection. Chapter 13

DNA Detection. Chapter 13 DNA Detection Chapter 13 Detecting DNA molecules Once you have your DNA separated by size Now you need to be able to visualize the DNA on the gel somehow Original techniques: Radioactive label, silver

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests. TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use

More information

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Highly specific and sensitive quantitation

Highly specific and sensitive quantitation PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is

More information

REAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE

REAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE i REAL-TIME PCR: FROM THEORY TO PRACTICE ii Put the odds in your favor with SuperScript RT. Engineered to be RNase H and incredibly thermostable, SuperScript III RT delivers robust first-strand synthesis

More information

Quantification of Hepatitis B Virus. Core Protein Region. 150 tests

Quantification of Hepatitis B Virus. Core Protein Region. 150 tests Quantification of Hepatitis B Virus Core Protein Region For general laboratory and research use only 150 tests Introduction to Hepatitis B Virus Originally known as serum hepatitis, hepatitis B has only

More information

Human Herpes Virus 4 (Epstein Barr)

Human Herpes Virus 4 (Epstein Barr) Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein

More information

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Cepheid Technical Support Overview This technical note provides guidelines on transferring, optimizing, and evaluating real-time PCR

More information

preface EUROGENTEC www.eurogentec.com info@eurogentec.com

preface EUROGENTEC www.eurogentec.com info@eurogentec.com qpcr guide 3 preface Real-Time quantitative PCR, or qpcr in short, is heralded as the gold standard for accurate, sensitive and fast quantification of nucleic acid sequences. Indeed it is a wonderful

More information

PrimeTime. qpcr Application Guide. Experimental Overview, Protocol, Troubleshooting Fourth Edition

PrimeTime. qpcr Application Guide. Experimental Overview, Protocol, Troubleshooting Fourth Edition PrimeTime qpcr Application Guide Experimental Overview, Protocol, Troubleshooting Fourth Edition qpcr Application Guide Experimental Overview, Protocol, Troubleshooting Fourth Edition Managing Editors

More information

The AB7900Fast and Principles of Real Time PCR

The AB7900Fast and Principles of Real Time PCR The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

Real-time PCR handbook

Real-time PCR handbook Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Oligonucleotide Stability Study

Oligonucleotide Stability Study Oligonucleotide Stability Study IDT is performing a long term study of oligo stability. The study has been ongoing for 2 years and has tested oligo stability under various conditions. An overview of the

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

Real-time qpcr Assay Design Software www.qpcrdesign.com

Real-time qpcr Assay Design Software www.qpcrdesign.com Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Quantification of Mycobacterium Tuberculosis. 150 tests

Quantification of Mycobacterium Tuberculosis. 150 tests Quantification of Mycobacterium Tuberculosis rep 13E12 For general laboratory and research use only 150 tests Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium that

More information

Critical Factors for Successful Real-Time PCR

Critical Factors for Successful Real-Time PCR Critical Factors for Successful Real-Time PCR Sample & ssay Technologies Contents 1. Introduction 4 2. Detection of PCR products in real-time 5 2.1 SYR Green 5 2.2 Fluorescently labeled sequence-specific

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

Path-ID Multiplex One-Step RT-PCR Kit

Path-ID Multiplex One-Step RT-PCR Kit USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System 5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Fluorescent dyes for use with the

Fluorescent dyes for use with the Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany

More information

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES UNIT.3 Real-Time PCR Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland,

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension

Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................

More information

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS ADVANCES IN CLINICAL CHEMISTRY, VOL. 40 ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS Bernhard Kaltenboeck and Chengming Wang Department of Pathobiology, College of Veterinary

More information

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07 Techne qpcr test Lyme Disease RecA gene 150 tests For general laboratory and research use only 1 Introduction to Lyme Disease Lyme disease is an infectious disease caused mainly by three species of bacteria

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES

Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES UNIT.3 Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland, Ohio OVERVIEW

More information

A guide to the analysis of KASP genotyping data using cluster plots

A guide to the analysis of KASP genotyping data using cluster plots extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing A guide to the analysis of KASP genotyping data using cluster plots Contents of

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Getting Started Guide

Getting Started Guide Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering

More information

Genomic DNA detection assay

Genomic DNA detection assay Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage

More information

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Brilliant QPCR Master Mix

Brilliant QPCR Master Mix Brilliant QPCR Master Mix Instruction Manual Catalog #600549 (single kit) #929549 (10-pack kit) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600549-12 LIMITED PRODUCT WARRANTY This

More information

CUSTOM DNA SEQUENCING SERVICES

CUSTOM DNA SEQUENCING SERVICES CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and

More information

Borrelia burgdorferi

Borrelia burgdorferi Techne qpcr test Borrelia burgdorferi Outer surface protein A (ospa) gene 150 tests For general laboratory and research use only 1 Introduction to Borrelia burgdorferi Borrelia burgdorferi is a Gram negative

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

KASP genotyping chemistry User guide and manual

KASP genotyping chemistry User guide and manual KASP genotyping chemistry User guide and manual KASP manual content 1. Introduction 3 2. Principal of the KASP genotyping assay 3 2.1 Mechanism of KASP chemistry 4 3. The KASP reaction component 5 3.1

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

AnDiaTec GmbH & Co. KG Leibnizstr. 11 70806 Kornwestheim. Telefon ++49 7154 807 190 Telefax ++49 7154 807 197

AnDiaTec GmbH & Co. KG Leibnizstr. 11 70806 Kornwestheim. Telefon ++49 7154 807 190 Telefax ++49 7154 807 197 Evaluation of the sensitivity and specificity of the AnDiaTec BoVirSL BVDV TaqMan RTPCR kit for the detection of bovine viral diarrhea virus in bovine whole blood and ear notch samples Bovine blood and

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

RealLine HCV PCR Qualitative - Uni-Format

RealLine HCV PCR Qualitative - Uni-Format Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013

More information

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd.

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd. TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction

More information

Introduction to High Resolution Melt Analysis

Introduction to High Resolution Melt Analysis Introduction to High Resolution Melt Analysis Contents Page Introduction 3 Overview of the Melting Profile Principle 3 The Intercalating Dye Non-saturating dyes Saturating dyes Release-on-demand dyes Instruments

More information

Absolute Quantitation Using Standard Curve Getting Started Guide

Absolute Quantitation Using Standard Curve Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information

Lyme Disease. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... RecA gene. 150 tests. Primerdesign Ltd.

Lyme Disease. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... RecA gene. 150 tests. Primerdesign Ltd. TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Absolute Quantitation Using Standard Curve Getting Started Guide

Absolute Quantitation Using Standard Curve Getting Started Guide Applied Biosystems 7900HT Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started Guide Introduction Designing an AQ Experiment Preparing the Samples and Reaction Plate Creating

More information

Streptococcus pneumoniae

Streptococcus pneumoniae Techne qpcr test Streptococcus pneumoniae alpha-fucosidase gene 150 tests For general laboratory and research use only 1 Introduction to Streptococcus pneumoniae Streptococcus pneumoniae, or pneumococcus,

More information

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient

More information

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System The most convenient automated HLA typing system BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System for on call, high throughput and disease association

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Introduction to Gene Expression. Getting Started Guide

Introduction to Gene Expression. Getting Started Guide Introduction to Gene Expression Getting Started Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information