Scorpions Technology for Real Time PCR and Genotyping
|
|
- Gerald Sims
- 7 years ago
- Views:
Transcription
1 Scorpions Technology for Real Time PCR and Genotyping
2 Outline Origins of Scorpions Principles of Scorpions Performance Applications Conclusions
3 Origins of Scorpions
4 A Bit of History At Zeneca Diagnostics, we made products for human gene based diagnostics Initial technology- PCR + Gels Customers (educated, research-oriented, smart ) customised the tests(!) Split the reagents Added too much DNA Wanted to remove customer from the equation Homogeneous (closed tube) Simplicity
5 Benefits of Homogeneous Simple to Use Automatable Closed tube minimises contamination issues Suitable for both endpoint and Real time
6 Homogeneous options Intercalation Easy to use but not suitable for diagnostic applications Cannot be multiplexed Fluorescence Polarisation Difficult to use with real time PCR Instrumentation (in 1998)
7 Fluorophore/Quencher Technologies Taqman Excellent technology Not commercially available for Diagnostic Use Molecular Beacons Neat Idea Commercially available Amplifluor/Sunrise Neat and effective No third level specificity so not suitable for Diagnostics
8 Molecular Beacons CT G C A A C A C G T T A A T GG G C C T G CG AT GC GC CG F Beacon Q F Q C G G C G A T C C G C G CCTTTCACCTGACAGAAGGGT AACAGTCTAAAGGAAAGTGGACTGTCTTCCCAGCTGACC Beacon + target
9 Issues With Bimolecular Probe Systems Kinetics are slow Energy cost to open stem/loop of probe Bimolecular collision Competition for Molecular Beacon Target site from: PCR product synthesis Target/complement reannealing Target strand folding These problems also apply to other bimolecular (Eclipse) and tri-molecular systems (LightCycler Probes)
10 Principles of Scorpions
11 If the Target Molecule Folds Efficiently Why not stick the probe to the amplicon? Q F
12
13 What s the Blocker for? F Q F Q
14 Prevention of Non-Specific Signals F Q F Q
15
16 Benefits of dual oligo Scorpions Linear molecules for easier synthesis Single labels for more cost effective synthesis Greater separation of fluorophore and quencher gives even stronger signals
17 Summary Scorpions combines probe and primer into a single molecule Two simple formats for presenting quencher Quenched probe ensures low backgrounds The probe sees the extension product of its own primer- unimolecular rearrangement Probing is predicted to be fast and efficient leading to high signals
18 Performance of Scorpions
19 Does it work? Amplicon Detection FAM fluorescecne intensity cycles
20 Strong signals, low backgrounds Scorpion Beacon TaqMan
21 Details of signal generation Intercalation TaqMan FAM Time (s) FAM Time Molecular Beacons Scorpions FAM Time (s) FAM Time
22 10 minute PCR Scorpions vs TaqMan, fast cycling Fluorescence TaqMan B TaqMan B neg Scorpion B Scorpion B neg Cycles
23 PCR Limiting? Very Fast Cycling Cycles FAM Cycles FAM
24 Sensitivity and Specificity 20,000 copies 2 copies
25 Sensitivity and Specificity
26 Short Probes/Quenchers Annealing
27 Summary Scorpions detect amplicons efficiently High signals, low backgrounds Reliable Quantitative data Shorter probes allow greater allelic specificity Scorpions probing is fast PCR is probably the limiting factor
28 Applications Genotyping Q-PCR Others
29 Genotyping Reaction Quencher/Probe Variant A Q F Quencher/Probe Variant B Q R
30 Genotyping Products F Q F Q R F R
31 ARMS Single Tube Genotyping Reaction Scheme A Rox Fam Allele A primer Allele B primer B
32 Genotyping Data 70:30 Polymorphism Processed F/R aa ab bb Sample Number
33 Genotyping data aa ab bb aa+4sd ab+4sd bb+4sd aa-4sd ab-4sd bb-4sd
34 Real Time Genotyping Wild type Sample Cycles Fluorescence WT MUT No Template Control Cycles Fluorescence WT MUT Heterozygote Sample Cycles Fluorescence WT MUT Mutant Sample Cycles Fluorescence WT MUT
35 Reverse Transcription/PCR Tth system (Mn Buffer) In vitro transcript RT for 7 min at 60 C PCR: 95 C 2s, 60 C 10s, 72 C 3s
36 Reverse Transcription & PCR N N 20 NTC N
37 Haplotyping Other Applications Pooled Samples
38 Haplotyping A B F Q
39 Haplotyping Data Rpost-Rpre
40 Accuracy Improves with Larger Pools Observed Allele Frequency Pools of 12 Pools of 48 Pools of 96 Pools of 192 Pools of % accuracy Predicted Allele Frequency
41 Summary Scorpions has proved to be very applicable to Genotyping Endpoint and Real Time ARMS or hybridisation QPCR (+/- reverse transcription) Multiplexing to at least 3 achieved on RT-PCR Haplotyping Determining allele frequency in pooled samples
42 One last thing Scorpions are easy molecules to design (after bit of practice!); but Software for probe design now available from DNA Software Inc
43 Conclusions Scorpions are linked primer/probe molecules with a unimolecular mode of action Benefits of this MOA include Speed Efficiency Reliability Stoichiometry: 1 molecule gives one signal Applications include Genotyping Haplotyping Pooled Genotyping Q-PCR +/- RT
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationReal-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationQPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
More informationMethods and Application Guide. Introduction to Quantitative PCR
Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304
More informationCo Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
More informationReal-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
More informationTechnical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
More informationPitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A.
Pitfalls in qpcr Primer and probe design and synthesis Mary Span Eurogentec S.A. Steps in qpcr assay Set up experiment statistical relevant # samples/experimental group controls Design and synthesis primers
More informationIntroduction to Quantitative PCR
Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770
More informationSpeed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
More informationValidating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
More information2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number
application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000
More informationReal time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed
Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental
More informationApplications Guide. Real-Time PCR Applications Guide
Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time
More informationReagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems
Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationAbsolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
More informationqpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide
qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide Table of Contents qpcr Technical Guide Introduction... 1 Quantitative PCR: How does it work?... 2 qpcr
More informationFactors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
More informationTaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationQuantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
More informationDyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
More informationDNA Detection. Chapter 13
DNA Detection Chapter 13 Detecting DNA molecules Once you have your DNA separated by size Now you need to be able to visualize the DNA on the gel somehow Original techniques: Radioactive label, silver
More informationmircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
More informationHepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use
More informationDengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory
More informationStratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationHighly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
More informationREAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE
i REAL-TIME PCR: FROM THEORY TO PRACTICE ii Put the odds in your favor with SuperScript RT. Engineered to be RNase H and incredibly thermostable, SuperScript III RT delivers robust first-strand synthesis
More informationQuantification of Hepatitis B Virus. Core Protein Region. 150 tests
Quantification of Hepatitis B Virus Core Protein Region For general laboratory and research use only 150 tests Introduction to Hepatitis B Virus Originally known as serum hepatitis, hepatitis B has only
More informationHuman Herpes Virus 4 (Epstein Barr)
Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein
More informationOptimizing and Analyzing Real-Time Assays on the SmartCycler II System
Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Cepheid Technical Support Overview This technical note provides guidelines on transferring, optimizing, and evaluating real-time PCR
More informationpreface EUROGENTEC www.eurogentec.com info@eurogentec.com
qpcr guide 3 preface Real-Time quantitative PCR, or qpcr in short, is heralded as the gold standard for accurate, sensitive and fast quantification of nucleic acid sequences. Indeed it is a wonderful
More informationPrimeTime. qpcr Application Guide. Experimental Overview, Protocol, Troubleshooting Fourth Edition
PrimeTime qpcr Application Guide Experimental Overview, Protocol, Troubleshooting Fourth Edition qpcr Application Guide Experimental Overview, Protocol, Troubleshooting Fourth Edition Managing Editors
More informationThe AB7900Fast and Principles of Real Time PCR
The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications
More informationProtocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
More informationReal-time PCR handbook
Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time
More informationquantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
More informationOligonucleotide Stability Study
Oligonucleotide Stability Study IDT is performing a long term study of oligo stability. The study has been ongoing for 2 years and has tested oligo stability under various conditions. An overview of the
More informationMystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
More informationReal-time qpcr Assay Design Software www.qpcrdesign.com
Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488
More informationRevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationQuantification of Mycobacterium Tuberculosis. 150 tests
Quantification of Mycobacterium Tuberculosis rep 13E12 For general laboratory and research use only 150 tests Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium that
More informationCritical Factors for Successful Real-Time PCR
Critical Factors for Successful Real-Time PCR Sample & ssay Technologies Contents 1. Introduction 4 2. Detection of PCR products in real-time 5 2.1 SYR Green 5 2.2 Fluorescently labeled sequence-specific
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationTITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
More informationEpstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing
TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...
More informationAll-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
More informationPath-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationCompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
More informationRelative Quantification Applied Biosystems 7300/7500 Real Time PCR System
5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationFluorescent dyes for use with the
Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany
More informationReal-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES
UNIT.3 Real-Time PCR Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland,
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationApplication Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension
Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................
More informationEpstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
More informationADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS
ADVANCES IN CLINICAL CHEMISTRY, VOL. 40 ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS Bernhard Kaltenboeck and Chengming Wang Department of Pathobiology, College of Veterinary
More informationLyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07
Techne qpcr test Lyme Disease RecA gene 150 tests For general laboratory and research use only 1 Introduction to Lyme Disease Lyme disease is an infectious disease caused mainly by three species of bacteria
More informationMolecular Diagnostics in the Clinical Microbiology Laboratory
Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology
More informationReal-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES
UNIT.3 Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland, Ohio OVERVIEW
More informationA guide to the analysis of KASP genotyping data using cluster plots
extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing A guide to the analysis of KASP genotyping data using cluster plots Contents of
More informationGene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
More informationGetting Started Guide
Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering
More informationGenomic DNA detection assay
Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage
More informationHuman Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
More informationBrilliant QPCR Master Mix
Brilliant QPCR Master Mix Instruction Manual Catalog #600549 (single kit) #929549 (10-pack kit) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600549-12 LIMITED PRODUCT WARRANTY This
More informationCUSTOM DNA SEQUENCING SERVICES
CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and
More informationBorrelia burgdorferi
Techne qpcr test Borrelia burgdorferi Outer surface protein A (ospa) gene 150 tests For general laboratory and research use only 1 Introduction to Borrelia burgdorferi Borrelia burgdorferi is a Gram negative
More informationab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
More informationKASP genotyping chemistry User guide and manual
KASP genotyping chemistry User guide and manual KASP manual content 1. Introduction 3 2. Principal of the KASP genotyping assay 3 2.1 Mechanism of KASP chemistry 4 3. The KASP reaction component 5 3.1
More informationBeginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
More informationAnDiaTec GmbH & Co. KG Leibnizstr. 11 70806 Kornwestheim. Telefon ++49 7154 807 190 Telefax ++49 7154 807 197
Evaluation of the sensitivity and specificity of the AnDiaTec BoVirSL BVDV TaqMan RTPCR kit for the detection of bovine viral diarrhea virus in bovine whole blood and ear notch samples Bovine blood and
More informationHBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
More informationPATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide
PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria
More informationPyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
More informationRealLine HCV PCR Qualitative - Uni-Format
Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013
More informationLyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd.
TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction
More informationIntroduction to High Resolution Melt Analysis
Introduction to High Resolution Melt Analysis Contents Page Introduction 3 Overview of the Melting Profile Principle 3 The Intercalating Dye Non-saturating dyes Saturating dyes Release-on-demand dyes Instruments
More informationAbsolute Quantitation Using Standard Curve Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started
More informationRealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
More informationLyme Disease. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... RecA gene. 150 tests. Primerdesign Ltd.
TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationAbsolute Quantitation Using Standard Curve Getting Started Guide
Applied Biosystems 7900HT Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started Guide Introduction Designing an AQ Experiment Preparing the Samples and Reaction Plate Creating
More informationStreptococcus pneumoniae
Techne qpcr test Streptococcus pneumoniae alpha-fucosidase gene 150 tests For general laboratory and research use only 1 Introduction to Streptococcus pneumoniae Streptococcus pneumoniae, or pneumococcus,
More informationUser Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
More informationHISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics
HISTO SPOT SSO System The most convenient automated HLA typing system BAG Health Care the experts for HLA and blood group diagnostics HISTO SPOT SSO System for on call, high throughput and disease association
More informationQuantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationIntroduction to Gene Expression. Getting Started Guide
Introduction to Gene Expression Getting Started Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More information