LifeSpan. Rudi Westendorp - LUMC Bas Zwaan Institute of Biology, Leiden

Transcription

1 LifeSpan Rudi Westendorp - LUMC Bas Zwaan Institute of Biology, Leiden

2 improved survival Oeppen&Vaupel, Science 2002

3 environmental factors 1 survival age (years)

4 selective survival 1 survival age (years)

5 nowadays environment Finch & Grimmins. Science 2004; 305:1736

6 early environment Finch & Grimmins. Science 2004; 305:1736

7 call text SIXTH FRAMEWORK PROGRAMME PRIORITY [LSH ] [Studying human development and the ageing process] Call text LSH : Integration of research in development and ageing - NETWORK OF EXCELLENCE. The aim of the project is to determine the influence of genetic, environmental, and stochastic effects during development on the ageing process. The project should integrate the corresponding research in invertebrate and vertebrate model systems and their application in humans

8 models humans LifeSpan research field development ageing LifeSpan organisms humans models development ageing

9 world leaders No. Participant organisation name short name Scientific team leaders 1 Leiden University Medical LUMC R. Westendorp Center, Dept. of Gerontology & E. Slagboom Geriatrics (coordinator) J. Ton 2 Institute of Biology Leiden, section of Evolutionary Biology 3 Austrian Academy of Sciences, Institute for Biomedical Ageing Research 4 University of Tartu, Institute of Molecular and Cell Biology 5 1) Erasmus University Rotterdam, Dept. of Genetics and Cell Biology 6 INSERM U515, Hopital Saint- Antoine 7 University of Lausanne, Department of Ecology and Evolution 8 Eberhard-Karls-Universität Tübingen, Tübingen Ageing and Tumour Immunology Group 9 Albert-Ludwigs University of Freiburg, Bio 3, Bioinformatics and Molecular Genetics 10 University of Newcastle, Institute for Ageing and Health 11 University of Southern Denmark, Institute of Epidemiology and Public Health 12 Karolinska Institutet, Department of Medical Epidemiology and Biostatistics 13 Norwegian University of Life Sciences, Department of Animal and Aquacultural Sciences 14 University College London, Dept. of Biology IBL OEAW B. Zwaan P. Brakefield E. de Pauw B.Grubeck- Loebenstein Town Leiden Leiden Innsbruck Country Netherlands Netherlands Austria IMCB A. Metspalu Tartu Estonia EUR J. Hoeijmakers Rotterdam Netherlands INSERM M. Holzenberger Paris France U515 DEE L. Keller Lausanne Switzerland UT G. Pawelec Tübingen Germany ALU.FR M. Hertweck R. Baumeister Freiburg Germany UNEW T. Kirkwood Newcastle UK upon Tyne SDU K. Christensen Odense Denmark KI S. Cnattingius Stockholm Sweden UMB UCL R. Aamodt S. Omholt D. Gems L. Partridge Aas London Norway 15 1) DNage DNage J. Hoeijmakers Rotterdam Netherlands 16 Leiden/Amsterdam Center for LACDR R. de Rijk Leiden Netherlands Drug Research, Dept. of Medical Pharmacology R. de Kloet 17 OSAÜHING BioData BioData M. Remm Tartu Estonia 18 PANATecs GmbH PANATECS T. Flad Tübingen Germany UK

10 instruments Caenorhabditis elegans Drosophila melanogaster Apis mellifera Solenopsis invicta Bicyclus anynana Homo sapiens Mus musculus Classical models - genetics, general tools, knowledge base Social insects - huge variation in life span, sociality, gene modulation Phenotypic plasticity - Seasonal forms, natural selection, selection lines Old-age cohorts & Twins - Genetic association, gene search, biological parameters -epigenetics

11 life history regulation Gluckman & Hanson. Science 2004; 305:1733

12 early adverse Barker hypothesis Dutch hunger winter Metabolic Syndrome; premature death

13 modern affluent males females log log mortality(q) Zwaan et al. Unpublished

14 life history regulation Gluckman & Hanson. Science 2004; 305:1733

15 environmental chance Traditional focus Future focus conception birth reproduction longevity Environment Adaptation

16 imprinting Epigenetics, genetic variation, GxE Physiology, hormones Life-long immunity, disease cttattatacccacagacgaag aagaattgatgacgtactataa tccaagagccatggaagaag aaacttaagaaccgttcatct Genotype Phenotype Early life Late life

17 twin studies Genes Immunity 2005;6:

18 life history regulation Gluckman & Hanson. Science 2004; 305:1733

19 experiment and observation Bicyclus anynana Drosophila melanogaster Homo sapiens study natural variation and experimental manipulation provide candidate genes test candidate genes Model organisms cover the full range from genotype to phenotype

20 private and public Private survival Public reproduction

21 gene mapping LINKAGE mapping: uses a single generation of lab recombination to map differences between parental lines ASSOCIATION mapping: relies on many generations of recombination to map variation in large populations

22 different environments

23 LifeSpan General public Health-care professional Networks Scientists & Industry

24