Mutagenéza in vitro a in vivo

Size: px
Start display at page:

Download "Mutagenéza in vitro a in vivo"

Transcription

1 Mutagenéza in vitro a in vivo chemická/fyzikálna mutagenéza vs. cielená mutagenéza transpozónová mutagenéza vs. disrupcie/výmeny génov využitie RNA interferencie cielené ovplyvnenie expresie génu na úrovni RNA (knockdown)

2 Typy mutácií synonymná vs. nesynonymná substitučná mutácia

3 Mutagenéza klasický prístup rôzne fyzikálne a chemické mutagény vs. molekulárny prístup náhodné mutácie zmeny podmienok syntézy DNA (in vitro) napr. PCR mutátorové kmene E. coli (in vivo) transpozónová mutagenéza definované zmeny oligonukleotidová mutagenéza prerušenie/delécia génov výmena génov inzercia génov

4 Čo môžu spôsobiť mutácie? Cerebellar abnormalities in tmgc26 / mutants Lx mutant rats (polydactyly-luxate syndrome) Liska a kol. (2009)

5 Čo môžu spôsobiť mutácie? kvasinkové cdc mutanty, mitochondriálne mutanty,

6 Mutagenéza klasický prístup rôzne fyzikálne a chemické mutagény vs. molekulárny prístup náhodné mutácie zmeny podmienok syntézy DNA (in vitro) napr. PCR mutátorové kmene E. coli (in vivo) transpozónová mutagenéza definované zmeny oligonukleotidová mutagenéza prerušenie/delécia génov výmena génov inzercia génov

7 Náhodná mutagenéza in vitro

8 Náhodná mutagenéza in vivo Escherichia coli XL1-Red muts (error-prone mismatch repair) mutd (deficient in 3 - to 5 -exonuclease of DNA polymerase III) mutt (unable to hydrolyze 8-oxodGTP) Greener a kol. (1997)

9 Transpozónová inzerčná mutagenéza v baktériách

10 Sleeping beauty transpozónová inzerčná mutagenéza vyšších eukaryotov Ivics a kol. (2011)

11 Sleeping beauty inzerčná mutagenéza potkanov Ivics a kol. (2011)

12 Mutagenéza klasický prístup rôzne fyzikálne a chemické mutagény (in vivo, in vitro) vs. molekulárny prístup náhodné mutácie mutátorové kmene E. coli (in vivo) zmeny podmienok syntézy DNA (in vitro) napr. PCR transpozónová mutagenéza cielená mutagenéza - definované zmeny oligonukleotidová mutagenéza prerušenie/delécia génov výmena génov inzercia génov

13 Michael Smith - Nobelova cena za chémiu, 1993 for his fundamental contributions to the establishment of oligonucleotide-based, site-directed mutagenesis and its development for protein studies Výsledná populácia je zmesou mutovaných a pôvodných DNA

14 Cirkulárna mutagenéza a degradácia templátu s DpnI metylovaný plazmid primery s mutáciou DNA polymeráza, dntp (napr. PCR) produkt nie je metylovaný degradácia templátu enzýmom DpnI (štiepi G m ATC sekvencie) transformácia do E.coli izolácia mutovaného plazmidu

15 UNG (uracil-n-glycosylase) Degradácia templátu v ung + kmeni E.coli (Kunkelova metóda)

16 Disrupcie a výmeny génov

17 Negatívna selekcia s použitím kyseliny 5-fluoroorotovej (5-FOA) b) Orotidine-5 -phosphate Decarboxylase (URA3) b

18 Prerušenie a výmena génov v kvasinkách disrupcia eliminácia markera (counter-selection) výmena alely

19 Cielená mutagenéza u vyšších eukaryotov

20 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka do náhodného lokusu/lokusov (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek u myší knock-out knock-in

21 Disrupcie a výmeny génov u vyšších eukaryotov prečo? Myší model syndrómu KID (keratitída, ichtióza, hluchota mutácia Cx26-G45E v konexíne) Mese a kol., MBoC 2011 Potkaní model obezity (produkuje ľudský ubikvitínový elongačný faktor E4B, neurodegenerácia hypotalamu) Susaki a Nakayama, Aging 2010 Model starnutia (Xpd mutant, helikáza)

22 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka náhodná (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek knock-out knock-in

23 Príprava transgénnych organizmov: náhodná inzercia rekombinantnej DNA do oplodneného vajíčka izolácia DNA klonovanie do vektora implantácia embryí mikroinjekcia vektora do oocytov transgénne myši

24 Príprava transgénnych organizmov: náhodná inzercia rekombinantnej DNA do oplodneného vajíčka náhodná integrácia nepredvídateľné množstvo kópií nepredvídateľná expresia

25 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka náhodná (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek knock-out knock-in

26 Príprava transgénnych organizmov: cielená inzercia rekombinantnej DNA do oplodneného vajíčka pomocou zinc finger nucleases

27 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka náhodná (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek knock-out knock-in

28 The Nobel Prize in Physiology or Medicine 2007 "for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells" Mario R. Capecchi Sir Martin J. Evans Oliver Smithies

29 Izolácia embryonálnych kmeňových (EC) buniek Courtesy of Andras Nagy

30 Selekcia pozitívnych ES buniek

31 Selekcia pozitívnych ES buniek

32

33 Cre-loxP system (bacteriophage P1) loxp locus cross-over in P1 Cre recombinase loxp A palindrome core palindrome ATAACTTCGTATAATGTATGCTATACGAAGT TAT x ATAACTTCGTATAATGTATGCTATACGAAGT TAT Cre recombinase B ATAACTTCGTATAATGTATGCTATACGAAGT TAT x ATAACTTCGTATAATGTATGCTATACGAAGT TAT Cre recombinase

34 Tkanivovo-špecifický knock-out génu

35 Mutagenéza in vitro a in vivo chemická/fyzikálna mutagenéza vs. cielená mutagenéza transpozónová mutagenéza vs. disrupcie/výmeny génov využitie RNA interferencie cielené ovplyvnenie expresie génu na úrovni RNA (knockdown)

36 Mutagenéza in vitro a in vivo chemická/fyzikálna mutagenéza vs. cielená mutagenéza transpozónová mutagenéza vs. disrupcie/výmeny génov využitie RNA interferencie cielené ovplyvnenie expresie génu na úrovni RNA (knockdown) The Nobel Prize in Physiology or Medicine 2006 "for their discovery of RNA interference - gene silencing by double-stranded RNA Andrew Z. Fire Craig C. Mello

37 Malé interferujúce RNA (sirna)

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which

More information

The Nobel Prize in Physiology or Medicine 2007

The Nobel Prize in Physiology or Medicine 2007 The Nobel Prize in Physiology or Medicine 2007 is awarded jointly to Mario R. Capecchi, Martin J. Evans and Oliver Smithies for their discoveries of principles for introducing specific gene modifications

More information

June 09, 2009 Random Mutagenesis

June 09, 2009 Random Mutagenesis Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center

More information

Biochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!!

Biochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!! Biochemistry Major Talk 2014-15 August 14, 2015 Department of Biochemistry The University of Hong Kong Welcome!!!!!!!!!!!!!! Introduction to Biochemistry A four-minute video: http://www.youtube.com/watch?v=tpbamzq_pue&l

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2012 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation

More information

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2011 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation

More information

Molecular Biology. Yeast Transformation. Yeast Plasmids. Gene Disruption, tagging. Cloning by Complementation. Epistasis

Molecular Biology. Yeast Transformation. Yeast Plasmids. Gene Disruption, tagging. Cloning by Complementation. Epistasis Molecular Biology Yeast Transformation Yeast Plasmids Gene Disruption, tagging Cloning by Complementation Epistasis Transformation Transformation: introduction of DNA 1978, ca 1000x less efficient than

More information

Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS

Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing: Tools to Support CRISPR/Cas9 Applications Genome editing is enabled by the development of tools to make precise, targeted changes

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2010 Bad Schandau Methods additional genetic information transgenic mouse line gene inactivation gene-deficient knockout mouse line Jak2

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Techniques in Molecular Biology (to study the function of genes)

Techniques in Molecular Biology (to study the function of genes) Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD

Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD Design high specificity CRISPR-Cas9 grnas: principles and tools Heidi Huang, PhD Webinar Agenda 1 2 3 4 Introduction of CRISPR-Cas9 grna Design Resources and Services Q&A 2 What is CRISPR? CRISPR Clustered

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.

Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

What is the difference between basal and activated transcription?

What is the difference between basal and activated transcription? What is the difference between basal and activated transcription? Regulation of Transcription I. Basal vs. activated transcription for mrna genes A. General transcription factor (TF) vs. promoterspecific

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN

More information

The automated mouse: Systematic generation of disease models

The automated mouse: Systematic generation of disease models The automated mouse: Systematic generation of disease models Nadia Rosenthal EMBL Mouse Biology Monterotondo, Rome Harefield Heart Science Centre Imperial College London Australian Regenerative Medicine

More information

Von Mäusen und Menschen E - 1

Von Mäusen und Menschen E - 1 Von Mäusen und Menschen E - 1 Mus musculus: Genetic Portrait of the House Mouse E - 3 Outline Mouse genome Mouse life cycle Transgenic protocols Addition of genes by nuclear injection Removal of genes

More information

RNAi. Martin Latterich

RNAi. Martin Latterich RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of

More information

Grantsmanship and THE BASICS OF SCIENCE GRANT WRITING THREE GOLDEN RULES: May 10, 2011. Peter Wagner, UCSD Dept of Medicine. pdwagner@ucsd.

Grantsmanship and THE BASICS OF SCIENCE GRANT WRITING THREE GOLDEN RULES: May 10, 2011. Peter Wagner, UCSD Dept of Medicine. pdwagner@ucsd. Grantsmanship and Funding Fest Series May 10, 2011 Presented by UCSD Office of Postdoctoral and Visiting Scholar Affairs TSRI Office of Career and Postdoctoral Services THE BASICS OF SCIENCE GRANT WRITING

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Gene Therapy- Past, Present and Future. Mark A. Kay MD, PhD Dennis Farrey Family Professor Departments of Pediatrics and Genetics Stanford University

Gene Therapy- Past, Present and Future. Mark A. Kay MD, PhD Dennis Farrey Family Professor Departments of Pediatrics and Genetics Stanford University Gene Therapy- Past, Present and Future Mark A. Kay MD, PhD Dennis Farrey Family Professor Departments of Pediatrics and Genetics Stanford University Definition of gene therapy Gene therapy is the introduction

More information

Psychoonkology, Sept. 2010 lifestyle factors and epigenetics

Psychoonkology, Sept. 2010 lifestyle factors and epigenetics Psychoonkology, Sept. 2010 lifestyle factors and epigenetics Alexander G. Haslberger Dep. für Ernährungswissenschaften Univ. of Vienna Working group: Food, GI-Microbiology, Epigenetics Content Health:

More information

RNAi: principle DNA RNA PROTEIN

RNAi: principle DNA RNA PROTEIN RNAi: principle RNAi DNA RNA PROTEIN Transcription (nucleus) Translation (cytoplasm) Many diseases develop from the undesirable production of specific proteins (oncogene products, mutant proteins, toxins,

More information

Wnt signaling in adult intestinal stem cells and cancer - an insight from transgenic mice

Wnt signaling in adult intestinal stem cells and cancer - an insight from transgenic mice Wnt signaling in adult intestinal stem cells and cancer - an insight from transgenic mice Vladimir Korinek Department of Cell and Developmental Biology Institute of Molecular Genetics, v.v.i., Prague,

More information

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms

More information

Long-Term Effects of Drug Addiction

Long-Term Effects of Drug Addiction Long-Term Effects of Drug Addiction Part 1: Addiction is a chronic disease Drug addiction is considered a chronic brain disease because drugs cause long-lasting changes in brain structure and function.

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Trasposable elements: P elements

Trasposable elements: P elements Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Wide range of high-quality enzymes and proteins for molecular biology

Wide range of high-quality enzymes and proteins for molecular biology Enzymes & Proteins Wide range of high-quality enzymes and proteins for molecular biology ENZYMES & PROTEINS We offer a wide range of high-quality enzymes and proteins for molecular biology including proteases,

More information

Chapter 8. Summary and Perspectives

Chapter 8. Summary and Perspectives Chapter 8 Summary and Perspectives 131 Chapter 8 Summary Overexpression of the multidrug resistance protein MRP1 confer multidrug resistance (MDR) to cancer cells. The contents of this thesis describe

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D., Chief Scientific Officer, Trevigen, Inc., Gaithersburg, MD For further infomation, please contact: William Booth, Ph.D. Tel: +44 (0)1235

More information

Molecular Cloning, Product Brochure

Molecular Cloning, Product Brochure , Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE

More information

Nucleic Acid Amplification Life Science Dashboard Series 3

Nucleic Acid Amplification Life Science Dashboard Series 3 Brochure More information from http://www.researchandmarkets.com/reports/1937244/ Nucleic Acid Amplification Life Science Dashboard Series 3 Description: Nucleic acid amplification is one of the most commonly

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes

CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE Section B: Sex Chromosomes 1. The chromosomal basis of sex varies with the organism 2. Sex-linked genes have unique patterns of inheritance 1. The chromosomal

More information

Milestones of bacterial genetic research:

Milestones of bacterial genetic research: Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical

More information

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100 RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes

More information

Answer Key Problem Set 5

Answer Key Problem Set 5 7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently. Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Site-Directed Mutagenesis Using Oligonucleotide-Based Recombineering

Site-Directed Mutagenesis Using Oligonucleotide-Based Recombineering 17 Site-Directed Mutagenesis Using Oligonucleotide-Based Recombineering Roman G. Gerlach, Kathrin Blank and Thorsten Wille Robert Koch-Institute Wernigerode Branch Germany 1. Introduction Methods enabling

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

Primetime for KNIME:

Primetime for KNIME: Primetime for KNIME: Towards an Integrated Analysis and Visualization Environment for RNAi Screening Data F. Oliver Gathmann, Ph. D. Director IT, Cenix BioScience Presentation for: KNIME User Group Meeting

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

Basic attributes of genetic processes (replication, transcription, translation)

Basic attributes of genetic processes (replication, transcription, translation) 411-3 2008 Lecture notes I. First general topic in the course will be mutation (in broadest sense, any change to an organismʼs genetic material). Intimately intertwined with this is the process of DNA

More information

Support structure for genetic material

Support structure for genetic material Support structure for genetic material 1 Making proteins in the RER Making copies of humans 2 Making copies of cells Making copies of genetic material 3 Making copies of genetic material Making copies

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Systems Biology through Data Analysis and Simulation

Systems Biology through Data Analysis and Simulation Biomolecular Networks Initiative Systems Biology through Data Analysis and Simulation William Cannon Computational Biosciences 5/30/03 Cellular Dynamics Microbial Cell Dynamics Data Mining Nitrate NARX

More information

Crosslinking of archaeal transcription initiation. Christina Bone

Crosslinking of archaeal transcription initiation. Christina Bone Crosslinking of archaeal transcription initiation Christina Bone Transcription Transcription: The process of synthesizing RNA with DNA acting as a template Structure=function Pre-initiation Complex (PIC)

More information

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services

More information

Semiconservative DNA replication. Meselson and Stahl

Semiconservative DNA replication. Meselson and Stahl DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis

More information

Evaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models

Evaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models Group members and Contact details Jacques Robert graduated in medicine from the University of Strasbourg in 1974 and received hi Research projects: The objectives of our group are: (1) to identify preclinical

More information

Interaktionen von Nukleinsäuren und Proteinen

Interaktionen von Nukleinsäuren und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

T to recognize noncomplementary base pairs in

T to recognize noncomplementary base pairs in Copyright 1987 by the Genetics Society of America Repair of a Mismatch Is Influenced by the Base Composition of the Surrounding Nucleotide Sequence Madeleine Jones, Robert Wagner and Miroslav Radman Institut

More information

Exploiting science for engineering: BRCA2 targeted therapies

Exploiting science for engineering: BRCA2 targeted therapies 20.109 MOD1 DNA ENGINEERING Fall 2010 Exploiting science for engineering: BRCA2 targeted therapies Orsi Kiraly Engelward lab Homologous recombination is important No HR chromosomal aberrations cell death

More information

Carbon Hydrogen Oxygen Nitrogen

Carbon Hydrogen Oxygen Nitrogen Concept 1 - Thinking Practice 1. If the following molecules were to undergo a dehydration synthesis reaction, what molecules would result? Circle the parts of each amino acid that will interact and draw

More information

Subject Coverage Read and see these newly featured protocols online at www.cshprotocols.org:

Subject Coverage Read and see these newly featured protocols online at www.cshprotocols.org: Subject Coverage Antibodies Bioinformatics/Genomics Cell Biology Chromatography Computational Biology DNA Delivery/Gene Transfer Electrophoresis Genetics High Throughput Analysis Imaging/Microscopy Immunology

More information

2012 CCR Mouse Research Models. Laboratory Animal Sciences Program CORE Resources

2012 CCR Mouse Research Models. Laboratory Animal Sciences Program CORE Resources National Cancer Institute 2012 CCR Mouse Research Models Mouse 101 Laboratory Animal Sciences Program CORE Resources Lionel Feigenbaum, Ph.D. Laboratory Animal Sciences Program May 7, 2012 CORE Resources

More information

AMES TEST: Bacterial Reverse Mutation Assay

AMES TEST: Bacterial Reverse Mutation Assay AMES TEST: Bacterial Reverse Mutation Assay 1. Introduction The bacteria reversed mutation assay (Ames Test) is used to evaluate the mutagenic properties of test articles. The test uses amino acid-dependent

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

OpenMedicine Foundation (OMF)

OpenMedicine Foundation (OMF) Scientific Advisory Board Director Ronald Davis, Ph.D. Genome Technology Center Paul Berg, PhD Molecular Genetics Mario Capecchi, Ph.D Genetics & Immunology University of Utah Mark Davis, Ph.D. Immunology

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

THE MORINGA ANTIOXIDANT ASSORTMENT, TELOMERES AND AGING. Dr. Howard W. Fisher

THE MORINGA ANTIOXIDANT ASSORTMENT, TELOMERES AND AGING. Dr. Howard W. Fisher THE MORINGA ANTIOXIDANT ASSORTMENT, TELOMERES AND AGING by Dr. Howard W. Fisher As an anti-aging physician, awareness of the factors that will decrease the length or quality of life is necessary knowledge

More information

Gene Transcription in Prokaryotes

Gene Transcription in Prokaryotes Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.

More information

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22 Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker

More information

Functional RNAs; RNA catalysts, mirna,

Functional RNAs; RNA catalysts, mirna, Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

30 th Annual meeting of the Ohio Physiological Society held at the University of Toledo College of Medicine and Life Sciences

30 th Annual meeting of the Ohio Physiological Society held at the University of Toledo College of Medicine and Life Sciences 30 th Annual meeting of the Ohio Physiological Society held at the University of Toledo College of Medicine and Life Sciences Dr. Lance Stechschulte Postdoctoral Fellow Department of Physiology and Pharmacology

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information