Mutagenéza in vitro a in vivo
|
|
- Charla Wilkins
- 7 years ago
- Views:
Transcription
1 Mutagenéza in vitro a in vivo chemická/fyzikálna mutagenéza vs. cielená mutagenéza transpozónová mutagenéza vs. disrupcie/výmeny génov využitie RNA interferencie cielené ovplyvnenie expresie génu na úrovni RNA (knockdown)
2 Typy mutácií synonymná vs. nesynonymná substitučná mutácia
3 Mutagenéza klasický prístup rôzne fyzikálne a chemické mutagény vs. molekulárny prístup náhodné mutácie zmeny podmienok syntézy DNA (in vitro) napr. PCR mutátorové kmene E. coli (in vivo) transpozónová mutagenéza definované zmeny oligonukleotidová mutagenéza prerušenie/delécia génov výmena génov inzercia génov
4 Čo môžu spôsobiť mutácie? Cerebellar abnormalities in tmgc26 / mutants Lx mutant rats (polydactyly-luxate syndrome) Liska a kol. (2009)
5 Čo môžu spôsobiť mutácie? kvasinkové cdc mutanty, mitochondriálne mutanty,
6 Mutagenéza klasický prístup rôzne fyzikálne a chemické mutagény vs. molekulárny prístup náhodné mutácie zmeny podmienok syntézy DNA (in vitro) napr. PCR mutátorové kmene E. coli (in vivo) transpozónová mutagenéza definované zmeny oligonukleotidová mutagenéza prerušenie/delécia génov výmena génov inzercia génov
7 Náhodná mutagenéza in vitro
8 Náhodná mutagenéza in vivo Escherichia coli XL1-Red muts (error-prone mismatch repair) mutd (deficient in 3 - to 5 -exonuclease of DNA polymerase III) mutt (unable to hydrolyze 8-oxodGTP) Greener a kol. (1997)
9 Transpozónová inzerčná mutagenéza v baktériách
10 Sleeping beauty transpozónová inzerčná mutagenéza vyšších eukaryotov Ivics a kol. (2011)
11 Sleeping beauty inzerčná mutagenéza potkanov Ivics a kol. (2011)
12 Mutagenéza klasický prístup rôzne fyzikálne a chemické mutagény (in vivo, in vitro) vs. molekulárny prístup náhodné mutácie mutátorové kmene E. coli (in vivo) zmeny podmienok syntézy DNA (in vitro) napr. PCR transpozónová mutagenéza cielená mutagenéza - definované zmeny oligonukleotidová mutagenéza prerušenie/delécia génov výmena génov inzercia génov
13 Michael Smith - Nobelova cena za chémiu, 1993 for his fundamental contributions to the establishment of oligonucleotide-based, site-directed mutagenesis and its development for protein studies Výsledná populácia je zmesou mutovaných a pôvodných DNA
14 Cirkulárna mutagenéza a degradácia templátu s DpnI metylovaný plazmid primery s mutáciou DNA polymeráza, dntp (napr. PCR) produkt nie je metylovaný degradácia templátu enzýmom DpnI (štiepi G m ATC sekvencie) transformácia do E.coli izolácia mutovaného plazmidu
15 UNG (uracil-n-glycosylase) Degradácia templátu v ung + kmeni E.coli (Kunkelova metóda)
16 Disrupcie a výmeny génov
17 Negatívna selekcia s použitím kyseliny 5-fluoroorotovej (5-FOA) b) Orotidine-5 -phosphate Decarboxylase (URA3) b
18 Prerušenie a výmena génov v kvasinkách disrupcia eliminácia markera (counter-selection) výmena alely
19 Cielená mutagenéza u vyšších eukaryotov
20 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka do náhodného lokusu/lokusov (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek u myší knock-out knock-in
21 Disrupcie a výmeny génov u vyšších eukaryotov prečo? Myší model syndrómu KID (keratitída, ichtióza, hluchota mutácia Cx26-G45E v konexíne) Mese a kol., MBoC 2011 Potkaní model obezity (produkuje ľudský ubikvitínový elongačný faktor E4B, neurodegenerácia hypotalamu) Susaki a Nakayama, Aging 2010 Model starnutia (Xpd mutant, helikáza)
22 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka náhodná (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek knock-out knock-in
23 Príprava transgénnych organizmov: náhodná inzercia rekombinantnej DNA do oplodneného vajíčka izolácia DNA klonovanie do vektora implantácia embryí mikroinjekcia vektora do oocytov transgénne myši
24 Príprava transgénnych organizmov: náhodná inzercia rekombinantnej DNA do oplodneného vajíčka náhodná integrácia nepredvídateľné množstvo kópií nepredvídateľná expresia
25 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka náhodná (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek knock-out knock-in
26 Príprava transgénnych organizmov: cielená inzercia rekombinantnej DNA do oplodneného vajíčka pomocou zinc finger nucleases
27 Príprava transgénnych hlodavcov inzercia rekombinantnej DNA do oplodneného vajíčka náhodná (Tg) cielená (zinc finger nucelases) cielená muatgenéza s využitím embryonálnych kmeňových buniek knock-out knock-in
28 The Nobel Prize in Physiology or Medicine 2007 "for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells" Mario R. Capecchi Sir Martin J. Evans Oliver Smithies
29 Izolácia embryonálnych kmeňových (EC) buniek Courtesy of Andras Nagy
30 Selekcia pozitívnych ES buniek
31 Selekcia pozitívnych ES buniek
32
33 Cre-loxP system (bacteriophage P1) loxp locus cross-over in P1 Cre recombinase loxp A palindrome core palindrome ATAACTTCGTATAATGTATGCTATACGAAGT TAT x ATAACTTCGTATAATGTATGCTATACGAAGT TAT Cre recombinase B ATAACTTCGTATAATGTATGCTATACGAAGT TAT x ATAACTTCGTATAATGTATGCTATACGAAGT TAT Cre recombinase
34 Tkanivovo-špecifický knock-out génu
35 Mutagenéza in vitro a in vivo chemická/fyzikálna mutagenéza vs. cielená mutagenéza transpozónová mutagenéza vs. disrupcie/výmeny génov využitie RNA interferencie cielené ovplyvnenie expresie génu na úrovni RNA (knockdown)
36 Mutagenéza in vitro a in vivo chemická/fyzikálna mutagenéza vs. cielená mutagenéza transpozónová mutagenéza vs. disrupcie/výmeny génov využitie RNA interferencie cielené ovplyvnenie expresie génu na úrovni RNA (knockdown) The Nobel Prize in Physiology or Medicine 2006 "for their discovery of RNA interference - gene silencing by double-stranded RNA Andrew Z. Fire Craig C. Mello
37 Malé interferujúce RNA (sirna)
RNAi Shooting the Messenger!
RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which
More informationThe Nobel Prize in Physiology or Medicine 2007
The Nobel Prize in Physiology or Medicine 2007 is awarded jointly to Mario R. Capecchi, Martin J. Evans and Oliver Smithies for their discoveries of principles for introducing specific gene modifications
More informationJune 09, 2009 Random Mutagenesis
Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center
More informationBiochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!!
Biochemistry Major Talk 2014-15 August 14, 2015 Department of Biochemistry The University of Hong Kong Welcome!!!!!!!!!!!!!! Introduction to Biochemistry A four-minute video: http://www.youtube.com/watch?v=tpbamzq_pue&l
More informationHow to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2012 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation
More informationGeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang
G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng
More informationHow to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2011 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation
More informationMolecular Biology. Yeast Transformation. Yeast Plasmids. Gene Disruption, tagging. Cloning by Complementation. Epistasis
Molecular Biology Yeast Transformation Yeast Plasmids Gene Disruption, tagging Cloning by Complementation Epistasis Transformation Transformation: introduction of DNA 1978, ca 1000x less efficient than
More informationGenome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS
Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing: Tools to Support CRISPR/Cas9 Applications Genome editing is enabled by the development of tools to make precise, targeted changes
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationHow to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2010 Bad Schandau Methods additional genetic information transgenic mouse line gene inactivation gene-deficient knockout mouse line Jak2
More informationHCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
More informationTechniques in Molecular Biology (to study the function of genes)
Techniques in Molecular Biology (to study the function of genes) Analysis of nucleic acids: Polymerase chain reaction (PCR) Gel electrophoresis Blotting techniques (Northern, Southern) Gene expression
More information4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
More informationDesign high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD
Design high specificity CRISPR-Cas9 grnas: principles and tools Heidi Huang, PhD Webinar Agenda 1 2 3 4 Introduction of CRISPR-Cas9 grna Design Resources and Services Q&A 2 What is CRISPR? CRISPR Clustered
More informationDicer Substrate RNAi Design
INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of
More informationSite-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationWhat is the difference between basal and activated transcription?
What is the difference between basal and activated transcription? Regulation of Transcription I. Basal vs. activated transcription for mrna genes A. General transcription factor (TF) vs. promoterspecific
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationImproved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
More informationThe automated mouse: Systematic generation of disease models
The automated mouse: Systematic generation of disease models Nadia Rosenthal EMBL Mouse Biology Monterotondo, Rome Harefield Heart Science Centre Imperial College London Australian Regenerative Medicine
More informationVon Mäusen und Menschen E - 1
Von Mäusen und Menschen E - 1 Mus musculus: Genetic Portrait of the House Mouse E - 3 Outline Mouse genome Mouse life cycle Transgenic protocols Addition of genes by nuclear injection Removal of genes
More informationRNAi. Martin Latterich
RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie
More informationDNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationUnderstanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
More informationTroubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
More informationGrantsmanship and THE BASICS OF SCIENCE GRANT WRITING THREE GOLDEN RULES: May 10, 2011. Peter Wagner, UCSD Dept of Medicine. pdwagner@ucsd.
Grantsmanship and Funding Fest Series May 10, 2011 Presented by UCSD Office of Postdoctoral and Visiting Scholar Affairs TSRI Office of Career and Postdoctoral Services THE BASICS OF SCIENCE GRANT WRITING
More informationDesign of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationDNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
More informationGene Therapy- Past, Present and Future. Mark A. Kay MD, PhD Dennis Farrey Family Professor Departments of Pediatrics and Genetics Stanford University
Gene Therapy- Past, Present and Future Mark A. Kay MD, PhD Dennis Farrey Family Professor Departments of Pediatrics and Genetics Stanford University Definition of gene therapy Gene therapy is the introduction
More informationPsychoonkology, Sept. 2010 lifestyle factors and epigenetics
Psychoonkology, Sept. 2010 lifestyle factors and epigenetics Alexander G. Haslberger Dep. für Ernährungswissenschaften Univ. of Vienna Working group: Food, GI-Microbiology, Epigenetics Content Health:
More informationRNAi: principle DNA RNA PROTEIN
RNAi: principle RNAi DNA RNA PROTEIN Transcription (nucleus) Translation (cytoplasm) Many diseases develop from the undesirable production of specific proteins (oncogene products, mutant proteins, toxins,
More informationWnt signaling in adult intestinal stem cells and cancer - an insight from transgenic mice
Wnt signaling in adult intestinal stem cells and cancer - an insight from transgenic mice Vladimir Korinek Department of Cell and Developmental Biology Institute of Molecular Genetics, v.v.i., Prague,
More informationPlant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development
Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms
More informationLong-Term Effects of Drug Addiction
Long-Term Effects of Drug Addiction Part 1: Addiction is a chronic disease Drug addiction is considered a chronic brain disease because drugs cause long-lasting changes in brain structure and function.
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationTrasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationWide range of high-quality enzymes and proteins for molecular biology
Enzymes & Proteins Wide range of high-quality enzymes and proteins for molecular biology ENZYMES & PROTEINS We offer a wide range of high-quality enzymes and proteins for molecular biology including proteases,
More informationChapter 8. Summary and Perspectives
Chapter 8 Summary and Perspectives 131 Chapter 8 Summary Overexpression of the multidrug resistance protein MRP1 confer multidrug resistance (MDR) to cancer cells. The contents of this thesis describe
More informationFunctional and Biomedical Aspects of Genome Research
Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering
More informationGene Regulation -- The Lac Operon
Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:
More informationThe Need for a PARP in vivo Pharmacodynamic Assay
The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D., Chief Scientific Officer, Trevigen, Inc., Gaithersburg, MD For further infomation, please contact: William Booth, Ph.D. Tel: +44 (0)1235
More informationMolecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
More informationNucleic Acid Amplification Life Science Dashboard Series 3
Brochure More information from http://www.researchandmarkets.com/reports/1937244/ Nucleic Acid Amplification Life Science Dashboard Series 3 Description: Nucleic acid amplification is one of the most commonly
More informationHow Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
More informationCHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes
CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE Section B: Sex Chromosomes 1. The chromosomal basis of sex varies with the organism 2. Sex-linked genes have unique patterns of inheritance 1. The chromosomal
More informationMilestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
More informationRIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
More informationAnswer Key Problem Set 5
7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating
More informationRNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
More informationGenetic Engineering and Biotechnology
1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines
More informationMicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationA and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationSite-Directed Mutagenesis Using Oligonucleotide-Based Recombineering
17 Site-Directed Mutagenesis Using Oligonucleotide-Based Recombineering Roman G. Gerlach, Kathrin Blank and Thorsten Wille Robert Koch-Institute Wernigerode Branch Germany 1. Introduction Methods enabling
More informationNotch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
More informationPrimetime for KNIME:
Primetime for KNIME: Towards an Integrated Analysis and Visualization Environment for RNAi Screening Data F. Oliver Gathmann, Ph. D. Director IT, Cenix BioScience Presentation for: KNIME User Group Meeting
More information2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
More informationBasic attributes of genetic processes (replication, transcription, translation)
411-3 2008 Lecture notes I. First general topic in the course will be mutation (in broadest sense, any change to an organismʼs genetic material). Intimately intertwined with this is the process of DNA
More informationSupport structure for genetic material
Support structure for genetic material 1 Making proteins in the RER Making copies of humans 2 Making copies of cells Making copies of genetic material 3 Making copies of genetic material Making copies
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationSystems Biology through Data Analysis and Simulation
Biomolecular Networks Initiative Systems Biology through Data Analysis and Simulation William Cannon Computational Biosciences 5/30/03 Cellular Dynamics Microbial Cell Dynamics Data Mining Nitrate NARX
More informationCrosslinking of archaeal transcription initiation. Christina Bone
Crosslinking of archaeal transcription initiation Christina Bone Transcription Transcription: The process of synthesizing RNA with DNA acting as a template Structure=function Pre-initiation Complex (PIC)
More informationTECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services
More informationSemiconservative DNA replication. Meselson and Stahl
DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis
More informationEvaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models
Group members and Contact details Jacques Robert graduated in medicine from the University of Strasbourg in 1974 and received hi Research projects: The objectives of our group are: (1) to identify preclinical
More informationInteraktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
More informationChapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
More informationT to recognize noncomplementary base pairs in
Copyright 1987 by the Genetics Society of America Repair of a Mismatch Is Influenced by the Base Composition of the Surrounding Nucleotide Sequence Madeleine Jones, Robert Wagner and Miroslav Radman Institut
More informationExploiting science for engineering: BRCA2 targeted therapies
20.109 MOD1 DNA ENGINEERING Fall 2010 Exploiting science for engineering: BRCA2 targeted therapies Orsi Kiraly Engelward lab Homologous recombination is important No HR chromosomal aberrations cell death
More informationCarbon Hydrogen Oxygen Nitrogen
Concept 1 - Thinking Practice 1. If the following molecules were to undergo a dehydration synthesis reaction, what molecules would result? Circle the parts of each amino acid that will interact and draw
More informationSubject Coverage Read and see these newly featured protocols online at www.cshprotocols.org:
Subject Coverage Antibodies Bioinformatics/Genomics Cell Biology Chromatography Computational Biology DNA Delivery/Gene Transfer Electrophoresis Genetics High Throughput Analysis Imaging/Microscopy Immunology
More information2012 CCR Mouse Research Models. Laboratory Animal Sciences Program CORE Resources
National Cancer Institute 2012 CCR Mouse Research Models Mouse 101 Laboratory Animal Sciences Program CORE Resources Lionel Feigenbaum, Ph.D. Laboratory Animal Sciences Program May 7, 2012 CORE Resources
More informationAMES TEST: Bacterial Reverse Mutation Assay
AMES TEST: Bacterial Reverse Mutation Assay 1. Introduction The bacteria reversed mutation assay (Ames Test) is used to evaluate the mutagenic properties of test articles. The test uses amino acid-dependent
More informationEU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
More informationGenetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.
Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationThermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
More informationChapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
More informationOpenMedicine Foundation (OMF)
Scientific Advisory Board Director Ronald Davis, Ph.D. Genome Technology Center Paul Berg, PhD Molecular Genetics Mario Capecchi, Ph.D Genetics & Immunology University of Utah Mark Davis, Ph.D. Immunology
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationDNA Scissors: Introduction to Restriction Enzymes
DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe
More information岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationTHE MORINGA ANTIOXIDANT ASSORTMENT, TELOMERES AND AGING. Dr. Howard W. Fisher
THE MORINGA ANTIOXIDANT ASSORTMENT, TELOMERES AND AGING by Dr. Howard W. Fisher As an anti-aging physician, awareness of the factors that will decrease the length or quality of life is necessary knowledge
More informationGene Transcription in Prokaryotes
Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.
More informationFive-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22
Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker
More informationFunctional RNAs; RNA catalysts, mirna,
Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More information30 th Annual meeting of the Ohio Physiological Society held at the University of Toledo College of Medicine and Life Sciences
30 th Annual meeting of the Ohio Physiological Society held at the University of Toledo College of Medicine and Life Sciences Dr. Lance Stechschulte Postdoctoral Fellow Department of Physiology and Pharmacology
More informationCoding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
More information