Site-directed mutagenesis

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Site-directed mutagenesis"

Transcription

1 Site-directed mutagenesis Adrian Suarez Covarrubias Modified from Sherry Mowbray s 1

2 Content DNA, PCR, oligonucleotides Reverse PCR mutagenesis Quick change mutagenesis Multi-change mutagenesis Oligonucleotide design 2

3 Applications A few examples... Protein: Change one or more specific amino acids in a protein, e.g. functional studies RNA: Change one or more specific nucleotides to study structure/function, e.g catalytic sites DNA: Change one or more specific nucleotides to study regulatory elements, e.g promoters...but there are MANY more applications 3

4 Structure of DNA 5 - P-ACTG-OH-3 3 -HO-TGAC-P -5 Resistant to exo-nucleases 4

5 Polymerase chain reaction (PCR): General application 5

6 Polymerase chain reaction (PCR): Steps 6

7 PCR primers to introduce mutations 7

8 Reverse PCR mutagenesis Excellent method for introducing deletions or insertions 8

9 Reverse PCR mutagenesis, steps The primers must be phosphorylated or you must kinase your product 9

10 Quick change mutagenesis Excellent method for introducing small mutations T A 10

11 Quick change mutagenesis 11

12 Multi-change mutagenesis Excellent method for introducing multiple mutations 12

13 Getting rid off the template plasmid Large excess of mutated plasmid, may not use DpnI DpnI!!! DpnI!!! 13

14 DpnI recognition XXXACGTTCAGATCATGGCCTTXXX XXXTGCAAGTCTAGTACCGGAAXXX Dam methylase in E. coli methylates A in GATC sequences CH3 XXXACGTTCAGATCATGGCCTTXXX XXXTGCAAGTCTAGTACCGGAAXXX CH3 H H N Adenosin CH3 H N 14 N6-methyladenosin

15 DpnI recognition XXXACGTTCAGATCATGGCCTTXXX XXXTGCAAGTCTAGTACCGGAAXXX CH3 Dam methylase in E. coli methylates A in GATC sequences XXXACGTTCAGATCATGGCCTTXXX XXXTGCAAGTCTAGTACCGGAAXXX CH3 MboI - cut only unmethylated DNA Isoschizomers DpnI - cut only methylated DNA Sau3AI - cut both un/methylated DNA CH3 XXXACGTTCAGATCATGGCCTTXXX XXXTGCAAGTCTAGTACCGGAAXXX hemimethylated 15

16 DpnI sites in pbadtopothio vector DpnI cleaves the vector 24 times Largest fragment will be 979 bp In the lab rpia is inserted into a modified version of pbadtopothio 16

17 Steps in quick change mutagenesis (1) Introduce mutation with PCR Plasmid with your gene (from dam+ strain) Add your mutagenic primers G T A Wild-type sequence XXXCAAGACGATCTCXXX XXXCAAGGCGATCTCXXX Mutant sequence C Mutation introduced G Cleave old plasmid with DpnI Run PCR (use proof reading polymerase) C G C A G T C All these steps are performed in vitro 17

18 Steps in quick change mutagenesis (2) Transform cells and verify the mutation Plasmid with your gene hopefully mutated G Sealed plasmid with mutation? C 2 C G 1 G C E. coli with your mutated? plasmid PCR with analytical primer Transformation Plasmid purification E. coli seals the DNA strands with ligase and replicates the plasmid 2 1 PCR fragment=you have mutated your gene! Analytical primer hibridize and is extended only on your mutated gene 18

19 Design of mutagenic oligonucleotides We need two complementary oligonucleotides with the mutation in the center The oligos should be about 18 nt on each side of the mutation (max. length of oligo = 46 nt) and the GC content about 40-50% (optimally 50%) If possible, the first and last nucleotide of the oligos should be a G or a C The melting temperature (Tm) of your mutation oligos should be ~78 C Tm = 81,5 + 0,41(%GC) - 675/N -%mismatch E.g. to mutate A to G in: 5..AAAAACTCTCCGTTCTCGATGATAATCCTCGAATTGACCTCGAAAA TTTTTGAGAGGCAAGAGCTACTATTAGGAGCTTAACTGGAGCTTTT..5 5' CTCTCCGTTCTCGATGATGATCCTCGAATTGACCTCG 3 5' CGAGGTCAATTCGAGGATCATCATCGAGAACGGAGAG 3' 19

20 Analytical PCR For good detection, PCR product should be bp long 20

21 Site directed mutagenesis what do you need? Plasmid with your gene 2 mutagenic primers 1 analytical primer Restriction enzyme (DpnI) Heat stable DNA polymerase datp, dgtp, dctp, dttp Deoxynucleotides (dntps) Competent E. coli PCR machine 21

22 Discussion time Why Johnny can t clone: Common pitfalls and not so common solutions BioTechniques 59:IV-XIII (September 2015) doi /

23 Discussion time Why Johnny can t clone: Common pitfalls and not so common solutions BioTechniques 59:IV-XIII (September 2015) doi / Exponential Megapriming PCR (EMP) Cloning Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints. PLOS One,

KAPA HiFi. Site-directed Mutagenesis. DNA Polymerase. Application Note. 1. Introduction. 2. Materials.

KAPA HiFi. Site-directed Mutagenesis. DNA Polymerase. Application Note. 1. Introduction. 2. Materials. KAPA HiFi DNA Polymerase 1. Introduction Site-directed mutagenesis is a powerful tool for protein engineering and the study of protein structure and function. Numerous methods of site-directed mutagenesis

More information

June 09, 2009 Random Mutagenesis

June 09, 2009 Random Mutagenesis Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct.

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct. Lectures 19 and 20 Chapter 12: DNA Replication and Recombination DNA Replication is semiconservative Meselson-Stahl experiment: 15 N-labeling and CsCl density gradient centrifugation. Problem set 3A: due

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Paul C Winter, Belfast City Hospital, Belfast, UK The polymerase chain reaction is a technique that allows DNA molecules of interest (usually gene sequences) to be copied

More information

Stratagene Mutagenesis Solutions for Your Protein Engineering Needs

Stratagene Mutagenesis Solutions for Your Protein Engineering Needs Stratagene Mutagenesis Solutions for Your Protein Engineering Needs Protein engineering via mutagenesis allows researchers to modulate protein activity and characterize structurefunction relationships,

More information

POLYMERASE CHAIN REACTION (PCR)

POLYMERASE CHAIN REACTION (PCR) POLYMERASE CHAIN REACTION (PCR) The polymerase chain reaction (PCR) is a technique used to amplify specific segments of DNA that may range in size from ca. 200-2000 or more base pairs. Two recent papers

More information

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN

More information

DNA. Form and Function

DNA. Form and Function DNA Form and Function DNA: Structure and replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence Lecture 10 Analysis of Gene Sequences Anatomy of a bacterial gene: Promoter Coding Sequence (no stop codons) mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA,

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY I. General Info A. Landmarks in modern genetics 1. Rediscovery of Mendel s work 2. Chromosomal theory of inheritance 3. DNA as the genetic material

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

DNA TECHNOLOGY- methods for studying and manipulating genetic material.

DNA TECHNOLOGY- methods for studying and manipulating genetic material. 1 DNA TECHNOLOGY- methods for studying and manipulating genetic material. BIOTECHNOLOGY, the manipulation of organisms or their components to make useful products. Biotechnology today usually refers to

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Molecular Cloning, Product Brochure

Molecular Cloning, Product Brochure , Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE

More information

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) 05 PCR primer design 05.01 Design criteria PCR: an overview (from 02.01) PCR fidelity and optimization Primer design alessandro bogliolo isti information science and technology institute 1/20 Polymerase

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Question 1 Solutions to 7.012 Problem Set 5 Restriction

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

LEVEL TWO BIOLOGY: GENE EXPRESSION

LEVEL TWO BIOLOGY: GENE EXPRESSION LEVEL TWO BIOLOGY: GENE EXPRESSION Protein synthesis DNA structure and replication Polypeptide chains and amino acids Mutations Metabolic pathways Protein Synthesis: I can define a protein in terms of

More information

Chapter 9 Homework Assignment

Chapter 9 Homework Assignment Chapter 9 Homework Assignment We will not cover the entire chapter. Please use the lecture notes and the Review Sheet for testable material I have decided to alter the homework assignment for Chapter 9.

More information

Answer Key. Bacterial Genetics, BIO 4443/6443 Spring Semester 2001 Exam I. Name. Student ID#

Answer Key. Bacterial Genetics, BIO 4443/6443 Spring Semester 2001 Exam I. Name. Student ID# Name Student ID# Answer Key Bacterial Genetics, BIO 4443/6443 Spring Semester 2001 Exam I 1.) Describe two general mechanisms by which transcription can terminate in bacteria. (5pts) Factor dependant termination

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system.

Overview. KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. Overview KAPAHiFi HotStart is the engineered KAPAHiFi DNA Polymerase with an antibody-based hot start technology and improved buffer system. KAPAHiFi HotStart exhibits: World leading fidelity confirmed

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

DNA replication (Lecture 28,29)

DNA replication (Lecture 28,29) DNA replication (Lecture 28,29) 1. DNA replication and the cell cycle 2. DNA is Reproduced by Semiconservative Replication 2.1 Conservation of the Original Helix 2.2 The Meselson-Stahl Experiment 2.3 Semiconservative

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Solutions for Recombinant DNA Unit Exam

Solutions for Recombinant DNA Unit Exam Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves

More information

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet PCR Pre-Lab (pg. 1-3) PCR Pre-Lab Answers (pg. 4-7) RNAi Pre-Lab (pg. 8) RNAi Pre-Lab Answers (pg. 9-10 Gel Electrophoresis Worksheet (pg.

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Chap 4 Synthesis, Sequencing and Amplification of DNA

Chap 4 Synthesis, Sequencing and Amplification of DNA Chap 4 Synthesis, Sequencing and Amplification of DNA Why chemical synthesis of DNA? [1] 1. Used as a probe for DNA detection (Hybridization and Southern blotting) 2. Synthesized DNA for the assembly of

More information

Reminder. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA.

Reminder. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA. DNA Replication Genes are DNA. Reminder DNA is a double-stranded molecule. The genetic information in a gene is encoded in the sequence of bases on one strand of DNA. 1 10 20 30 40 50 60 70 80 90 100 AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Introduction to cloning

Introduction to cloning 1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria

More information

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 2. True or False? Dideoxy sequencing is a chain initiation method of DNA sequencing. False

More information

Ultramer. Oligonucleotides. Mutagenesis Application Guide. Experimental Overview, Protocol, Troubleshooting

Ultramer. Oligonucleotides. Mutagenesis Application Guide. Experimental Overview, Protocol, Troubleshooting Ultramer Oligonucleotides Mutagenesis Application Guide Experimental Overview, Protocol, Troubleshooting Ultramer Oligonucleotides Mutagenesis Application Guide Experimental Overview, Protocol, Troubleshooting

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells DNA CLONING DNA CLONING: amplification of unique DNA molecules In vitro-pcr In vivo-in different host cells POLYMERASE CHAIN REACTION (PCR) PCR THE POLYMERASE CHAIN REACTION (PCR) PROVIDES AN EXTREMELY

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad Biochem 717 Gene Cloning Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad How to construct a recombinant DNA molecule? DNA isolation Cutting of DNA molecule with the help of restriction

More information

Part III. Genetic information replication and flow

Part III. Genetic information replication and flow Part III Genetic information replication and flow Chapter 16 DNA Biosynthesis and Recombination The biological function of DNA Store genetic information Replicate genetic information Express genetic information

More information

Chap 4 Synthesis, Sequencing and Amplification of DNA

Chap 4 Synthesis, Sequencing and Amplification of DNA Chap 4 Synthesis, Sequencing and Amplification of DNA Why chemical synthesis of DNA? [1] 1. Used as a probe for DNA detection (Hybridization and Southern blotting) 2. Synthesized DNA for the assembly of

More information

1. Location matters: Primers should flank the DNA you want to amplify

1. Location matters: Primers should flank the DNA you want to amplify MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 Primer design Where do primers come from? generally purchased from a company, who makes them by chemical synthesis How do

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

The most popular method for doing this is called the dideoxy method or Sanger method (named after its inventor, Frederick Sanger, who was awarded the

The most popular method for doing this is called the dideoxy method or Sanger method (named after its inventor, Frederick Sanger, who was awarded the DNA Sequencing DNA sequencing is the determination of the precise sequence of nucleotides in a sample of DNA. The most popular method for doing this is called the dideoxy method or Sanger method (named

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

DNA Structure and Replication. Chapter Nine

DNA Structure and Replication. Chapter Nine DNA Structure and Replication Chapter Nine 2005 We know: DNAis the hereditary material DNAhas a double helix structure Made of four bases; A,T,C,G Sugar-Phosphate backbone DNAreplication is semi-conservative

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

PCR-based technologies

PCR-based technologies Using molecular marker technology in studies on plant genetic diversity DNA-based technologies PCR-based technologies PCR basics Copyright: IPGRI and Cornell University, 2003 PCR basics 1 Contents! The

More information

MMG 301 Lec. 28 Genetic Engineering Basics

MMG 301 Lec. 28 Genetic Engineering Basics MMG 301 Lec. 28 Genetic Engineering Basics Questions for Today: 1. How does one obtain a DNA fragment containing the desired gene using restriction enzymes? using the Polymerase Chain Reaction (PCR)? 2.

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

CHAPTER 3 Molecular Genetics DNA Replication

CHAPTER 3 Molecular Genetics DNA Replication CHAPTER 3 Molecular Genetics DNA Replication Watson and Crick DNA model implies a mechanism for replication: a. Unwind the DNA molecule. b. Separate the two strands. c. Make a complementary copy for each

More information

PrimeSTAR GXL DNA Polymerase

PrimeSTAR GXL DNA Polymerase For Research Use PrimeSTAR GXL DNA Polymerase Product Manual Table of Contents I. Description...3 II. Components...3 III. Storage...3 IV. Protocols...4 V. Optimization of Parameters...6 VI. Electrophoresis,

More information

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics SBI4U1 Molecular Genetics Recall: mitosis requires that each daughter cell has an exact copy of parent DNA. Ms. Ponvia The Watson-Crick model suggests how this occurs: Parent DNA molecule unzips, creating

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Lecture 37: Polymerase Chain Reaction

Lecture 37: Polymerase Chain Reaction Lecture 37: Polymerase Chain Reaction We have already studied basics of DNA/RNA structure and recombinant DNA technology in previous classes. Polymerase Chain Reaction (PCR) is another revolutionary method

More information

SESSION 2. Possible answer:

SESSION 2. Possible answer: UPDATED CLONE THAT GENE ACTIVITY 2014 TEACHER GUIDE SESSION 2 Key ideas: When creating a recombinant plasmid, it is important to examine the sequences of the plasmid DNA and of the human DNA that contains

More information

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp),

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), deoxyguanosine triphosphate (dgtp), deoxycytidine triphos-phate (dctp),

More information

Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS

Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing TOOLS TO SUPPORT CRISPR/CAS9 APPLICATIONS Genome Editing: Tools to Support CRISPR/Cas9 Applications Genome editing is enabled by the development of tools to make precise, targeted changes

More information

BYB2. General Certificate of Education June 2008 Advanced Subsidiary Examination. BIOLOGY (SPECIFICATION B) Unit 2 Genes and Genetic Engineering

BYB2. General Certificate of Education June 2008 Advanced Subsidiary Examination. BIOLOGY (SPECIFICATION B) Unit 2 Genes and Genetic Engineering Surname Other Names For Examiner s Use Centre Number Candidate Number Candidate Signature General Certificate of Education June 2008 Advanced Subsidiary Examination BIOLOGY (SPECIFICATION B) Unit 2 Genes

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

1º Test. Maximum duration: 2h

1º Test. Maximum duration: 2h 1 Name: Nº 1º Test Maximum duration: 2h Atrazine is an herbicide widely used in agriculture, being able to persist for a long time in soils. Due to soil leaching, atrazine and its toxic derivatives are

More information

2. Enzymes that cleave DNA at specific sites are called.

2. Enzymes that cleave DNA at specific sites are called. Biotechnology 1. The most recent techniques developed in the biological sciences allow the manipulation of DNA with the ultimate goal of intervening directly with the fate of organisms. 2. Enzymes that

More information

Taq98 Hot Start 2X Master Mix

Taq98 Hot Start 2X Master Mix Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com

More information

Lecture 5. GENETICS OF PROKARYOTES

Lecture 5. GENETICS OF PROKARYOTES Lecture 5. GENETICS OF PROKARYOTES 1. Basic concepts 2. The prokaryotic genome 3. The pan-genome 4. Genetic interchange and recombination 4.1. Recombination 4.2. Transformation 4.3. Conjugation 4.4. Transduction

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

MBLG1001 Lecture 8 page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Lecture 8

MBLG1001 Lecture 8 page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Lecture 8 MBLG1001 Lecture 8 page 1 University of Sydney Library Electronic Item CURSE: MBLG1001 Lecturer: Dale ancock Lecture 8 CMMNWEALT F AUSTRALIA Copyright Regulation WARNING This material has been reproduced

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)? 1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The

More information

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation

12/22/2014. Read the introduction. How does a cell make proteins with the information from DNA? Protein Synthesis: Transcription and Translation EQ How does a cell make proteins with the information from DNA? Protein Synthesis: Get Started Get Started Think of a corn cell that is genetically modified to contain the Bt gene and a corn cell that

More information