Null Alleles in Genetic Genealogy. Thomas Krahn

Transcription

1 Null Alleles in Genetic Genealogy 0 Thomas Krahn FTDNA Conference 200

2 Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia) Gene DNA Promotor Transcription RNA Polymerase mrna Splicing Protein Translation Ribosomes Not a sharp definition. Many things can go wrong in the complex gene expression process.

3 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. Note: This is my own definition. Other definitions I found in the literature and on the internet usually focus on a very narrow subtype of a DNA segment. E.g. STR markers.

4 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. For a PCR reaction we need a solution of intact DNA. Degraded (sheared) DNA cannot be amplified because the TAQ polymerase needs to extend one DNA strand down until the reverse primer. If the TAQ drops off from the DNA segment before it reaches the reverse primer we will not get an exponential amplification. Since degraded DNA doesn't represent a species who can have descendants, we exclude degraded DNA from being a Null Allele for genealogical purpose.

5 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. All our known STR markers (e.g. DYS31, DYF385S1, vwa etc.) are DNA segments that are defined by flanking PCR primer sequences. DYS stands for DNA Y-chromosome Segment. The famous database GDB that recorded all primer pairs is unfortunately off-line since summer So it is sometimes difficult to look up the exact primers for D markers from older publications. Genbank still keeps record of a partial subset of the GDB markers. There they are also called STS markers (=Sequence Tagged Sites). An STS may also contain one or more SNP markers.

6 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. The actual characteristic of a Null Allele is that we can't detect a signal from a PCR product. We'll go into detail later what detection means, but this makes already clear that we need to precisely define a detection limit above the background noise of the detection instrument. Some mutations in the primer binding region don't completely inhibit the formation of a PCR product so that a small signal persists despite the mutation. With alternative assays such a small signal may be still identified as a Null Allele.

7 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. Here comes the population genetic aspect of Null Alleles as a usable phylogenetic marker. It is however important to understand the molecular genetic background of the mutation mechanism. Some of these genetic changes may occur independently on completely different branches of the phylogenetic tree, some of them may even be revertible. Depending on the stability of the marker we may need to select independent assays to restrict or confirm the phylogenetic position of a Null Allele marker.

8 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. This makes clear that every Null Allele requires a positive control. This is usually easy with routine STR markers. However, if other samples is restricted to a narrow population the samples with Null Alleles may become the majority. Alternatively a competitive primer may sometimes be designed that inverts the definition of a Null Allele marker to the contrary. This primer matches only the samples who carry the mutation and doesn't yield a PCR product for the normal samples. In our lab we have designed assays that combine both primers so that we are able to properly distinguish the alleles and always get at least one positive result.

9 Basics

10 Basics

11 Basics Capillary electrophoresis to detect the PCR products AATGTCTGGTTGAGGC - +

12 What can go wrong at PCR? Bad DNA template Assay doesn't work Detection method fails If we can exclude the above, but still get no signal from a PCR product => then a NULL allele is very likely (...but not proven).

13 DYS3 Null mutation (L1) Not observed when STR testing was performed in the GRC lab because we use a different forward primer.

14 DYS37 Null

15 DYS31 Null

16 DYS63 Null

17 DYS565 Null

18 DYS8 Null

19 DYS8 Null PCR with more distant primers did NOT yield any PCR products. Regular primer pair Size Standard Outer primers GRC > female GRC > DYS8 GRC > DYS8 1 GRC > DYS8 Null D Y S 8 DYS8 Null PCR product on agarose gel The DYS8 Y-STR marker has been amplified with alternative primers DYS8_f: GAGGAGGATATGTCAAAGGATTC DYS8_r: CAGTTTCACTTCATGTTTGGG and PCR products have been sized on an agarose gel (FlashGel 1.2% agarose Lonza 200V/5min). The positive controls (1 and repeats) show a band ant the expected size of ca. 800 bp. The female negative control and the DYS8 Null allele sample don't have a PCR product and their lanes on the gel are empty. Amplification assays with alternative primer sets practically eliminate the hypothesis of an inhibited PCR due to a mutation on the primer binding site.

20 DYS8 Null Palindromic Pack results are generally inconspicuous... Except DYF37 has possibly only 2 alleles

21 DYS8 Null DYS8 = Null DYS6 = - DYS5 = - DYS01 = - DYF08 = DYF3 = 21t-c (no.1 allele!) DYF37 = - DYS7 = DYS32 = DYS61 DYS52 DYS32 is NOT missing DYS85 DYS32 DYF37 DYS8 P3 DYF37 DYF3 ins G, T-type DYS6 G-type DYS8 is located on the unique loop of the P3 palindrome DYS7 P2 DYS6 C-type N.N. DYS7 DYF37 DYF01 DYF387 DYS5 DYF385 DYS7 DYF371 C-type DYF08 DYF3 T-type DYS6 C-type DYF3 C-type DYS6 C-type DYS7 8 bp 8 bp N.N. DYF37 DYF01 DYF37 only 2 alleles DYF387 DYS5 DYF385 DYS7 DYF3 only 2 alleles and no.1 allele DYF371 C-type DYF08 DYS7 P1 DYS6 and DYS7 only 2 alleles

22 DYS8 Null DYS8 = Null DYS6 = - DYS5 = - DYS01 = - DYF08 = DYF3 = 21t-c (no.1 allele!) DYF37 = - DYS7 = DYS32 = Loop Constellation! DYS7 DYS6 G-type DYF3 ins G, T-type DYS61 DYS52 DYS85 DYS32 DYS7 DYF37 DYS6 C-type DYS8 DYF37 DYF371 C-type DYF3 DYS6 T-type C-type P1 DYF37 DYF 01 DYF37 Recombination DYF 387 DYS 5 DYF 385 DYS 7 DYF371 DYF DYF3 DYS6 DYS C-type 08 C-type C-type 7

23 DYS8 Null Loop Constellation! DYS7 DYS61 DYS6 G-type DYS8 = Null DYS6 = - DYS5 = - DYS01 = - DYF08 = DYF3 = 21t-c (no.1 allele!) DYF37 = - DYS7 = DYS32 = DYF3 ins G, T-type DYS7 DYF37 DYS6 C-type DYS8 DYS52 DYF37 DYS85 DYS32 DYF371 C-type DYF3 DYS6 T-type C-type P1 DYF37 DYF 01 DYF37 DYF 387 DYS 5 DYF 385 DYS 7 DYF371 DYF DYF3 DYS6 DYS C-type 08 C-type C-type 7

24 DYS38 Null

25 DYS38 Null Yfiler Singleplex

26 DYS38 Null Deletion of the middle fragment in between DYS38I and DYS38B DYS38I DYS38II The nomenclature of DYS38 is defined as DYS38I: [TCTG]q [TCTA]r = GenBank top strand DYS38II: [TCTG]n[TCTA]p[TCTG]q [TCTA]r = GenBank top strand See: The deleted sample matches the first 5 repeats [TCTG] from the related samples in R1b1c. It shows repeats of TCTA which we can align to the left or to the right side. 5 x [TCTG] + x [TCTA] = repeat units

27 DYS38 Null Peak shows up at 16 - But really has repeats!

28 DYS38 Null DYS38 Null a b a 5 b a 6 b c d

29 DYS38 Null DYS38I 28? DYS38II 5??? 3?? Looping constellation Recombination Deletion 5

30 DYS Null

31 DYS Null DYS P8 DYS DYS30 DYF35 DYF371 T-type YCAII DYF35 DYF371 C-type DYF DYS385b* YCAII DYF08 P5 DYF08 P DYF DYS61 DYS = DYF371 T-type allele The T-type SNP can get lost by a recloh DYS385a* This is seen as a NULL-Allele if only DYS is tested DYS52 DYS85 DYS32 DYF37 DYS8 P3 DYF37 DYF3 ins G, T-type DYS6 G-type DYS7 P2 DYS6 C-type DYS7 N.N. DYF37 DYF01 DYF387 DYS5 DYF385 DYS7 DYF371 C-type DYF08 DYF3 T-type DYS6 C-type DYF3 C-type DYS6 C-type DYS7 8 bp 8 bp N.N. DYF37 DYF01 DYF387 DYS5 DYF385 DYS7 DYF371 C-type DYF08 DYS7 P1

32 DYS Null / DYF371X DYS DYS Null

33 DYS Null The HUGO sequence has also a Null allele at DYS c-c-c-c Normally in R1b (and most other haplogroups): c-t-c-c

34 Multi Marker Deletion

35 Multi Marker Deletion Marker DYS33 DYS1 DYS31 DYS37 DYS3 DYS38I DYS38II DYS388 DYS38 DYS30 DYS26 DYS385b DYS385a DYS32 Allele Region ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY Start Stop Possible P1/P5 deletion in the palindromic region

36 GRC Lab Pics Astrid Krahn (mt hg J)

37 GRC Lab Pics Dr. Connie Bormans (mt hg I)

38 GRC Lab Pics Jory Clark (Y hg T)

39 GRC Lab Pics Brent Maning (Y hg R-U6*)

40 GRC Lab Pics Dr. Arjan Bormans (Y hg R-L2*)

41 GRC Lab Pics...and our other lab coworkers Thanks for listening!