Null Alleles in Genetic Genealogy. Thomas Krahn

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Null Alleles in Genetic Genealogy. Thomas Krahn"

Transcription

1 Null Alleles in Genetic Genealogy 0 Thomas Krahn FTDNA Conference 200

2 Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia) Gene DNA Promotor Transcription RNA Polymerase mrna Splicing Protein Translation Ribosomes Not a sharp definition. Many things can go wrong in the complex gene expression process.

3 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. Note: This is my own definition. Other definitions I found in the literature and on the internet usually focus on a very narrow subtype of a DNA segment. E.g. STR markers.

4 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. For a PCR reaction we need a solution of intact DNA. Degraded (sheared) DNA cannot be amplified because the TAQ polymerase needs to extend one DNA strand down until the reverse primer. If the TAQ drops off from the DNA segment before it reaches the reverse primer we will not get an exponential amplification. Since degraded DNA doesn't represent a species who can have descendants, we exclude degraded DNA from being a Null Allele for genealogical purpose.

5 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. All our known STR markers (e.g. DYS31, DYF385S1, vwa etc.) are DNA segments that are defined by flanking PCR primer sequences. DYS stands for DNA Y-chromosome Segment. The famous database GDB that recorded all primer pairs is unfortunately off-line since summer So it is sometimes difficult to look up the exact primers for D markers from older publications. Genbank still keeps record of a partial subset of the GDB markers. There they are also called STS markers (=Sequence Tagged Sites). An STS may also contain one or more SNP markers.

6 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. The actual characteristic of a Null Allele is that we can't detect a signal from a PCR product. We'll go into detail later what detection means, but this makes already clear that we need to precisely define a detection limit above the background noise of the detection instrument. Some mutations in the primer binding region don't completely inhibit the formation of a PCR product so that a small signal persists despite the mutation. With alternative assays such a small signal may be still identified as a Null Allele.

7 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. Here comes the population genetic aspect of Null Alleles as a usable phylogenetic marker. It is however important to understand the molecular genetic background of the mutation mechanism. Some of these genetic changes may occur independently on completely different branches of the phylogenetic tree, some of them may even be revertible. Depending on the stability of the marker we may need to select independent assays to restrict or confirm the phylogenetic position of a Null Allele marker.

8 Definition of Null Allele Concerning DNA markers: A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction. This makes clear that every Null Allele requires a positive control. This is usually easy with routine STR markers. However, if other samples is restricted to a narrow population the samples with Null Alleles may become the majority. Alternatively a competitive primer may sometimes be designed that inverts the definition of a Null Allele marker to the contrary. This primer matches only the samples who carry the mutation and doesn't yield a PCR product for the normal samples. In our lab we have designed assays that combine both primers so that we are able to properly distinguish the alleles and always get at least one positive result.

9 Basics

10 Basics

11 Basics Capillary electrophoresis to detect the PCR products AATGTCTGGTTGAGGC - +

12 What can go wrong at PCR? Bad DNA template Assay doesn't work Detection method fails If we can exclude the above, but still get no signal from a PCR product => then a NULL allele is very likely (...but not proven).

13 DYS3 Null mutation (L1) Not observed when STR testing was performed in the GRC lab because we use a different forward primer.

14 DYS37 Null

15 DYS31 Null

16 DYS63 Null

17 DYS565 Null

18 DYS8 Null

19 DYS8 Null PCR with more distant primers did NOT yield any PCR products. Regular primer pair Size Standard Outer primers GRC > female GRC > DYS8 GRC > DYS8 1 GRC > DYS8 Null D Y S 8 DYS8 Null PCR product on agarose gel The DYS8 Y-STR marker has been amplified with alternative primers DYS8_f: GAGGAGGATATGTCAAAGGATTC DYS8_r: CAGTTTCACTTCATGTTTGGG and PCR products have been sized on an agarose gel (FlashGel 1.2% agarose Lonza 200V/5min). The positive controls (1 and repeats) show a band ant the expected size of ca. 800 bp. The female negative control and the DYS8 Null allele sample don't have a PCR product and their lanes on the gel are empty. Amplification assays with alternative primer sets practically eliminate the hypothesis of an inhibited PCR due to a mutation on the primer binding site.

20 DYS8 Null Palindromic Pack results are generally inconspicuous... Except DYF37 has possibly only 2 alleles

21 DYS8 Null DYS8 = Null DYS6 = - DYS5 = - DYS01 = - DYF08 = DYF3 = 21t-c (no.1 allele!) DYF37 = - DYS7 = DYS32 = DYS61 DYS52 DYS32 is NOT missing DYS85 DYS32 DYF37 DYS8 P3 DYF37 DYF3 ins G, T-type DYS6 G-type DYS8 is located on the unique loop of the P3 palindrome DYS7 P2 DYS6 C-type N.N. DYS7 DYF37 DYF01 DYF387 DYS5 DYF385 DYS7 DYF371 C-type DYF08 DYF3 T-type DYS6 C-type DYF3 C-type DYS6 C-type DYS7 8 bp 8 bp N.N. DYF37 DYF01 DYF37 only 2 alleles DYF387 DYS5 DYF385 DYS7 DYF3 only 2 alleles and no.1 allele DYF371 C-type DYF08 DYS7 P1 DYS6 and DYS7 only 2 alleles

22 DYS8 Null DYS8 = Null DYS6 = - DYS5 = - DYS01 = - DYF08 = DYF3 = 21t-c (no.1 allele!) DYF37 = - DYS7 = DYS32 = Loop Constellation! DYS7 DYS6 G-type DYF3 ins G, T-type DYS61 DYS52 DYS85 DYS32 DYS7 DYF37 DYS6 C-type DYS8 DYF37 DYF371 C-type DYF3 DYS6 T-type C-type P1 DYF37 DYF 01 DYF37 Recombination DYF 387 DYS 5 DYF 385 DYS 7 DYF371 DYF DYF3 DYS6 DYS C-type 08 C-type C-type 7

23 DYS8 Null Loop Constellation! DYS7 DYS61 DYS6 G-type DYS8 = Null DYS6 = - DYS5 = - DYS01 = - DYF08 = DYF3 = 21t-c (no.1 allele!) DYF37 = - DYS7 = DYS32 = DYF3 ins G, T-type DYS7 DYF37 DYS6 C-type DYS8 DYS52 DYF37 DYS85 DYS32 DYF371 C-type DYF3 DYS6 T-type C-type P1 DYF37 DYF 01 DYF37 DYF 387 DYS 5 DYF 385 DYS 7 DYF371 DYF DYF3 DYS6 DYS C-type 08 C-type C-type 7

24 DYS38 Null

25 DYS38 Null Yfiler Singleplex

26 DYS38 Null Deletion of the middle fragment in between DYS38I and DYS38B DYS38I DYS38II The nomenclature of DYS38 is defined as DYS38I: [TCTG]q [TCTA]r = GenBank top strand DYS38II: [TCTG]n[TCTA]p[TCTG]q [TCTA]r = GenBank top strand See: The deleted sample matches the first 5 repeats [TCTG] from the related samples in R1b1c. It shows repeats of TCTA which we can align to the left or to the right side. 5 x [TCTG] + x [TCTA] = repeat units

27 DYS38 Null Peak shows up at 16 - But really has repeats!

28 DYS38 Null DYS38 Null a b a 5 b a 6 b c d

29 DYS38 Null DYS38I 28? DYS38II 5??? 3?? Looping constellation Recombination Deletion 5

30 DYS Null

31 DYS Null DYS P8 DYS DYS30 DYF35 DYF371 T-type YCAII DYF35 DYF371 C-type DYF DYS385b* YCAII DYF08 P5 DYF08 P DYF DYS61 DYS = DYF371 T-type allele The T-type SNP can get lost by a recloh DYS385a* This is seen as a NULL-Allele if only DYS is tested DYS52 DYS85 DYS32 DYF37 DYS8 P3 DYF37 DYF3 ins G, T-type DYS6 G-type DYS7 P2 DYS6 C-type DYS7 N.N. DYF37 DYF01 DYF387 DYS5 DYF385 DYS7 DYF371 C-type DYF08 DYF3 T-type DYS6 C-type DYF3 C-type DYS6 C-type DYS7 8 bp 8 bp N.N. DYF37 DYF01 DYF387 DYS5 DYF385 DYS7 DYF371 C-type DYF08 DYS7 P1

32 DYS Null / DYF371X DYS DYS Null

33 DYS Null The HUGO sequence has also a Null allele at DYS c-c-c-c Normally in R1b (and most other haplogroups): c-t-c-c

34 Multi Marker Deletion

35 Multi Marker Deletion Marker DYS33 DYS1 DYS31 DYS37 DYS3 DYS38I DYS38II DYS388 DYS38 DYS30 DYS26 DYS385b DYS385a DYS32 Allele Region ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY ChrY Start Stop Possible P1/P5 deletion in the palindromic region

36 GRC Lab Pics Astrid Krahn (mt hg J)

37 GRC Lab Pics Dr. Connie Bormans (mt hg I)

38 GRC Lab Pics Jory Clark (Y hg T)

39 GRC Lab Pics Brent Maning (Y hg R-U6*)

40 GRC Lab Pics Dr. Arjan Bormans (Y hg R-L2*)

41 GRC Lab Pics...and our other lab coworkers Thanks for listening!

Y Chromosome Markers

Y Chromosome Markers Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet PCR Pre-Lab (pg. 1-3) PCR Pre-Lab Answers (pg. 4-7) RNAi Pre-Lab (pg. 8) RNAi Pre-Lab Answers (pg. 9-10 Gel Electrophoresis Worksheet (pg.

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY

CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY CHAPTER 14 LECTURE NOTES: RECOMBINANT DNA TECHNOLOGY I. General Info A. Landmarks in modern genetics 1. Rediscovery of Mendel s work 2. Chromosomal theory of inheritance 3. DNA as the genetic material

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence

Lecture 10. mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA, or UGA) Terminator S-D Sequence Lecture 10 Analysis of Gene Sequences Anatomy of a bacterial gene: Promoter Coding Sequence (no stop codons) mrna: Transcription Translation Start Translation Stop Transcription Start (AUG) (UAG, UAA,

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Lecture 37: Polymerase Chain Reaction

Lecture 37: Polymerase Chain Reaction Lecture 37: Polymerase Chain Reaction We have already studied basics of DNA/RNA structure and recombinant DNA technology in previous classes. Polymerase Chain Reaction (PCR) is another revolutionary method

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

TECH NOTE Characterization of CRISPR/Cas9 introduced Mutations using the Guide it Indel Identification Kit

TECH NOTE Characterization of CRISPR/Cas9 introduced Mutations using the Guide it Indel Identification Kit TECH NOTE Characterization of CRISPR/Cas9 introduced Mutations using the Guide it Indel Identification Kit Streamlined method for characterizing the variety of indels introduced by genome editing technologies:

More information

Artifacts in Genotyping STRs

Artifacts in Genotyping STRs Biology of STRs Artifacts in Genotyping STRs A number of artifacts are possible: Stuttering Non-template additions Microvariants Three peaks Allele dropouts Mutations All interfere with reading a DNA profile

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents Scientific Working Group on DNA Analysis Methods Validation Guidelines for DNA Analysis Methods Table of Contents Introduction.2 1. Definitions. 2 2. General Considerations 3 3. Developmental Validation..5

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Biological Mathematics: A General DNA Splicing Model. Garret Suen CPSC Wednesday, January 30, 2002

Biological Mathematics: A General DNA Splicing Model. Garret Suen CPSC Wednesday, January 30, 2002 Biological Mathematics: A General DNA Splicing Model Garret Suen CPSC601.73 Wednesday, January 30, 2002 Forward The following is a brief summary of a general DNA splicing model system as outlined by Lila

More information

Auth required. Mod. Y or N

Auth required. Mod. Y or N Appendix E -Genetic Testing CPT/ HCPCS Codes Description Auth required Y or N Mod Service Limits Age Limits Notes 83890 Molecular diagnostics: molecular isolation or extraction, each nucleic acid type

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

DNA Sequencing Troubleshooting Guide

DNA Sequencing Troubleshooting Guide DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry

More information

3/31 Using DNA to Track Your Ancestors

3/31 Using DNA to Track Your Ancestors 1/9/16 11:49 AM 3/31 Using DNA to Track Your Ancestors DNA analysis: General Procedure (slide 1) Amplify sections of the DNA Separate DNA fragments by length and visualize Compare the DNA pattern between

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

The purpose of today s lab is to:

The purpose of today s lab is to: Cancer Gene Detection Instructions The purpose of today s lab is to: gain an understanding of the p53 tumor suppressor gene and its role in familial cancers; analyze p53 mutations from normal and tumor

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Section 12 3 RNA and Protein Synthesis

Section 12 3 RNA and Protein Synthesis Name Class Date Section 12 3 RNA and Protein Synthesis (pages 300 306) Key Concepts What are the three main types of RNA? What is transcription? What is translation? The Structure of RNA (page 300) 1.

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

Biology Performance Level Descriptors

Biology Performance Level Descriptors Limited A student performing at the Limited Level demonstrates a minimal command of Ohio s Learning Standards for Biology. A student at this level has an emerging ability to describe genetic patterns of

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid

Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at:

A great video with lots of visuals of plots and how the fluorescent probes work, reviewing this info, is at: REAL- TIME POLYMERASE CHAIN REACTION: This technology has all but replaced Northern blots for determining gene expression in tissues, cells, and organisms with more accuracy and more quantitative capabilities

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Paul C Winter, Belfast City Hospital, Belfast, UK The polymerase chain reaction is a technique that allows DNA molecules of interest (usually gene sequences) to be copied

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

T C G A A C T G A G G A C T A T. 4) What type of bonds hold the two strands of DNA together? Are they strong or weak bonds?

T C G A A C T G A G G A C T A T. 4) What type of bonds hold the two strands of DNA together? Are they strong or weak bonds? Fo Sci DNA Questions #1 Name Key Use PPT slides 1-11 to answer the following questions. 1) Who are these gentlemen and what did they discover? James Watson and Frances Crick discovered the structure of

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Guideline for the submission of DNA sequences and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003

Guideline for the submission of DNA sequences and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 Guideline for the submission of DNA sequences and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European Reference Laboratory for Genetically Modified

More information

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells DNA CLONING DNA CLONING: amplification of unique DNA molecules In vitro-pcr In vivo-in different host cells POLYMERASE CHAIN REACTION (PCR) PCR THE POLYMERASE CHAIN REACTION (PCR) PROVIDES AN EXTREMELY

More information

Super One-step RT-PCR Kit for Virus Detection

Super One-step RT-PCR Kit for Virus Detection Super One-step RT-PCR Kit for Virus Detection For fast and sensitive one-step RT-PCR with highly specificity www.tiangen.com/en SD121221 Super One-step RT-PCR Kit Kit Contents Contents Cat. no. SD103 SD103

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

SEQUENCING TROUBLESHOOTING

SEQUENCING TROUBLESHOOTING SEQUENCING TROUBLESHOOTING No sequence or very weak sequence Possible explanations: There was no DNA in your tube (or far less DNA than necessary). o Did you quantitate the DNA using a spectrophotometer?

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Technical Bulletin #176. Avoiding DNA Contamination in RT-PCR

Technical Bulletin #176. Avoiding DNA Contamination in RT-PCR 1 of 7 7/12/2007 8:27 PM Shop My Account View Cart nmlkji Products nmlkj Documents Technical Resources > Help Desk > Technical Bulletins Technical Bulletin #176 Avoiding DNA Contamination in RT-PCR A frequent

More information

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems.

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. Cycles of Matter ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. ECO-1.2: I can explain how carbon and nitrogen are stored in ecosystems. ECO-1.3: I can describe

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

Chapter 9 Homework Assignment

Chapter 9 Homework Assignment Chapter 9 Homework Assignment We will not cover the entire chapter. Please use the lecture notes and the Review Sheet for testable material I have decided to alter the homework assignment for Chapter 9.

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

The Power od DNA in Unlocking Family Relationships

The Power od DNA in Unlocking Family Relationships The Power od DNA in Unlocking Family Relationships by Ugo A. Perego, PhD Senior Researcher for Sorenson Molecular Genealogy Foundation (www.smgf.org) Scientific Consultant for GeneTree (www.genetree.com)

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Plasmids are small, double strand, closed circular DNA molecules. Isolated from bacterial cells. Replicate independently

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Genes DNA Replication

Genes DNA Replication Genes DNA Replication Classwork 1. Explain why it is necessary to be able to replicate DNA in order to sustain life. 2. What is the appropriate scientific term used to describe a series of bases that code

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

The Genetic Code There are 20 amino acids, but there are only four nucleotide bases in DNA. How many nucleotides correspond to an amino acid?

The Genetic Code There are 20 amino acids, but there are only four nucleotide bases in DNA. How many nucleotides correspond to an amino acid? CH 17 Transcription & Translation Basic Principles of Transcription & Translation RNA is the bridge between genes and the proteins for which they code. Transcription is the synthesis of RNA under the direction

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

PCR: Polymerase Chain Reaction

PCR: Polymerase Chain Reaction PCR: Polymerase Chain Reaction Basics & Miniaturization Shared Nobel Prize - Chemistry 1993 for his invention of the polymerase chain reaction (PCR) method Outline What is PCR? DNA Background PCR Real

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information