NSilico Life Science Introductory Bioinformatics Course

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "NSilico Life Science Introductory Bioinformatics Course"

Transcription

1 NSilico Life Science Introductory Bioinformatics Course

2 INTRODUCTORY BIOINFORMATICS COURSE A public course delivered over three days on the fundamentals of bioinformatics and illustrated with lectures, hands-on software workshops and case studies on prokaryotes, microbial pathogens, eukaryotes, and infection and cancer studies. This NSilico Life Science certified bioinformatics professional course will allow delegates to rapidly enter this burgeoning field. Audience: Biologists and computer scientists wishing to extend their expertise to the domain of bioinformatics. COURSE OVERVIEW An introduction to bioinformatics and the use of online resources in modern molecular biology and also working with workflows in NSilico s bioinformatics pipeline software called Simplicity and with the statistical programming package R. The student will cover methods for gene sequencing (Illumina nextgeneration and others), reads quality control, adapter trimming and cleaning, assembly, assembly quality assessment, gene prediction, codon and amino acid usage tables, similarity searching with BLAST, Gene Ontology database and GO terms, protein structure and family classification, multiple sequence alignment, phylogenetic analysis for evolutionary relatedness. Simplicity is an easy-to-use, cloud-based high performance system for the automatic annotation, analysis and visualisation of prokaryote genetic data. It is aimed at researchers who lack an in-depth knowledge of bioinformatics and enables the generation of comprehensive reports from raw data with just a few mouse clicks. 2

3 LEARNING OUTCOMES 1. Interpret information from a range of sources and apply strategies for the analysis and management of next generation sequence data. 2. Critically evaluate the strengths and weaknesses of the bioinformatics tools available for genome analysis. 3. Configure bioinformatics tools to aid in the evaluation of hypotheses and explain the significance of the results. 4. Synthesise multiple sequence alignments and highlight the significant features of the alignment using an alignment editor. 5. Design appropriate work flows for annotation of large amounts of sequence data. 6. Design and implement pipelines for gene expression analysis. 7. Demonstrate an ability to interpret complex sequence analysis data and report the findings in publishable format. 3

4 WHY ATTEND THIS COURSE? Bioinformatics is a rapidly moving field with numerous practical applications in different areas of biology, drug discovery, medicine and more. This course seeks to equip the participants with a clear methodology and practical tools and techniques designed to make bioinformatics easy to handle. During the seminar, participants will undertake numerous exercises in small groups giving them the opportunities to apply the theory blocks and reinforce the learning. THIS HIGHLY INTERACTIVE HANDS-ON COURSE REQUIRES USE OF A PERSONAL LAPTOP. COURSE IS HELD IN HOUSE OR IN OUR TRAINING CENTRE WITH SOCIAL EVENTS IN HISTORIC DUBLIN. 4

5 COURSE CONTENT DAY 1 INTRODUCTION TO COMPUTATIONAL BIOLOGY Overview, cell biology, genes, genomes, environment and epigenetics, history of genomics, biology for computer scientists, computer science for biologists, research strategies, algorithms, sequencing technology, file formats, FastQ files, file orientation, encoding type, depth of coverage, paired end, mate pair, unpaired, bioinformatics databases, software tools, online services. Hands on Workshop: Online bioinformatics tools. READS QUALITY CONTROL Sequence data and quality issues, finding how many reads are in the file, percentage GC of the entire dataset, sequence length of the reads, finding the top over-represented sequence, per-base sequence quality, per sequence quality, per base sequence content, per-base GC content, persequence GC content, per-base N content, sequence length distribution, duplicate sequences, over-represented sequences, over-represented k-mers. Hands on Workshop: Reads quality. 5

6 ADAPTER TRIMMING Dealing with contamination, phred quality scores, forward and reverse adapters, handling mismatch error rate (%), quality cut off (%), synchronised paired files. Choosing trimming tools and configuring parameters. Hands on Workshop: Adapter trimming. ASSEMBLING NEXT GENERATION SEQUENCES De novo, mapping to reference genome, De Bruijn graphs, k-mers, contigs, scaffolds, mismatch error correction, coverage, file orientation, unsorted contigs and gaps. Hands on Workshop: De novo assembly. DAY 2 ASSEMBLY ASSESSMENT GC% content, no. of contigs, largest contig length, total length of all contigs, total length of contigs 1000 bp, N50 score, N75 score, L50 score, L75 score, SNPs, INDELs and variant calling. Hands on Workshop: Assembly assessment with cases studies on SNPs and variants. GENE PREDICTION, CODON AND AMINO ACID USAGE Gene finding, open reading frames, exon, codon tables, hidden markov models, interpolated markov model, empirical methods, ab initio methods, codon and amino usage tables, codon frequency, amino acid frequency, organism codon preferences, GC content. Hands on Workshop: Gene predication assessment. 6

7 GENE EXPRESSION AND VISUALISATION Gene expression analysis, representing output, descriptive statistics, charting, gene map, circular map, linear map, heat maps. Hands on Workshop: Visualising genomic data. Basic LOCAL ALIGNMENT SEARCH TOOL (BLAST) BLASTn, BLASTp, BLASTx, tblastn, tblastx, hit, heuristic algorithms, % identity, homologues, infer functional and evolutionary relationships between sequences, BLOSUM/PAM matrixes (proteins), match/ mismatch(dna), gap open, gap extend, e-value, scores, evidence/confidence. Hands on Workshop: Basic local alignment. DAY 3 GENE ONTOLOGIES GC% content, number of contigs, largest contig length, total length of all contigsgo terms, MySQL database, integrated into EBI QuickGo, universal standard terminology for biology, gene product properties, protein domains or structural features, protein-protein interactions, cellular components, molecular functions, biological processes. Hands on Workshop: Gene Ontology. PROTEIN CLASSIFICATION Class, Architecture, Topology, Homology, Protein Data Bank, domains, protein structures are classified using a combination of automated and manual procedures, homologous super families, fold groups, CATH code, similarity search with BLASTp, pattern databases, profile databases, motifs, protein domains and families, hidden Markov model, similarity search with BLASTp. Hands on Workshop: Protein classification with case study in antibiotics resistance and virulence. 7

8 MULTIPLE SEQUENCE ALIGNMENT Pairwise alignment, dot plot, local alignment, global alignment, dynamic programming, progressive alignment, dealign input sequences, Clustal format, PHYLIP format, MSF format, max guide tree iterations, max HMM iterations. Hands on Workshop: Multiple alignment. PHYLOGENETIC ANALYSIS Tree construction, phylogenies, phylogenetic inference, root, node, outgroup, branch length, leaf, progressive alignment, Newick format, orthologous genes, paralogous genes, distance and character based methods, NJ, UPGMA, maximum parsimony, maximum likelihood, bootstrap analysis. Hands on Workshop: Phylogenetic analysis. WRAP UP Final assessment and research project mentoring. Course Director Dr Paul Walsh is chief technology officer at NSilico with over 20 years experience in high performance computing, medical applications and bioinformatics. He has led National and EU Framework projects for major projects in bioinformatics, microbial biomarker detection and cancer genomics. He has an extensive list of publications in both computer science, biology and management. He is a certified project manager and has over 20 years experience in the training sector. 8

9 BOOKING FORM PRICING GROUP DISCOUNTS 1,650 per delegate 6 or more delegates 20% discount 12 or more delegates 25% discount Phone: Web: DELEGATE DETAILS Name: Job title: Tel: Fax: Mob: Name: Job title: Tel: Fax: Mob: COMPANY DETAILS Company: Post code: Address: Country: Tel: Fax: I have read and agreed to the following terms and conditions Signature: 1. Please Invoice my Company Visa Master Card 2. Please change my Credit Card Card Number : CVS/CCV Number: Exp Date : / / Name on card : Signature : 9

10 NSilico Lifescience Ltd. Grange Erin Lodge, Grange Road, Douglas, Cork Ireland +353 (021)

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Public Health Laboratory Workforce Development Bioinformatics

Public Health Laboratory Workforce Development Bioinformatics Public Health Laboratory Workforce Development Bioinformatics Templates for Course Development Contents Overview... 1 Going Beyond the Introductory Courses... 1 Course Templates... 3 Template 1: Introduction

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics

Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics Taj Azarian, MPH Doctoral Student Department of Epidemiology College of Medicine and College

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Sequence Database Searching (Basic Tools and Advanced Methods)

Sequence Database Searching (Basic Tools and Advanced Methods) I519 Introduction to Bioinformatics Sequence Database Searching (Basic Tools and Advanced Methods) Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Basics of DB search BLAST Table of

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Comprehensive Examinations for the Program in Bioinformatics and Computational Biology

Comprehensive Examinations for the Program in Bioinformatics and Computational Biology Comprehensive Examinations for the Program in Bioinformatics and Computational Biology The Comprehensive exams will be given once a year. The format will be six exams. Students must show competency on

More information

Single/Whole Genome Sequencing Dr Caitriona Guinane 11/06/2015

Single/Whole Genome Sequencing Dr Caitriona Guinane 11/06/2015 Single/Whole Genome Sequencing Dr Caitriona Guinane caitriona.guinane@teagasc.ie 11/06/2015 454 platform MiSeq/Illumina technology Growth of Microbial Genome Sequencing Outline 1. Genome Sequencing Terminology

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat

More information

A guided tutorial and Jalview clinic

A guided tutorial and Jalview clinic A guided tutorial and Jalview clinic Jim Procter Barton Group, College of Life Sciences University of Dundee j.procter@dundee.ac.uk FASTA GFF Bioinformatics data is not fun to read.. PDB Newick CSV Alignment

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Tutorial. Getting started with Ensembl Module 1 Introduction

Tutorial. Getting started with Ensembl  Module 1 Introduction Tutorial Getting started with Ensembl www.ensembl.org Ensembl provides genes and other annotation such as regulatory regions, conserved base pairs across species, and mrna protein mappings to the genome.

More information

Exercise 11 - Understanding the Output for a blastn Search (excerpted from a document created by Wilson Leung, Washington University)

Exercise 11 - Understanding the Output for a blastn Search (excerpted from a document created by Wilson Leung, Washington University) Exercise 11 - Understanding the Output for a blastn Search (excerpted from a document created by Wilson Leung, Washington University) Read the following tutorial to better understand the BLAST report for

More information

ABiL. Workforce Development Course Description. A unique bioinformatics resource for the translation of molecular data into

ABiL. Workforce Development Course Description. A unique bioinformatics resource for the translation of molecular data into Workforce Development Course Description ABiL A unique bioinformatics resource for the translation of molecular data into Applied BioInformatics Laboratory actionable public health intelligence ABiL is

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Bayesian Phylogeny and Measures of Branch Support

Bayesian Phylogeny and Measures of Branch Support Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models

Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Megan Bowman Childs Lab Bioinformatics Seminar 22 April 2015 Outline GC content in plant genomes Codon usage

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy II. Pathways of Discovery in Microbiology 1.6 The Historical Roots of Microbiology 1.6 The Historical Roots of Microbiology 1.7 Pasteur and the Defeat of Spontaneous Generation 1.8 Koch, Infectious Disease,

More information

Bioinformatics Summer School Konstantin Okonechnikov Max Planck Institute For Infection Biology

Bioinformatics Summer School Konstantin Okonechnikov Max Planck Institute For Infection Biology Bioinformatics Summer School 2014 Konstantin Okonechnikov Max Planck Institute For Infection Biology Quality Control of High Throughput Sequencing Data Летняя Школа Биоинформатики 2014 If we lived in a

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen

More information

How to Build a Phylogenetic Tree

How to Build a Phylogenetic Tree How to Build a Phylogenetic Tree Phylogenetics tree is a structure in which species are arranged on branches that link them according to their relationship and/or evolutionary descent. A typical rooted

More information

Protein Sequence Analysis - Overview -

Protein Sequence Analysis - Overview - Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein

More information

DNA Sequence Classification in the Presence of Sequencing Errors Project of CSE847

DNA Sequence Classification in the Presence of Sequencing Errors Project of CSE847 DNA Sequence Classification in the Presence of Sequencing Errors Project of CSE847 Yuan Zhang zhangy72@msu.edu Cheng Yuan chengy@msu.edu Computer Science and Engineering Department Michigan State University

More information

Table of Contents. Chapter 1 Read Me First! 1. Chapter 2 Tutorial: Estimate a Tree 11

Table of Contents. Chapter 1 Read Me First! 1. Chapter 2 Tutorial: Estimate a Tree 11 Table of Contents Chapter 1 Read Me First! 1 New and Improved Software 2 Just What Is a Phylogenetic Tree? 3 Estimating Phylogenetic Trees: The Basics 4 Beyond the Basics 5 Learn More about the Principles

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

Genomics for Dummies. Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013

Genomics for Dummies. Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013 Genomics for Dummies Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013 Do I need to know more than just this telephone number? Introduction Try to learn/understand things

More information

This task contains question. Please answer these questions in groups of two persons and make a small report.

This task contains question. Please answer these questions in groups of two persons and make a small report. Tasks Monday January 21st 2006 Goals: - to work with public databases on the internet to find gene and protein information. - To use tools to analyse and compare DNA sequences - To find homologous sequences

More information

Gene Prediction. Jasreet, Jia, Kunal, Ben, Jeff February 4 th 2009

Gene Prediction. Jasreet, Jia, Kunal, Ben, Jeff February 4 th 2009 Gene Prediction Jasreet, Jia, Kunal, Ben, Jeff February 4 th 2009 What are genes? Complete DNA segments responsible to make functional products Products Proteins Functional RNA molecules RNAi (interfering

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Multiple Sequence Alignment

Multiple Sequence Alignment Multiple Sequence Alignment Definition Given N sequences x 1, x 2,, x N : Insert gaps (-) in each sequence x i, such that All sequences have the same length L Score of the global map is maximum Applications

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Activity #5. Mr. Green Genes

Activity #5. Mr. Green Genes Activity #5. Mr. Green Genes a. Hypothesis Development Using Bioinformatics b. Plasmid DNA Isolation & Restriction Enzyme Digestion & Phenotype Confirmation, c. Gel Electrophoresis In this experiment,

More information

Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics

Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics Evolutionary Bioinformatics Short Report Open Access Full open access to this and thousands of other papers at http://www.la-press.com. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary

More information

A Comprehensive metatranscriptomics analysis pipeline and its validation using human small intestine microbiota metatranscriptome

A Comprehensive metatranscriptomics analysis pipeline and its validation using human small intestine microbiota metatranscriptome A Comprehensive metatranscriptomics analysis pipeline and its validation using human small intestine microbiota metatranscriptome NBIC: 3 rd Metagenomics Seminar Utrecht / September 25 th, 2012 Javier

More information

Bioinformatics and its applications

Bioinformatics and its applications Bioinformatics and its applications Alla L Lapidus, Ph.D. SPbAU, SPbSU, St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as

More information

Data analysis of next generation sequencing metagenomics studies - parallel computing approaches in genome assembly algorithms

Data analysis of next generation sequencing metagenomics studies - parallel computing approaches in genome assembly algorithms Data analysis of next generation sequencing metagenomics studies - parallel computing approaches in genome assembly algorithms Milko Krachunov 2, Ivan Popov 1, Peter Petrov 2, Valeria Simeonova 2, Maria

More information

Visualization of Phylogenetic Trees and Metadata

Visualization of Phylogenetic Trees and Metadata Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com

More information

Core Bioinformatics. Titulació Tipus Curs Semestre. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Titulació Tipus Curs Semestre. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Codi: 42397 Crèdits: 12 Titulació Tipus Curs Semestre 4313473 Bioinformàtica/Bioinformatics OB 0 1 Professor de contacte Nom: Sònia Casillas Viladerrams Correu electrònic:

More information

Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician

Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician Next generation sequencing (NGS) Bioinformatics Challenges and strategies Urmi Trivedi Lead Bioinformatician urmi.trivedi@ed.ac.uk Major Bottlenecks Data volume Data complexity Data noise Overview Solutions

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

I. Use BLAST to Find DNA Sequences in Databases (Electronic PCR)

I. Use BLAST to Find DNA Sequences in Databases (Electronic PCR) Using DNA Barcodes to Identify and Classify Living Things: Bioinformatics I. Use BLAST to Find DNA Sequences in Databases (Electronic PCR) 1. Perform a BLAST search as follows: a) Do an Internet search

More information

SOLUTIONS FOR NEXT-GENERATION SEQUENCING

SOLUTIONS FOR NEXT-GENERATION SEQUENCING SOLUTIONS FOR NEXT-GENERATION SEQUENCING GENOMICS CELL BIOLOGY PROTEOMICS AUTOMATION enabling next-generation research From Samples To Publication, Millennium Science Enables Your Next-Gen Sequencing Workflow

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Once sequenced the problem becomes computational Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Next Generation Sequencing data Analysis at Genoscope

Next Generation Sequencing data Analysis at Genoscope Next Generation Sequencing data Analysis at Genoscope Genoscope (National Sequencing center) Among the largest sequencing center in Europe Part of the CEA Institut de Génomique since 05/2007 Provide high-throughput

More information

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Dirk.Repsilber@oru.se 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför

More information

Vector NTI Advance 11.5 Quick Start Guide Catalog no , ,

Vector NTI Advance 11.5 Quick Start Guide Catalog no , , Vector NTI Advance 11.5 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Part no. 12605-022 Revision date: 10 October 2010 MAN0000419 User Manual 2010 Life Technologies Corporation. All rights

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

Bioinformatics: course introduction

Bioinformatics: course introduction Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz

More information

Biology Performance Level Descriptors

Biology Performance Level Descriptors Limited A student performing at the Limited Level demonstrates a minimal command of Ohio s Learning Standards for Biology. A student at this level has an emerging ability to describe genetic patterns of

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Programme Specification MSc in Molecular Genetics

Programme Specification MSc in Molecular Genetics Programme Specification MSc in Molecular Genetics Entry-level Honours degree in Bioscience subject or a science degree with a relevant bioscience component. Overall minimum level 2:2. International applicants

More information

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

Using the RAST prokaryotic genome annotation server

Using the RAST prokaryotic genome annotation server Using the RAST prokaryotic genome annotation server RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic genome. RAST, Rapid Annotations based on Subsystem

More information

T cell Epitope Prediction

T cell Epitope Prediction Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments

More information

FastQC 1. Introduction 1.1 What is FastQC

FastQC 1. Introduction 1.1 What is FastQC FastQC 1. Introduction 1.1 What is FastQC Modern high throughput sequencers can generate tens of millions of sequences in a single run. Before analysing this sequence to draw biological conclusions you

More information

2015-2016 Academic Catalog

2015-2016 Academic Catalog 2015-2016 Academic Catalog Master of Science or Arts in Biology Graduate Arts and Sciences Director: Dr. Karen Snetselaar (on sabbatical 2016) Science Center 225, 610-660-1826, ksnetsel@sju.edu Mission

More information

MANTRA 2.0 TUTORIAL. mantra.tigem.it

MANTRA 2.0 TUTORIAL. mantra.tigem.it MANTRA 2.0 TUTORIAL mantra.tigem.it OUTLINE 1. MANTRA Web Tool 2. Analysis a) New Experiment b) New Node c) GSEA 3. Network a) View b) Button Panel 4. Search 5. In Summary 6. Conclusion OUTLINE 1. MANTRA

More information

Computational localization of promoters and transcription start sites in mammalian genomes

Computational localization of promoters and transcription start sites in mammalian genomes Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute

More information

Next Generation Sequencing. Tobias Österlund

Next Generation Sequencing. Tobias Österlund Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 12/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 25/2 08.00-09.45

More information

Hidden Markov Models in Bioinformatics with Application to Gene Finding in Human DNA Machine Learning Project

Hidden Markov Models in Bioinformatics with Application to Gene Finding in Human DNA Machine Learning Project Hidden Markov Models in Bioinformatics with Application to Gene Finding in Human DNA 308-761 Machine Learning Project Kaleigh Smith January 17, 2002 The goal of this paper is to review the theory of Hidden

More information