How to Use this Practice Exam:

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "How to Use this Practice Exam:"

Transcription

1 How to Use this Practice Exam: I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows. 1. Do NOT answer the questions as a problem set. 2. Study material using your lecture and lab notes and do problem sets FIRST. 3. When you feel you are fairly prepared, put away all of your notes and sit down in a quiet place where you will not be interrupted for at least an hour or two. 4. "Take" the exam without stopping to check notes or the book. 5. At the end of the exam, "grade" your responses. THEN go back and try and figure out the ones you answered incorrectly. Use your notes/book if you need to at this point. 6. If you are still confused, contact an instructor or TA during their office hours or by so that you can get your questions answered. NOTE: This exam may or may not reflect the content of the exam as presented this quarter, nor will it necessarily be the same length (in fact, this one is WAY longer I've added several questions for your practice). Use these questions as a guideline as to the types of questions that may appear on your exams. THEREFORE YOU MAY FIND QUESTIONS ON MATERIAL WE HAVE NOT COVERED, OR THERE MAY BE MATERIAL NOT EXAMINED IN THESE TESTS THAT YOU WILL BE RESPONSIBLE FOR.

2 PRACTICE EXAM 1 *************************************************************************************************** Note: The codon table and the respiration intermediates are printed on the last 2 pages for your reference. 1. Fill in the blanks: All questions refer to the four molecules diagrammed below: a) Molecule A fits best into which category of biological macromolecules? b) B fits best in which category of biological macromolecules? A c) C fits best in which category of biological macromolecules? B d) Which molecule would best be described as a fatty acid? e) Which of these molecules could be a steroid hormone? C f) Which of these molecules has the most energy stored in its bonds that could be used to make ATP? D Multiple true/false CIRCLE ALL THAT ARE CORRECT! 2. Unsaturated oils a) have no double bonds. b) are liquid at room temperature. c) cannot store energy that cells could use to make ATP. d) are more often found in animals than plants. 3. A trna carrying the amino acid Arg (arginine)... a. may bind to the codon 5 ACA 3. b. can have the anticodon 5 GCC 3. c. will bind to the E site of a ribosome. d. can have the anticodon 3 UCC 5.

3 Biology 200, Autumn Answer questions based on this diagram Practice Exam 1 D E a. Which part of the diagram to the right represents the outside of a eukaryotic cell? (Circle one) A B C A b. Which of the molecules in the diagram is in the same category of biological macromolecules as the molecule below? B C (Circle one): D E F F c. Which of the molecules in the diagram is in the same category of biological molecules as the molecule below? (Circle one): D E F d. Molecule D in the diagram pumps chloride against its gradient using the energy stored in a sodium ion concentration gradient. This process is called: e. On the diagram, where would cholesterol molecules most commonly be found? (Circle one) A B C f. Which of the following molecules are permeable through a membrane made purely of molecule E? (Circle ALL that are correct the molecule on the right is one of your choices) H2 O CO2 glucose Na+ CH4

4 5. The following graph shows the results of a student assay testing mandase enzyme activity in the presence of various concentrations of salt. Use these results to answer the questions below. a) At which salt concentration does mandase enzyme work the most effectively? b) At what salt concentration is enzyme activity completely inhibited? c) Which of the following interactions will most likely be affected first by addition of salt? (Circle one) hydrophobic interactions disulfide bonds ionic bonds d) The graph below shows the pathway of the reaction that mandase enzyme catalyzes in the presence of intact enzyme. Draw on the graph a reaction pathway in the absence of intact mandase. G Progress of the reaction -> 6. Fill in the blank. For each, write TWO different answers that fit the description given. (There may be more than 2 answers. Please write only TWO!) a. Catalyst that breaks a bond between i. ii. an amino acid and a trna. b. Anticodon for a trna that gets attached to i. ii. the amino acid His. (include 5 and 3 labels!) c. Something that is transcribed but is not i. ii. translated.

5 7.As you saw in your problem sets, chemotrypsin is an enzyme which catalyzes the hydrolysis of peptide bonds. The first step of the reaction is shown to your right. Use this to answer the following questions. a) Describe briefly how an decrease in ph would affect the enzyme s interaction with substrate (not the enzyme s structure.) enzyme (Answer in 1-2 sentences) b) Adding chemotrypsin speeds up this reaction by changing: (Circle all that apply) substrate ΔG of the reaction E A of the reaction ΔH of the reaction G of the T.S.I. c) Draw a molecule in the space below that could act as a competitive inhibitor of chemotrypsin. d) In what organelle might you find an enzyme that performs a similar function to chemotrypsin? e) Imagine that Gly-193 is changed to Alanine: Describe how you would expect the reaction to change (if at all) and why. (Answer in 1-2 sentences)

6 8. The diagram below shows the translation of the protein phosphofructokinase (PFK), the enzyme that catalyzes step 3 of glycolysis (which occurs in the cytoplasm). This image comes from a eukaryotic cell. A B C E F G H D For a-d CIRCLE the correct answer(s): a. Which molecule has peptide bonds? D E b. Which is the 5 end? A H c. Which end lies at C? N C 5 3 d. Which bound to D FIRST? B G e. Will release factor bind next in site "F"? Yes No You can't tell from figure 9. The DNA below represents the beginning of a protein-coding gene in a bacterial cell AGATACCAAGTTACATCTTCCTGTACGGGAGTAAACTATAAGGC 5 5 TCTATGGTTCAATGTAGAAGGACATGCCCTCATTTGATATTCCG 3 a. What protein binds FIRST to the DNA to initiate transcription? b. Write out the first 6 nucleotides of the RNA strand made from this gene. Be sure to label the 5' and 3' ends of the strand. c. Is the start codon in these first 6 nucleotides? d. What sequence signals that it is the end of the gene?

7 10. In studying a strain of yeast that is very sickly, you find that all of the enzymes in the cell are functioning poorly. a) In your first experiment, you sequence the genes for 7 enzymes involved in lipid metabolism. You find that they all have wild-type sequence. What can you rule out as a cause for this sick yeast? (Circle one) i) mutations in the DNA coding for lipid-metabolizing enzymes ii) mutations in the mrna coding for lipid-metabolizing enzymes iii) mutations in the lipid-metabolizing enzymes primary amino acid sequences b) In your next experiment, you determine the amino acid sequence of each of the 7 proteins. In each one, the only difference you find is that the amino acid aspartic acid is sometimes found in the amino acid sequence when you should have a leucine. You conclude that this is not caused by an error of RNA polymerase during transcription. (RNA polymerase has an error rate of about 1 every 1,000 nucleotides.) How did you come to your conclusion? c) In a final experiment, you find a single mutation in a gene unrelated to lipid metabolism that accounts for the phenotype of this yeast strain. i. What does this gene code for? ii. How has its protein function changed? (Describe in 1-2 sentences) 11. In organisms living on planet Mandoid, all of respiration is the same as on planet Earth except for one part: At every oxidation step of glycolysis, the linking step, and the Krebs cycle, FAD is the molecule that gets reduced. How many molecules ATP per molecule of glucose can a prokaryote living on planet Mandoid make? (Show all work for full credit.)

8 12. On planet Rebus, the following reaction is catalyzed by a single enzyme as shown. Other than this reaction, the rest of respiration occurs just as it does on Earth. X a. What does molecule X have to be to balance this reaction? b. What is the total number of ATP that can be made from a molecule of glucose in a eukaryote on planet Rebus? (Assume there is oxygen on Rebus and that there is an NADH FADH 2 shuttle. Show all work for full credit.) 13. Imagine a eukaryotic cell in which there is a mutation in both copies of the gene for ATP synthase. In this mutant, the ATP synthase is not as efficient, requiring twice as many H+ to pass through to make a single ATP molecule compared to normal, wild type cells. How many ATP can the mutant organism make per glucose molecule? (Normal cells make ~30 ATP/glucose) - ATP from Substrate-level phosphorylation: - ATP from Oxidative phosphorylation:

9 14. Write in the one BEST category that describes each item below, using the letters in the box. a. ribosomal RNA b. glucose c. sigma d. thymidine monophosphate (TMP) e. promoter sequence f. Na+ channel in membrane Category: P = amino acid or protein R = carbohydrate S = lipid T = nucleotide or nucleic acid U = other molecule or structure g. cholesterol h. inorganic phosphate (P i ) i. quinone (Q) in the electron transport chain j. NADH k. release factor l. ATP 15. Read the descriptions listed in the table and choose the appropriate molecule(s) from the list on the right that match (A-F). There is at least one answer for each description and there may be more than one for some. Write ALL correct answers. Not all the choices will necessarily be used. Description a) Enzyme that uses ATP as a substrate b) DNA-binding protein c) Enzyme that has a carbohydrate as a substrate d) Enzyme that catalyzes an exergonic reaction e) Enzyme that spans the plasma membrane of bacterial cells Answer(s) Molecule name A. RNA polymerase B. sigma C. ATP synthase D. β-galactosidase E. enzyme that makes CDP from CMP F. enzyme that catalyzes the first step of glycolysis

10 16. This is the same reaction mechanism as the one you saw in Quiz 2. The complete reaction mechanism is shown. NEW INFORMATION: This enzyme is composed of a single polypeptide and is found in humans. a. If this enzyme were treated with high salt concentrations, which levels of protein structure would be disrupted? (Circle ALL that apply) Asp79 His97 B Asp b. If this enzyme were treated with high salt concentrations, which types of bonds would be disrupted? (Circle ALL that apply) peptide disulfide H-bonds ionic bonds bonds bonds A Asp52 Gly26 c. Which of the following is TRUE? (Circle ALL) A. G of the reactants > G of the products B. E A of the reaction with enzyme > E A without enzyme C. ΔG of the reaction is positive D. G of enzyme at beginning > G of enzyme at end Step 1 d. Which of the following molecules would be the BEST competitive inhibitor of this enzyme? (Circle ONE) e. If Gly26 were changed to the amino acid shown below, would the reaction rate increase, decrease, or stay the same? Give one specific reason using a few words. Step 2 f. Bacteria that live at 100 C in hot springs have an enzyme that carries out the same reaction. How would you expect the enzyme structure to be different?

11 17. Fill in the blanks: a. Where is ATP synthase in a eukaryotic cell? (Be specific!) b. You have 1 gram of glucose, 1 gram of protein, and 1 gram of fat. Which has the most energy that cells can use to make ATP? c.name one way you could change a lipid bilayer to make it less permeable. d. In a membrane protein, what is the characteristic of the R-groups that come in contact with the interior of the phospholipid bilayer? e. Name one molecule that is permeable through a lipid bilayer: 18. On planet Spensoid, organisms primarily use the carbohydrate "erythrose" as an energy source for respiration. Eukaryotic cells on Spensoid have enzymes that carry out the following reactions: 2 HSCoA 2 erythrose 2 H 2 O a. How many pairs of high energy electrons does erythrose have? b. Should any of the reactions in the diagram shown above have NAD+ as a substrate as well? Explain your answer in a few words. c. Starting with one molecule of erythrose, fill in the table below with the number of each molecule produced in a eukaryotic cell on Spensoid. Assume that all Earth enzymes are present and that Spensoid organisms have an NADH-> FADH 2 shuttle. (Respiration diagram shown on p. 1). ATP from substrate level phosphorylation NADH FADH 2 CO 2 Glycolysis Linking Step/ Krebs Cycle

12 19. Consider the following statements in the context of a fully active mitochondrion that is steadily producing ATP. Then mark the blank under True or False for each statement. True False H + concentration is higher in the matrix than outside of the matrix. Movement of H + into the matrix is facilitated diffusion. Movement of H + into the matrix requires energy. Quinone (Q) moves H + out of the matrix using energy from ATP. Oxygen is reduced by gaining electrons from Complex IV. ATP synthase goes through changes in conformation that catalyze ATP synthesis. 20. Below is the sequence of a complete mrna transcribed from a gene in bacteria. 5' GACGGAAGGUAGCGCUAAUGUUUGAGGGUAUAUAGUAUGAACCAGCAA 3' a. Write the protein sequence that is translated from this mrna on the line below, and label the amino (N) and carboxyl (C) ends of the protein. (Codon table is on p. 6) b. Circle all of the sequences below that are present in the mrna above: (Circle ALL that apply) - promoter - ribosome binding site - anticodon - stop codon c. Imagine that you have a bacterial cell in which one of the aa-trna synthetase enzymes is mutated. This aa-trna synthetase normally binds to the trna with a 3'UAG5' anticodon but now ALL COPIES of this enzyme bind to the trna with a 3'GAG5' anticodon instead, even though its amino acid binding site is the same. i. Would the mrna from part "a" be translated differently in a mutant cell? Why or why not? ii. Which of the following statements is TRUE about the mutant cell? (Circle ALL that apply) - There would be more trnas with 3'GAG5' anticodons in the mutant cell than trnas with 3'UAG5' anticodons. - There would be some trnas in the mutant cell that would never become attached to an amino acid. - Proteins in the mutant cell would have all Glu amino acids replaced by Asp - Proteins in the mutant cell would have some Leu amino acids replaced by Ile. - There would be more release factor trnas in the mutant cell.

13 Biology 200, Autumn 2014 Practice Exam 1 FOR YOUR REFERENCE ONLY. NOTHING WILL BE GRADED ON THIS PAGE. Codon Table

14 FOR REFERENCE ONLY: The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs.

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs. 1. An autotroph is an organism that a. extracts energy from organic sources b. converts energy from sunlight into chemical energy c. relies on the energy produced by other organisms as an energy source

More information

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline AP BIOLOGY CHAPTER 7 Cellular Respiration Outline I. How cells get energy. A. Cellular Respiration 1. Cellular respiration includes the various metabolic pathways that break down carbohydrates and other

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Chapter 7 Active Reading Guide Cellular Respiration and Fermentation

Chapter 7 Active Reading Guide Cellular Respiration and Fermentation Name: AP Biology Mr. Croft Chapter 7 Active Reading Guide Cellular Respiration and Fermentation Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

1. The diagram below represents a biological process

1. The diagram below represents a biological process 1. The diagram below represents a biological process 5. The chart below indicates the elements contained in four different molecules and the number of atoms of each element in those molecules. Which set

More information

Carbon Hydrogen Oxygen Nitrogen

Carbon Hydrogen Oxygen Nitrogen Concept 1 - Thinking Practice 1. If the following molecules were to undergo a dehydration synthesis reaction, what molecules would result? Circle the parts of each amino acid that will interact and draw

More information

* Is chemical energy potential or kinetic energy? The position of what is storing energy?

* Is chemical energy potential or kinetic energy? The position of what is storing energy? Biology 1406 Exam 2 - Metabolism Chs. 5, 6 and 7 energy - capacity to do work 5.10 kinetic energy - energy of motion : light, electrical, thermal, mechanical potential energy - energy of position or stored

More information

Anatomy and Physiology Placement Exam 2 Practice with Answers at End!

Anatomy and Physiology Placement Exam 2 Practice with Answers at End! Anatomy and Physiology Placement Exam 2 Practice with Answers at End! General Chemical Principles 1. bonds are characterized by the sharing of electrons between the participating atoms. a. hydrogen b.

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Chapter 7 Cellular Respiration

Chapter 7 Cellular Respiration Phases of aerobic cellular respiration 1. Glycolysis 2. Transition or Acetyl-CoA reaction 3. Krebs cycle 4. Electron transport system Chapter 7 Cellular Respiration These phases are nothing more than metabolic

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water

More information

Carbon-organic Compounds

Carbon-organic Compounds Elements in Cells The living substance of cells is made up of cytoplasm and the structures within it. About 96% of cytoplasm and its included structures are composed of the elements carbon, hydrogen, oxygen,

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Chapter 5. The Structure and Function of Macromolecule s

Chapter 5. The Structure and Function of Macromolecule s Chapter 5 The Structure and Function of Macromolecule s Most Macromolecules are polymers: Polymer: (poly: many; mer: part) Large molecules consisting of many identical or similar subunits connected together.

More information

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose 1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen

More information

CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES

CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman

SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman An Introduction to Metabolism Most biochemical processes occur as biochemical pathways, each individual reaction of which is catalyzed

More information

Biology [SBI 4U] FINAL EXAMINATION

Biology [SBI 4U] FINAL EXAMINATION Biology [SBI 4U] FINAL EXAMINATION Date: November 28, 2012 (Wednesday) Time: 8:30 a.m. 10:30 a.m. Length: 2 hours Lecturer: Ms. Kimberley Gagnon Canadian International Matriculation Programme Student Name:

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

8/20/2012 H C OH H R. Proteins

8/20/2012 H C OH H R. Proteins Proteins Rubisco monomer = amino acids 20 different amino acids polymer = polypeptide protein can be one or more polypeptide chains folded & bonded together large & complex 3-D shape hemoglobin Amino acids

More information

ATP accounting so far ELECTRON TRANSPORT CHAIN & CHEMIOSMOSIS. The Essence of ETC: The Electron Transport Chain O 2

ATP accounting so far ELECTRON TRANSPORT CHAIN & CHEMIOSMOSIS. The Essence of ETC: The Electron Transport Chain O 2 accounting so far The final stage of cellular respiration: ELECTRON TRANSPORT CHAIN & CHEMIOSMOSIS Glycolysis 2 Kreb s cycle 2 Life takes a lot of energy to run, need to extract more energy than 4! There

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

Electron Transport Generates a Proton Gradient Across the Membrane

Electron Transport Generates a Proton Gradient Across the Membrane Electron Transport Generates a Proton Gradient Across the Membrane Each of respiratory enzyme complexes couples the energy released by electron transfer across it to an uptake of protons from water in

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

Metabolism Poster Questions

Metabolism Poster Questions Metabolism Poster Questions Answer the following questions concerning respiration. 1. Consider the mitochondrial electron transport chain. a. How many hydrogen ions can be pumped for every NADH? b. How

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Lecture 6. Regulation of Protein Synthesis at the Translational Level Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Worksheet 13.1. Chapter 13: Human biochemistry glossary

Worksheet 13.1. Chapter 13: Human biochemistry glossary Worksheet 13.1 Chapter 13: Human biochemistry glossary α-helix Refers to a secondary structure of a protein where the chain is twisted to form a regular helix, held by hydrogen bonds between peptide bonds

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

1- Fatty acids are activated to acyl-coas and the acyl group is further transferred to carnitine because:

1- Fatty acids are activated to acyl-coas and the acyl group is further transferred to carnitine because: Section 10 Multiple Choice 1- Fatty acids are activated to acyl-coas and the acyl group is further transferred to carnitine because: A) acyl-carnitines readily cross the mitochondrial inner membrane, but

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Photosynthesis (CO 2 + H 2 O C 6 H 12 O 6 + O 2 )

Photosynthesis (CO 2 + H 2 O C 6 H 12 O 6 + O 2 ) The vital role of A This is the energy-rich compound that is the source of energy for all living things. It is a nucleotide, comprising a 5C sugar (ribose); an organic base (adenosine); and 3 phosphate

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Methods of Grading S/N Style of grading Percentage Score 1 Attendance, class work and assignment 10 2 Test 20 3 Examination 70 Total 100

Methods of Grading S/N Style of grading Percentage Score 1 Attendance, class work and assignment 10 2 Test 20 3 Examination 70 Total 100 COURSE: MIB 303 Microbial Physiology and Metabolism (3 Units- Compulsory) Course Duration: Three hours per week for 15 weeks (45 hours). Lecturer: Jimoh, S.O. B.Sc., M.Sc, Ph.D Microbiology (ABU, Zaria)

More information

PART I: Neurons and the Nerve Impulse

PART I: Neurons and the Nerve Impulse PART I: Neurons and the Nerve Impulse Identify each of the labeled structures of the neuron below. A. B. C. D. E. F. G. Identify each of the labeled structures of the neuron below. A. dendrites B. nucleus

More information

Cellular Respiration

Cellular Respiration Cellular Respiration Cellular Respiration Text, Diagrams, Assessments, and Link to Standards Focus Questions 1) What is cellular respiration? 2) How is cellular respiration connected to breathing? 3) If

More information

Unit I: Introduction To Scientific Processes

Unit I: Introduction To Scientific Processes Unit I: Introduction To Scientific Processes This unit is an introduction to the scientific process. This unit consists of a laboratory exercise where students go through the QPOE2 process step by step

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Lecture 5. 1. Transfer of proper aminoacyl-trna from cytoplasm to A-site of ribosome.

Lecture 5. 1. Transfer of proper aminoacyl-trna from cytoplasm to A-site of ribosome. Elongation & Termination of Protein Synthesis (5.1) Lecture 5 1. INITIATION Assembly of active ribosome by placing the first mrna codon (AUG or START codon) near the P site and pairing it with initiation

More information

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

Syllabus for MCB 3010/5001: Biochemistry Fall Semester 2011

Syllabus for MCB 3010/5001: Biochemistry Fall Semester 2011 Syllabus for MCB 3010/5001: Biochemistry Fall Semester 2011 Instructor: Dr. Wolf-Dieter Reiter Office: TLS 406 Phone: 486-5733 E-mail: wdreiter@uconn.edu Office hours: Wednesday, 11:00 12:00 a.m., Thursday,

More information

AP BIOLOGY 2008 SCORING GUIDELINES

AP BIOLOGY 2008 SCORING GUIDELINES AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.

More information

Exam 4 Outline CH 105 Spring 2012

Exam 4 Outline CH 105 Spring 2012 Exam 4 Outline CH 105 Spring 2012 You need to bring a pencil and your ACT card. Chapter 24: Lipids 1. Describe the properties and types of lipids a. All are hydrophobic b. Fatty acid-based typically contain

More information

A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys

A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys Questions- Proteins & Enzymes A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys Reaction of the intact peptide

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

CHAPTER 30: PROTEIN SYNTHESIS

CHAPTER 30: PROTEIN SYNTHESIS CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino

More information

Review of the Cell and Its Organelles

Review of the Cell and Its Organelles Biology Learning Centre Review of the Cell and Its Organelles Tips for most effective learning of this material: Memorize the names and structures over several days. This will help you retain what you

More information

6023-1 - Page 1. Name: 4) The diagram below represents a beaker containing a solution of various molecules involved in digestion.

6023-1 - Page 1. Name: 4) The diagram below represents a beaker containing a solution of various molecules involved in digestion. Name: 6023-1 - Page 1 1) Which one of the following situations indicates a serious organ system malfunction? A) Mitochondria stop functioning in a unicellular organism exposed to pollutants. B) White blood

More information

Foothill College Winter 2015 Survey of Organic and Biochemistry 30B Sections 01 and 02

Foothill College Winter 2015 Survey of Organic and Biochemistry 30B Sections 01 and 02 Foothill College Winter 2015 Survey of Organic and Biochemistry 30B Sections 01 and 02 Welcome to Chemistry 30B! Office hours: Tuesday and Thursday 10:30-11:45 AM Room 4431 or by appointment Instructor:

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require: A) EF-Tu. B) formylmethionyl

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Evolution of Metabolism. Introduction. Introduction. Introduction. How Cells Harvest Energy. Chapter 7 & 8

Evolution of Metabolism. Introduction. Introduction. Introduction. How Cells Harvest Energy. Chapter 7 & 8 How ells Harvest Energy hapter 7 & 8 Evolution of Metabolism A hypothetical timeline for the evolution of metabolism - all in prokaryotic cells!: 1. ability to store chemical energy in ATP 2. evolution

More information

-1- BIOS 100 - Fall, 2009 Exam I, 18 Sept, 2008 Michael Muller, Instructor

-1- BIOS 100 - Fall, 2009 Exam I, 18 Sept, 2008 Michael Muller, Instructor BIOS 100 - Fall, 2009 Exam I, 18 Sept, 2008 Michael Muller, Instructor Name: TA: This exam consists of 42 questions over 7 pages (the last page of which has the periodic table and Bloom s hierarchy). Please

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

Bio 101 Section 001: Practice Questions for First Exam

Bio 101 Section 001: Practice Questions for First Exam Do the Practice Exam under exam conditions. Time yourself! MULTIPLE CHOICE: 1. The substrate fits in the of an enzyme: (A) allosteric site (B) active site (C) reaction groove (D) Golgi body (E) inhibitor

More information

Introduction to the Cell: Plant and Animal Cells

Introduction to the Cell: Plant and Animal Cells Introduction to the Cell: Plant and Animal Cells Tissues, Organs, and Systems of Living Things Cells, Cell Division, and Animal Systems and Plant Systems Cell Specialization Human Systems All organisms

More information

Lab 2 Biochemistry. Learning Objectives. Introduction. Lipid Structure and Role in Food. The lab has the following learning objectives.

Lab 2 Biochemistry. Learning Objectives. Introduction. Lipid Structure and Role in Food. The lab has the following learning objectives. 1 Lab 2 Biochemistry Learning Objectives The lab has the following learning objectives. Investigate the role of double bonding in fatty acids, through models. Developing a calibration curve for a Benedict

More information

Chapter 20: Antimicrobial Drugs

Chapter 20: Antimicrobial Drugs Chapter 20: Antimicrobial Drugs 1. Overview of Antimicrobial Drugs 2. Antibacterial Drugs 3. Antiviral Drugs 4. Drugs for Eukaryotic Pathogens 1. Overview of Antimicrobial Drugs Antibiotics An antibiotic

More information

Lecture 4. Polypeptide Synthesis Overview

Lecture 4. Polypeptide Synthesis Overview Initiation of Protein Synthesis (4.1) Lecture 4 Polypeptide Synthesis Overview Polypeptide synthesis proceeds sequentially from N Terminus to C terminus. Amino acids are not pre-positioned on a template.

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

The Practice of Peptide Synthesis

The Practice of Peptide Synthesis The Practice of Peptide Synthesis Download: The Practice of Peptide Synthesis PDF ebook The Practice of Peptide Synthesis PDF - Are you searching for The Practice of Peptide Synthesis Books? Now, you will

More information

Investigating cells. Cells are the basic units of living things (this means that all living things are made up of one or more cells).

Investigating cells. Cells are the basic units of living things (this means that all living things are made up of one or more cells). SG Biology Summary notes Investigating cells Sub-topic a: Investigating living cells Cells are the basic units of living things (this means that all living things are made up of one or more cells). Cells

More information

Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein

Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein ranslation (written lesson) Q: How are proteins (amino acid chains) made from the information in mrn? : ranslation Ribosomes translate mrn into protein ranslation has 3 steps also! 1. ranslation Initiation:

More information

http://faculty.sau.edu.sa/h.alshehri

http://faculty.sau.edu.sa/h.alshehri http://faculty.sau.edu.sa/h.alshehri Definition: Proteins are macromolecules with a backbone formed by polymerization of amino acids. Proteins carry out a number of functions in living organisms: - They

More information

Digestive System Lecture 5 Winter 2014

Digestive System Lecture 5 Winter 2014 Digestive System Lecture 5 Winter 2014 This lecture tells the story of the Flow of Matter from Food to Cells. The pictures are only there to help you visualize structures don t worry about names of structures

More information

pathway that involves taking in heat from the environment at each step. C.

pathway that involves taking in heat from the environment at each step. C. Study Island Cell Energy Keystone Review 1. Cells obtain energy by either capturing light energy through photosynthesis or by breaking down carbohydrates through cellular respiration. In both photosynthesis

More information

Gene Transcription in Prokaryotes

Gene Transcription in Prokaryotes Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.

More information

Chapter 7: Membrane Structure and Function

Chapter 7: Membrane Structure and Function Name Period Concept 7.1 Cellular membranes are fluid mosaics of lipids and proteins 1. The large molecules of all living things fall into just four main classes. Name them. 2. Explain what is meant when

More information

Photosynthesis and Cellular Respiration. Stored Energy

Photosynthesis and Cellular Respiration. Stored Energy Photosynthesis and Cellular Respiration Stored Energy What is Photosynthesis? plants convert the energy of sunlight into the energy in the chemical bonds of carbohydrates sugars and starches. SUMMARY EQUATION:

More information

Cell and Membrane Practice. A. chromosome B. gene C. mitochondrion D. vacuole

Cell and Membrane Practice. A. chromosome B. gene C. mitochondrion D. vacuole Name: ate: 1. Which structure is outside the nucleus of a cell and contains N?. chromosome. gene. mitochondrion. vacuole 2. potato core was placed in a beaker of water as shown in the figure below. Which

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d) Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Cell Structure & Function!

Cell Structure & Function! Cell Structure & Function! Chapter 3! The most exciting phrase to hear in science, the one that heralds new discoveries, is not 'Eureka!' but 'That's funny.! -- Isaac Asimov Animal Cell Plant Cell Cell

More information

Gene Switches Teacher Information

Gene Switches Teacher Information STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277

Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277 Lab Next Week Announcements Help Session: Monday 6pm LSS 277 Office Hours Chapter 15 and Translation Proteins: Function Proteins: Function Enzymes Transport Structural Components Regulation Communication

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information