How to Use this Practice Exam:

Size: px
Start display at page:

Download "How to Use this Practice Exam:"

Transcription

1 How to Use this Practice Exam: I post practice exams to allow you to get a real sense of the experience of taking a Biology 200 exam. The best way to use each exam is as follows. 1. Do NOT answer the questions as a problem set. 2. Study material using your lecture and lab notes and do problem sets FIRST. 3. When you feel you are fairly prepared, put away all of your notes and sit down in a quiet place where you will not be interrupted for at least an hour or two. 4. "Take" the exam without stopping to check notes or the book. 5. At the end of the exam, "grade" your responses. THEN go back and try and figure out the ones you answered incorrectly. Use your notes/book if you need to at this point. 6. If you are still confused, contact an instructor or TA during their office hours or by so that you can get your questions answered. NOTE: This exam may or may not reflect the content of the exam as presented this quarter, nor will it necessarily be the same length (in fact, this one is WAY longer I've added several questions for your practice). Use these questions as a guideline as to the types of questions that may appear on your exams. THEREFORE YOU MAY FIND QUESTIONS ON MATERIAL WE HAVE NOT COVERED, OR THERE MAY BE MATERIAL NOT EXAMINED IN THESE TESTS THAT YOU WILL BE RESPONSIBLE FOR.

2 PRACTICE EXAM 1 *************************************************************************************************** Note: The codon table and the respiration intermediates are printed on the last 2 pages for your reference. 1. Fill in the blanks: All questions refer to the four molecules diagrammed below: a) Molecule A fits best into which category of biological macromolecules? b) B fits best in which category of biological macromolecules? A c) C fits best in which category of biological macromolecules? B d) Which molecule would best be described as a fatty acid? e) Which of these molecules could be a steroid hormone? C f) Which of these molecules has the most energy stored in its bonds that could be used to make ATP? D Multiple true/false CIRCLE ALL THAT ARE CORRECT! 2. Unsaturated oils a) have no double bonds. b) are liquid at room temperature. c) cannot store energy that cells could use to make ATP. d) are more often found in animals than plants. 3. A trna carrying the amino acid Arg (arginine)... a. may bind to the codon 5 ACA 3. b. can have the anticodon 5 GCC 3. c. will bind to the E site of a ribosome. d. can have the anticodon 3 UCC 5.

3 Biology 200, Autumn Answer questions based on this diagram Practice Exam 1 D E a. Which part of the diagram to the right represents the outside of a eukaryotic cell? (Circle one) A B C A b. Which of the molecules in the diagram is in the same category of biological macromolecules as the molecule below? B C (Circle one): D E F F c. Which of the molecules in the diagram is in the same category of biological molecules as the molecule below? (Circle one): D E F d. Molecule D in the diagram pumps chloride against its gradient using the energy stored in a sodium ion concentration gradient. This process is called: e. On the diagram, where would cholesterol molecules most commonly be found? (Circle one) A B C f. Which of the following molecules are permeable through a membrane made purely of molecule E? (Circle ALL that are correct the molecule on the right is one of your choices) H2 O CO2 glucose Na+ CH4

4 5. The following graph shows the results of a student assay testing mandase enzyme activity in the presence of various concentrations of salt. Use these results to answer the questions below. a) At which salt concentration does mandase enzyme work the most effectively? b) At what salt concentration is enzyme activity completely inhibited? c) Which of the following interactions will most likely be affected first by addition of salt? (Circle one) hydrophobic interactions disulfide bonds ionic bonds d) The graph below shows the pathway of the reaction that mandase enzyme catalyzes in the presence of intact enzyme. Draw on the graph a reaction pathway in the absence of intact mandase. G Progress of the reaction -> 6. Fill in the blank. For each, write TWO different answers that fit the description given. (There may be more than 2 answers. Please write only TWO!) a. Catalyst that breaks a bond between i. ii. an amino acid and a trna. b. Anticodon for a trna that gets attached to i. ii. the amino acid His. (include 5 and 3 labels!) c. Something that is transcribed but is not i. ii. translated.

5 7.As you saw in your problem sets, chemotrypsin is an enzyme which catalyzes the hydrolysis of peptide bonds. The first step of the reaction is shown to your right. Use this to answer the following questions. a) Describe briefly how an decrease in ph would affect the enzyme s interaction with substrate (not the enzyme s structure.) enzyme (Answer in 1-2 sentences) b) Adding chemotrypsin speeds up this reaction by changing: (Circle all that apply) substrate ΔG of the reaction E A of the reaction ΔH of the reaction G of the T.S.I. c) Draw a molecule in the space below that could act as a competitive inhibitor of chemotrypsin. d) In what organelle might you find an enzyme that performs a similar function to chemotrypsin? e) Imagine that Gly-193 is changed to Alanine: Describe how you would expect the reaction to change (if at all) and why. (Answer in 1-2 sentences)

6 8. The diagram below shows the translation of the protein phosphofructokinase (PFK), the enzyme that catalyzes step 3 of glycolysis (which occurs in the cytoplasm). This image comes from a eukaryotic cell. A B C E F G H D For a-d CIRCLE the correct answer(s): a. Which molecule has peptide bonds? D E b. Which is the 5 end? A H c. Which end lies at C? N C 5 3 d. Which bound to D FIRST? B G e. Will release factor bind next in site "F"? Yes No You can't tell from figure 9. The DNA below represents the beginning of a protein-coding gene in a bacterial cell AGATACCAAGTTACATCTTCCTGTACGGGAGTAAACTATAAGGC 5 5 TCTATGGTTCAATGTAGAAGGACATGCCCTCATTTGATATTCCG 3 a. What protein binds FIRST to the DNA to initiate transcription? b. Write out the first 6 nucleotides of the RNA strand made from this gene. Be sure to label the 5' and 3' ends of the strand. c. Is the start codon in these first 6 nucleotides? d. What sequence signals that it is the end of the gene?

7 10. In studying a strain of yeast that is very sickly, you find that all of the enzymes in the cell are functioning poorly. a) In your first experiment, you sequence the genes for 7 enzymes involved in lipid metabolism. You find that they all have wild-type sequence. What can you rule out as a cause for this sick yeast? (Circle one) i) mutations in the DNA coding for lipid-metabolizing enzymes ii) mutations in the mrna coding for lipid-metabolizing enzymes iii) mutations in the lipid-metabolizing enzymes primary amino acid sequences b) In your next experiment, you determine the amino acid sequence of each of the 7 proteins. In each one, the only difference you find is that the amino acid aspartic acid is sometimes found in the amino acid sequence when you should have a leucine. You conclude that this is not caused by an error of RNA polymerase during transcription. (RNA polymerase has an error rate of about 1 every 1,000 nucleotides.) How did you come to your conclusion? c) In a final experiment, you find a single mutation in a gene unrelated to lipid metabolism that accounts for the phenotype of this yeast strain. i. What does this gene code for? ii. How has its protein function changed? (Describe in 1-2 sentences) 11. In organisms living on planet Mandoid, all of respiration is the same as on planet Earth except for one part: At every oxidation step of glycolysis, the linking step, and the Krebs cycle, FAD is the molecule that gets reduced. How many molecules ATP per molecule of glucose can a prokaryote living on planet Mandoid make? (Show all work for full credit.)

8 12. On planet Rebus, the following reaction is catalyzed by a single enzyme as shown. Other than this reaction, the rest of respiration occurs just as it does on Earth. X a. What does molecule X have to be to balance this reaction? b. What is the total number of ATP that can be made from a molecule of glucose in a eukaryote on planet Rebus? (Assume there is oxygen on Rebus and that there is an NADH FADH 2 shuttle. Show all work for full credit.) 13. Imagine a eukaryotic cell in which there is a mutation in both copies of the gene for ATP synthase. In this mutant, the ATP synthase is not as efficient, requiring twice as many H+ to pass through to make a single ATP molecule compared to normal, wild type cells. How many ATP can the mutant organism make per glucose molecule? (Normal cells make ~30 ATP/glucose) - ATP from Substrate-level phosphorylation: - ATP from Oxidative phosphorylation:

9 14. Write in the one BEST category that describes each item below, using the letters in the box. a. ribosomal RNA b. glucose c. sigma d. thymidine monophosphate (TMP) e. promoter sequence f. Na+ channel in membrane Category: P = amino acid or protein R = carbohydrate S = lipid T = nucleotide or nucleic acid U = other molecule or structure g. cholesterol h. inorganic phosphate (P i ) i. quinone (Q) in the electron transport chain j. NADH k. release factor l. ATP 15. Read the descriptions listed in the table and choose the appropriate molecule(s) from the list on the right that match (A-F). There is at least one answer for each description and there may be more than one for some. Write ALL correct answers. Not all the choices will necessarily be used. Description a) Enzyme that uses ATP as a substrate b) DNA-binding protein c) Enzyme that has a carbohydrate as a substrate d) Enzyme that catalyzes an exergonic reaction e) Enzyme that spans the plasma membrane of bacterial cells Answer(s) Molecule name A. RNA polymerase B. sigma C. ATP synthase D. β-galactosidase E. enzyme that makes CDP from CMP F. enzyme that catalyzes the first step of glycolysis

10 16. This is the same reaction mechanism as the one you saw in Quiz 2. The complete reaction mechanism is shown. NEW INFORMATION: This enzyme is composed of a single polypeptide and is found in humans. a. If this enzyme were treated with high salt concentrations, which levels of protein structure would be disrupted? (Circle ALL that apply) Asp79 His97 B Asp b. If this enzyme were treated with high salt concentrations, which types of bonds would be disrupted? (Circle ALL that apply) peptide disulfide H-bonds ionic bonds bonds bonds A Asp52 Gly26 c. Which of the following is TRUE? (Circle ALL) A. G of the reactants > G of the products B. E A of the reaction with enzyme > E A without enzyme C. ΔG of the reaction is positive D. G of enzyme at beginning > G of enzyme at end Step 1 d. Which of the following molecules would be the BEST competitive inhibitor of this enzyme? (Circle ONE) e. If Gly26 were changed to the amino acid shown below, would the reaction rate increase, decrease, or stay the same? Give one specific reason using a few words. Step 2 f. Bacteria that live at 100 C in hot springs have an enzyme that carries out the same reaction. How would you expect the enzyme structure to be different?

11 17. Fill in the blanks: a. Where is ATP synthase in a eukaryotic cell? (Be specific!) b. You have 1 gram of glucose, 1 gram of protein, and 1 gram of fat. Which has the most energy that cells can use to make ATP? c.name one way you could change a lipid bilayer to make it less permeable. d. In a membrane protein, what is the characteristic of the R-groups that come in contact with the interior of the phospholipid bilayer? e. Name one molecule that is permeable through a lipid bilayer: 18. On planet Spensoid, organisms primarily use the carbohydrate "erythrose" as an energy source for respiration. Eukaryotic cells on Spensoid have enzymes that carry out the following reactions: 2 HSCoA 2 erythrose 2 H 2 O a. How many pairs of high energy electrons does erythrose have? b. Should any of the reactions in the diagram shown above have NAD+ as a substrate as well? Explain your answer in a few words. c. Starting with one molecule of erythrose, fill in the table below with the number of each molecule produced in a eukaryotic cell on Spensoid. Assume that all Earth enzymes are present and that Spensoid organisms have an NADH-> FADH 2 shuttle. (Respiration diagram shown on p. 1). ATP from substrate level phosphorylation NADH FADH 2 CO 2 Glycolysis Linking Step/ Krebs Cycle

12 19. Consider the following statements in the context of a fully active mitochondrion that is steadily producing ATP. Then mark the blank under True or False for each statement. True False H + concentration is higher in the matrix than outside of the matrix. Movement of H + into the matrix is facilitated diffusion. Movement of H + into the matrix requires energy. Quinone (Q) moves H + out of the matrix using energy from ATP. Oxygen is reduced by gaining electrons from Complex IV. ATP synthase goes through changes in conformation that catalyze ATP synthesis. 20. Below is the sequence of a complete mrna transcribed from a gene in bacteria. 5' GACGGAAGGUAGCGCUAAUGUUUGAGGGUAUAUAGUAUGAACCAGCAA 3' a. Write the protein sequence that is translated from this mrna on the line below, and label the amino (N) and carboxyl (C) ends of the protein. (Codon table is on p. 6) b. Circle all of the sequences below that are present in the mrna above: (Circle ALL that apply) - promoter - ribosome binding site - anticodon - stop codon c. Imagine that you have a bacterial cell in which one of the aa-trna synthetase enzymes is mutated. This aa-trna synthetase normally binds to the trna with a 3'UAG5' anticodon but now ALL COPIES of this enzyme bind to the trna with a 3'GAG5' anticodon instead, even though its amino acid binding site is the same. i. Would the mrna from part "a" be translated differently in a mutant cell? Why or why not? ii. Which of the following statements is TRUE about the mutant cell? (Circle ALL that apply) - There would be more trnas with 3'GAG5' anticodons in the mutant cell than trnas with 3'UAG5' anticodons. - There would be some trnas in the mutant cell that would never become attached to an amino acid. - Proteins in the mutant cell would have all Glu amino acids replaced by Asp - Proteins in the mutant cell would have some Leu amino acids replaced by Ile. - There would be more release factor trnas in the mutant cell.

13 Biology 200, Autumn 2014 Practice Exam 1 FOR YOUR REFERENCE ONLY. NOTHING WILL BE GRADED ON THIS PAGE. Codon Table

14 FOR REFERENCE ONLY: The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule

Ch 4: Cellular Metabolism - Part 2

Ch 4: Cellular Metabolism - Part 2 Ch 4: Cellular Metabolism - Part 2 Energy as it relates to Biology Enzymes Metabolism Catabolism (ATP production) Glycolysis and the TCA Cycle Anabolism (Synthetic pathways) Protein Synthesis Developed

More information

Oxidative Phosphorylation

Oxidative Phosphorylation Why? Oxidative Phosphorylation How are the electrons in NADH and FADH 2 used to make ATP during cellular respiration? The final phase of cellular respiration is oxidative phosphorylation. Both the electron

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The ʺone gene-one polypeptideʺ theory states that A) the synthesis of each enzyme is catalyzed

More information

Incoming Human Anatomy & Physiology I (Biol 2401) Student Knowledge Expectations for Basic Chemistry and Cell Biology Effective Fall 2015

Incoming Human Anatomy & Physiology I (Biol 2401) Student Knowledge Expectations for Basic Chemistry and Cell Biology Effective Fall 2015 Incoming Human Anatomy & Physiology I (Biol 2401) Student Knowledge Expectations for Basic Chemistry and Cell Biology Effective Fall 2015 Prior to enrolling in Human Anatomy & Physiology I (Biol 2401),

More information

Ch 4: Energy and Cellular Metabolism

Ch 4: Energy and Cellular Metabolism Ch 4: Energy and Cellular Metabolism Energy as it relates to Biology Chemical reactions Enzymes and how they speed rxs Metabolism and metabolic pathways Catabolism (ATP production) Anabolism (Synthesis

More information

Introductory Molecular and Cell Biology Assessment (IMCA)

Introductory Molecular and Cell Biology Assessment (IMCA) Introductory Molecular and Cell Biology Assessment (IMCA) J. Shi, W. B. Wood, J. M. Martin, N. A. Guild, Q. Vincens and J. K. Knight To prolong the utility of this assessment we ask that it not be given

More information

Respiration. Respiration. Respiration. How Cells Harvest Energy. Chapter 7

Respiration. Respiration. Respiration. How Cells Harvest Energy. Chapter 7 How Cells Harvest Energy Chapter 7 Organisms can be classified based on how they obtain energy: autotrophs: are able to produce their own organic molecules through photosynthesis heterotrophs: live on

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

IB BIOLOGY: Respiration Notes. Draw and annotate a molecule of ATP to show how it stores and releases energy.

IB BIOLOGY: Respiration Notes. Draw and annotate a molecule of ATP to show how it stores and releases energy. IB BIOLOGY: Respiration Notes Draw and annotate a molecule of ATP to show how it stores and releases energy. Contrast oxidation and reduction from the perspectives of (a) the gain or loss of electrons

More information

Figure During transcription, RNA nucleotides base-pair one by one with DNA

Figure During transcription, RNA nucleotides base-pair one by one with DNA Objectives Describe the process of DNA transcription. Explain how an RNA message is edited. Describe how RNA is translated to a protein. Summarize protein synthesis. Key Terms messenger RNA (mrna) RNA

More information

Section 12 3 RNA and Protein Synthesis

Section 12 3 RNA and Protein Synthesis Name Class Date Section 12 3 RNA and Protein Synthesis (pages 300 306) Key Concepts What are the three main types of RNA? What is transcription? What is translation? The Structure of RNA (page 300) 1.

More information

Biology. Practice Questions

Biology. Practice Questions Biology Practice Questions Instructions Individual, exam-style questions The questions contained in this booklet match the style of questions that are typically asked in exams. This booklet is not however,

More information

Chapter 9 Study Guide. 2. What is the difference between fermentation and cell respiration? (2 pts)

Chapter 9 Study Guide. 2. What is the difference between fermentation and cell respiration? (2 pts) Chapter 9 Study Guide Name 1. Fill in this summary for cellular respiration: (3 pts) + 6 O 2 + 6 H 2 O + 2. What is the difference between fermentation and cell respiration? (2 pts) 3. What do we call

More information

Slide 1 of 39. End Show Copyright Pearson Prentice Hall. Slide 3 of 39. End Show Copyright Pearson Prentice Hall. Slide 5 of 39

Slide 1 of 39. End Show Copyright Pearson Prentice Hall. Slide 3 of 39. End Show Copyright Pearson Prentice Hall. Slide 5 of 39 12-3 RNA and Protein Synthesis Essential Question What is transcription and translation and how do they take place? 1 of 39 2 of 39 12 3 RNA and Protein Synthesis The Structure of RNA Genes are coded DNA

More information

Mitochondrial Structure and Aerobic Respiration. Biology Exploring Life section 7.5 Modern Biology section 7-2

Mitochondrial Structure and Aerobic Respiration. Biology Exploring Life section 7.5 Modern Biology section 7-2 Mitochondrial Structure and Aerobic Respiration Biology Exploring Life section 7.5 Modern Biology section 7-2 Mitochondrial Structure and Aerobic Respiration Objectives: Diagram and explain the function

More information

1. The diagram below shows the synthesis of a polynucleotide by the formation of a phosphodiester bond.

1. The diagram below shows the synthesis of a polynucleotide by the formation of a phosphodiester bond. 1. The diagram below shows the synthesis of a polynucleotide by the formation of a phosphodiester bond. Which statement best describes how the nucleotides are joined to form the polynucleotide? (A) The

More information

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular

More information

Assessment Schedule 2015 Biology: Demonstrate understanding of gene expression (91159)

Assessment Schedule 2015 Biology: Demonstrate understanding of gene expression (91159) NCEA Level 2 Biology (91159) 2015 page 1 of 5 Assessment Schedule 2015 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Demonstrate understanding involves

More information

Bio F/10 Practice Exam 2

Bio F/10 Practice Exam 2 Here is a set of practice questions for Exam #2. The exam will cover lecture sets 5-9 (material from text chapters 4, 5, 7, 8, 11, 12). 1. Which of the following is not found in a prokaryotic cell? a.

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

E. coli RNA Polymerase Sequences of E. coli Promoters. Promoter sequences from 10 bacteriophage and bacterial genes

E. coli RNA Polymerase Sequences of E. coli Promoters. Promoter sequences from 10 bacteriophage and bacterial genes E. coli RNA Polymerase Sequences of E. coli Promoters Promoter sequences from 10 bacteriophage and bacterial genes Transcription by E. coli RNA Polymerase Transcription by E. coli RNA Polymerase Transcription

More information

Solutions for Biochemistry Unit Exam

Solutions for Biochemistry Unit Exam Solutions for Biochemistry Unit Exam Question 1 a) An example of a structural representation is shown in the adjacent box. Draw a structural representation of the amino acid, Aspartic acid, which has the

More information

Which statement best describes the movement of ions shown in the diagram? where they create a highly reducing environment and hydrolyze CO 2

Which statement best describes the movement of ions shown in the diagram? where they create a highly reducing environment and hydrolyze CO 2 1. The electron transport chain is a part of cellular respiration. The diagram below shows the movement of ions in the electron transport chain within a mitochondrion. Which statement best describes the

More information

Keystone Study Guide Module A: Cells and Cell Processes

Keystone Study Guide Module A: Cells and Cell Processes Keystone Study Guide Module A: Cells and Cell Processes Topic 1: Biological Principles Cells and the Organization of Life Characteristics of Life all living things share the following characteristics:

More information

Biology Test #3. Name: Class: Date: Multiple Choice Identify the letter of the choice that best completes the statement or answers the question.

Biology Test #3. Name: Class: Date: Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. Name: Class: Date: ID: A Biology Test #3 Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Energy is required for a variety of life processes

More information

Cellular Respiration: Harvesting Chemical Energy. Chapter 9

Cellular Respiration: Harvesting Chemical Energy. Chapter 9 Cellular Respiration: Harvesting Chemical Energy Chapter 9 Life Is Work Living cells require energy from outside sources Plants E from? Animals E from? Light energy Energy flows into ecosystem as light

More information

Chapter 6: CELLULAR RESPIRATION

Chapter 6: CELLULAR RESPIRATION Chapter 6: CELLULAR RESPIRATION 1. Overview of Respiration 2. Glycolysis 3. The Citric Acid Cycle 4. Oxidative Phosphorylation 1. Overview of Respiration What is Cellular Respiration? It is the process

More information

Keystone Review. Module A

Keystone Review. Module A Keystone Review Module A BIO.A.1.1 Explain the characteristics common to all organisms. Describe the characteristics of life shared by all prokaryotic and eukaryotic organisms. Which characteristic is

More information

Biology: Science for Life with Physiology, 5e (Belk) Chapter 2 Science Fiction, Bad Science, and Pseudoscience: Water, Biochemistry, and Cells

Biology: Science for Life with Physiology, 5e (Belk) Chapter 2 Science Fiction, Bad Science, and Pseudoscience: Water, Biochemistry, and Cells Biology: Science for Life with Physiology, 5e (Belk) Chapter 2 Science Fiction, Bad Science, and Pseudoscience: Water, Biochemistry, and Cells 1) Which feature is present in all known living things? A)

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Making Protein from DNA in E. coli The Organism Main organism used in synthetic biology Alternates include yeast Easy to work with reproduces fast Easily accepts and expresses new

More information

Why is Patrick Paralyzed?

Why is Patrick Paralyzed? Why is Patrick Paralyzed? 1 Why did Patrick lose his ability to move? Patrick at 2: Patrick at 21: Movie in QuickTime (mov) 2 Patrick s History When Patrick was 16 years old, his hand started twitching

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Name Advanced Biology Enzyme and Cellular Respiration Test Part I Multiple Choice (75 points) MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The

More information

Chapter 6: CELLULAR RESPIRATION

Chapter 6: CELLULAR RESPIRATION Chapter 6: CELLULAR RESPIRATION 1. Overview of Respiration 2. Glycolysis 3. The Citric Acid Cycle 4. Oxidative Phosphorylation 1. Overview of Respiration What is Cellular Respiration? It is the process

More information

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline

AP BIOLOGY CHAPTER 7 Cellular Respiration Outline AP BIOLOGY CHAPTER 7 Cellular Respiration Outline I. How cells get energy. A. Cellular Respiration 1. Cellular respiration includes the various metabolic pathways that break down carbohydrates and other

More information

Todays Outline. Metabolism. Why do cells need energy? How do cells acquire energy? Metabolism. Concepts & Processes. The cells capacity to:

Todays Outline. Metabolism. Why do cells need energy? How do cells acquire energy? Metabolism. Concepts & Processes. The cells capacity to: and Work Metabolic Pathways Enzymes Features Factors Affecting Enzyme Activity Membrane Transport Diffusion Osmosis Passive Transport Active Transport Bulk Transport Todays Outline -Releasing Pathways

More information

Name 6 How Cells Harvest Chemical Energy Test Date Study Guide You must know: The difference between fermentation and cellular respiration.

Name 6 How Cells Harvest Chemical Energy Test Date Study Guide You must know: The difference between fermentation and cellular respiration. Name 6 How Cells Harvest Chemical Energy Test Date Study Guide You must know: The difference between fermentation and cellular respiration. The role of glycolysis in oxidizing glucose to two molecules

More information

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs.

The correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs. 1. An autotroph is an organism that a. extracts energy from organic sources b. converts energy from sunlight into chemical energy c. relies on the energy produced by other organisms as an energy source

More information

2.3 Carbon-Based Molecules. KEY CONCEPT Carbon-based molecules are the foundation of life.

2.3 Carbon-Based Molecules. KEY CONCEPT Carbon-based molecules are the foundation of life. KEY CONCEPT Carbon-based molecules are the foundation of life. Carbon atoms have unique bonding properties. Carbon forms covalent bonds with up to four other atoms Carbon-based molecules have three general

More information

What affects an enzyme s activity? General environmental factors, such as temperature and ph. Chemicals that specifically influence the enzyme.

What affects an enzyme s activity? General environmental factors, such as temperature and ph. Chemicals that specifically influence the enzyme. CH s 8-9 Respiration & Metabolism Metabolism A catalyst is a chemical agent that speeds up a reaction without being consumed by the reaction. An enzyme is a catalytic protein. Hydrolysis of sucrose by

More information

Cellular Respiration: Harvesting Chemical Energy

Cellular Respiration: Harvesting Chemical Energy Cellular Respiration: Harvesting Chemical Energy Chapter 9 Objectives Define oxidation and reduction, and, in general terms, explain how redox reactions are involved in energy exchanges. Name the three

More information

Chapter 9 Cellular Respiration and Fermentation*

Chapter 9 Cellular Respiration and Fermentation* Chapter 9 Cellular Respiration and Fermentation* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. Overview : Life

More information

Name: Class: Date: Multiple Choice Identify the letter of the choice that best completes the statement or answers the question.

Name: Class: Date: Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. Name: Class: Date: ID: A Biology Test #2 Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. As a result of diffusion, the concentration of many

More information

2. Cellular Respiration ATP. Where in the cell does this occur? Mitochondria

2. Cellular Respiration ATP. Where in the cell does this occur? Mitochondria But, in the presence of Oxygen. 2. Cellular Respiration A series of metabolic pathways involving 3 separate phases: Krebs cycle electron transport system oxidative phosphorylation Oxidizes pyruvate to

More information

1. Overview of Respiration

1. Overview of Respiration Chapter 6: CELLULAR RESPIRATION 1. Overview of Respiration 2. Glycolysis 3. The Citric Acid Cycle 4. Oxidative Phosphorylation 1. Overview of Respiration What is Cellular Respiration? It is the process

More information

Important Coenzymes NAD+ NADP+ FAD Coenzyme A. Enzymes The turnover number is generally 1-10,000 molecules per second.

Important Coenzymes NAD+ NADP+ FAD Coenzyme A. Enzymes The turnover number is generally 1-10,000 molecules per second. Microbial Metabolism Metabolism: The sum of the chemical reactions in an organism Catabolism: The energy-releasing processes Anabolism: The energy-using processes Catabolism provides the building blocks

More information

Cellular Respiration: Harvesting Chemical Energy. Chapter 9

Cellular Respiration: Harvesting Chemical Energy. Chapter 9 Cellular Respiration: Harvesting Chemical Energy Chapter 9 Life Is Work Living cells require energy from outside sources Plants E from? Animals E from? Light energy Energy flows into ecosystem as light

More information

The Structure and Function of Large Biological Molecules

The Structure and Function of Large Biological Molecules NAME DATE Chapter 5 Key Concepts The Structure and Function of Large Biological Molecules Guided Reading Concept 5.1: Macromolecules are polymers, built from monomers 1. The large molecules of all living

More information

Biological Molecules. Biomolecules & Some of their Functions

Biological Molecules. Biomolecules & Some of their Functions Biomolecules & Some of their Functions Chapter 3 & part of 6 Biological Molecules Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form

More information

Multiple Choice Identify the choice that best completes the statement or answers the question.

Multiple Choice Identify the choice that best completes the statement or answers the question. AP bio fall 2014 final exam prep Multiple Choice Identify the choice that best completes the statement or answers the question. 1. According to the first law of thermodynamics, a. the energy of a system

More information

BIOLOGY 200 SPRING QUARTER 2015 EXAM 1-PRACTICE QUESTIONS KEY. Codon Table!

BIOLOGY 200 SPRING QUARTER 2015 EXAM 1-PRACTICE QUESTIONS KEY. Codon Table! BIOLOGY 200 SPRING QUARTER 2015 EXAM 1-PRACTICE QUESTIONS KEY Codon Table! STOP STOP STOP NOTE: We have included the Bloom s level for each practice question (written in blue after each question). This

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

THE CHEMISTRY OF LIFE

THE CHEMISTRY OF LIFE Name Date Class 24 THE CHEMISTRY OF LIFE Chapter Test A A. Matching Match each description in Column A to the correct term in Column B. Write the letter of the correct term on the line. Column A Column

More information

8 CELLULAR RESPIRATION

8 CELLULAR RESPIRATION Cellular Respiration Test Study Guide Redox Reactions What does it mean when something is reduced? Oxidized? What is an oxidizing agent? Reducing agent? Be able to apply these to the cellular respiration

More information

Metabolism. Sum total of all chemical reactions that occur within an organism Also refers to specific chemical reactions at the cellular level

Metabolism. Sum total of all chemical reactions that occur within an organism Also refers to specific chemical reactions at the cellular level Metabolism Sum total of all chemical reactions that occur within an organism Also refers to specific chemical reactions at the cellular level 1 Chemical reactions 2 factors govern fate of a chemical reaction

More information

The Citric Acid Cycle and Oxidative Phosphorylation

The Citric Acid Cycle and Oxidative Phosphorylation Honors Biology Chapter 6.8 6.12 Study Sheet The Citric Acid Cycle and Oxidative Phosphorylation PYRUVATE OXIDATION DRAW THE DETAILED REACTION BELOW: REACTION SUMMARY: SUBSTRATES: PRODUCTS: THE CITRIC ACID

More information

ATP. The point is to make ATP!

ATP. The point is to make ATP! ATP The point is to make ATP! 2008-2009 The energy needs of life Organisms are endergonic systems. What do we need energy for? synthesis building biomolecules reproduction movement active transport temperature

More information

UNIVERSITY OF BOLTON ENGINEERING, SPORTS AND SCIENCES ACADEMIC GROUP. BEng/MEng (HONS) BIOMEDICAL ENGINEERING SEMESTER ONE EXAMINATIONS 2014/15

UNIVERSITY OF BOLTON ENGINEERING, SPORTS AND SCIENCES ACADEMIC GROUP. BEng/MEng (HONS) BIOMEDICAL ENGINEERING SEMESTER ONE EXAMINATIONS 2014/15 UNIVERSITY OF BOLTON [ab63] ENGINEERING, SPORTS AND SCIENCES ACADEMIC GROUP BEng/MEng (HONS) BIOMEDICAL ENGINEERING SEMESTER ONE EXAMINATIONS 2014/15 MOLECULAR PRINCIPLES OF BIOMEDICAL ENGINEERING MODULE

More information

Concept 5.1 Macromolecules are polymers, built from monomers. 1. The large molecules of all living things fall into just four main classes. Name them.

Concept 5.1 Macromolecules are polymers, built from monomers. 1. The large molecules of all living things fall into just four main classes. Name them. Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Lecture 8 Cell Biolog y ٢٢٢ ١

Lecture 8 Cell Biolog y ٢٢٢ ١ Lecture 8 ١ Mitochondria Function The most prominent roles of mitochondria are to produce ATP (i.e., phosphorylation of ADP) through respiration And to regulate cellular metabolism. The central set of

More information

endergonic exergonic activation energy

endergonic exergonic activation energy Week 5 Last week, we talked about energy and how chemical reactions in biology are often endergonic (energy storing) or exergonic (energy releasing). Let s look at the endergonic and exergonic reaction

More information

Introduction Chapter 6. 6.1 Photosynthesis and cellular respiration provide energy for life. 6.3 Cellular respiration banks energy in ATP molecules

Introduction Chapter 6. 6.1 Photosynthesis and cellular respiration provide energy for life. 6.3 Cellular respiration banks energy in ATP molecules Introduction Chapter 6 In eukaryotes, cellular respiration harvests energy from food, yields large amounts of, and Uses to drive cellular work. A similar process takes place in many prokaryotic organisms.

More information

2. Give the formula (with names) for the catabolic degradation of glucose by cellular respiration.

2. Give the formula (with names) for the catabolic degradation of glucose by cellular respiration. Chapter 9: Cellular Respiration: Harvesting Chemical Energy Name Period Overview: Before getting involved with the details of cellular respiration and photosynthesis, take a second to look at the big picture.

More information

Which statement best describes the movement of ions shown in the diagram? where they create a highly reducing environment and hydrolyze CO 2

Which statement best describes the movement of ions shown in the diagram? where they create a highly reducing environment and hydrolyze CO 2 1. The electron transport chain is a part of cellular respiration. The diagram below shows the movement of ions in the electron transport chain within a mitochondrion. Which statement best describes the

More information

WHY IS THIS IMPORTANT?

WHY IS THIS IMPORTANT? CHAPTER 2 FUNDAMENTAL CHEMISTRY FOR MICROBIOLOGY Charles D. Winters / Science Photo Library WHY IS THIS IMPORTANT? An understanding of chemistry is essential to understand cellular structure and function,

More information

Biochemistry. Carbohydrates

Biochemistry. Carbohydrates Biochemistry Biochemistry is the science deals with chemical composition and reactions in living organisms At some level, all biological processes have a component that is chemical in nature Energy conversion

More information

Name: Teacher: Score: /30. Unit 1 Cell Biology Key Area 4: DNA and Production of Proteins

Name: Teacher: Score: /30. Unit 1 Cell Biology Key Area 4: DNA and Production of Proteins Name: Teacher: Score: /30 Unit 1 Cell Biology Key Area 4: DNA and Production of Proteins (Q1-5 are multiple choice, choose ONE answer by clearly writing/circling ONE letter. Each question is worth one

More information

Lecture 8: Cellular Respiration

Lecture 8: Cellular Respiration Lecture 8: Cellular Respiration I. Overview of Aerobic Respiration A. Redox process where energy contained in chemical bonds in glucose is converted to ATP 1. Aerobic respiration a. Requires oxygen C.

More information

monosaccharides fatty acids amino acids

monosaccharides fatty acids amino acids Cellular Energy In order to sustain life (steady state), cells constantly expend energy in the form of ATP hydrolysis the hydrolysis of ATP yields a molecule of ADP (adenosine diphosphate) and a Phosphate

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

KEY. BI 212 Summer Exam I. July 27 th 2015

KEY. BI 212 Summer Exam I. July 27 th 2015 KEY BI 212 Summer 2015 Exam I July 27 th 2015 On your scantron, please fill in: 1. Your name (First and Last) 2. Exam I 3. Date 4. Lab section: MW at 1 section 010; MW at 4 section 011; TR at 1 section

More information

Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy

Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy for cellular work (ATP) 3. Importance of electrons and

More information

Keystone Review Practice Test Module A Cells and Cell Processes. 1. Which characteristic is shared by all prokaryotes and eukaryotes?

Keystone Review Practice Test Module A Cells and Cell Processes. 1. Which characteristic is shared by all prokaryotes and eukaryotes? Keystone Review Practice Test Module A Cells and Cell Processes 1. Which characteristic is shared by all prokaryotes and eukaryotes? a. Ability to store hereditary information b. Use of organelles to control

More information

Cellular Respiration and Fermentation

Cellular Respiration and Fermentation Cellular Respiration and Fermentation Cellular Basis of Life Q: How do organisms obtain energy? 9.1 Why do most organisms undergo the process of cellular respiration? WHAT I KNOW SAMPLE ANSWER: Cellular

More information

AP BIOLOGY 2006 SCORING GUIDELINES (Form B) Question 2

AP BIOLOGY 2006 SCORING GUIDELINES (Form B) Question 2 AP BIOLOGY 2006 SCORING GUIDELINES (Form B) Question 2 The relationship of structure to function is one of the major themes in biology. For three of the following structure/function pairs, describe the

More information

UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES. BEng (HONS)/MEng BIOMEDICAL ENGINEERING BEng (Hons) MEDICAL ENGINEERING

UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES. BEng (HONS)/MEng BIOMEDICAL ENGINEERING BEng (Hons) MEDICAL ENGINEERING [LH92] UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES BEng (HONS)/MEng BIOMEDICAL ENGINEERING BEng (Hons) MEDICAL ENGINEERING SEMESTER ONE EXAMINATIONS 2015/16 MOLECULAR PRINCIPLES OF BIOMEDICAL

More information

Cellular Respiration: Harvesting Chemical Energy

Cellular Respiration: Harvesting Chemical Energy Chapter 9 Cellular Respiration: Harvesting Chemical Energy PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with

More information

Chapter 9: How Cells Harvest Energy

Chapter 9: How Cells Harvest Energy Chapter 9: How Cells Harvest Energy General Pathways for making ATP Aerobic Respiration Anaerobic Respiration Fermentation Differentiate between aerobic respiration, anaerobic respiration, and fermentation

More information

Lecture 6. Cellular respiration is carried out in two stages: Glycolysis Oxidation. An overview of aerobic respiration.

Lecture 6. Cellular respiration is carried out in two stages: Glycolysis Oxidation. An overview of aerobic respiration. Lecture 6 Respiration An Overview of Cellular Respiration Cellular respiration is the harvesting of energy from breakdown of organic molecules produced by plants The overall process may be summarized as

More information

Chapter 4: Cellular Respiration pg : Introduction to Cellular Respiration and Fermentation

Chapter 4: Cellular Respiration pg : Introduction to Cellular Respiration and Fermentation UNIT 2: Metabolic Processes Chapter 4: Cellular Respiration pg. 166-209 4.1: Introduction to Cellular Respiration and Fermentation pg. 168 171 The energy which keeps our planet alive comes from the solar

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

DNA and RNA. Griffith and Transformation (pages ) Avery and DNA (page 289) Chapter 12. Name Class Date

DNA and RNA. Griffith and Transformation (pages ) Avery and DNA (page 289) Chapter 12. Name Class Date Chapter 12 DNA and RNA Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

No growth: Mutant cells cannot grow and divide Minimal medium. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants

No growth: Mutant cells cannot grow and divide Minimal medium. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Minimal medium RESULTS Minimal medium (MM) (control) Wild type Classes of Neurospora crassa Class

More information

Chapter 5: Microbial Metabolism

Chapter 5: Microbial Metabolism Chapter 5: Microbial Metabolism 1. Enzymes 2. ATP Production 3. Autotrophic Processes 1. Enzymes Biochemical Reactions All living cells depend on biochemical reactions to maintain homeostasis. All of the

More information

Organic Chemistry Worksheet

Organic Chemistry Worksheet Organic Chemistry Worksheet Name Section A: Intro to Organic Compounds 1. Organic molecules exist in all living cells. In terms of biochemistry, what does the term organic mean? 2. Identify the monomer

More information

Lab 3 Organic Molecules of Biological Importance

Lab 3 Organic Molecules of Biological Importance Name Biology 3 ID Number Lab 3 Organic Molecules of Biological Importance Section 1 - Organic Molecules Section 2 - Functional Groups Section 3 - From Building Blocks to Macromolecules Section 4 - Carbohydrates

More information

1. One difference between prokaryotes and eukaryotes is that prokaryotes do not have a. DNA. c. cytoplasm. b. a cell membrane. d. a nucleus.

1. One difference between prokaryotes and eukaryotes is that prokaryotes do not have a. DNA. c. cytoplasm. b. a cell membrane. d. a nucleus. Biology 2 Chapter 3 Test Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. One difference between prokaryotes and eukaryotes is that prokaryotes do

More information

Chapter 9. Cellular Respiration: Harvesting Chemical Energy. Multiple-Choice Questions

Chapter 9. Cellular Respiration: Harvesting Chemical Energy. Multiple-Choice Questions Chapter 9 Cellular Respiration: Harvesting Chemical Energy Multiple-Choice Questions 1) What is the term for metabolic pathways that release stored energy by breaking down complex molecules? A) anabolic

More information

Section 1 Workbook (unit 3) ANSWERS

Section 1 Workbook (unit 3) ANSWERS Section 1 Workbook (unit 3) ANSWERS Complete the following table: nucleotide DNA RN B1. Analyze the functional inter-relationships of cell structures. 1) Describe the function and structure of these organelles.

More information

Cell Station. Cytoplasm DNA

Cell Station. Cytoplasm DNA Cell Station Part 1: Cell Types --Turn to pages 74 & 75 1. Create a double bubble comparing and contrasting eukaryotes and prokaryotes a. Must have three similarities and two differences No membranebound

More information

Introduction to Life Science BSC Fall Homework 3: Cellular Processes. Connect Due Date: 11/23/ :59PM. Multiple Choice Portion

Introduction to Life Science BSC Fall Homework 3: Cellular Processes. Connect Due Date: 11/23/ :59PM. Multiple Choice Portion Introduction to Life Science BSC 1005 Fall 2011 Homework 3: Cellular Processes Connect Due Date: 11/23/2011 11:59PM Instructions Complete this homework assignment as the material is covered in class. You

More information

Intermediate Step. Pyruvic acid (from ) is oxidized and decarboyxlated. Figure

Intermediate Step. Pyruvic acid (from ) is oxidized and decarboyxlated. Figure Intermediate Step Pyruvic acid (from ) is oxidized and decarboyxlated Figure 5.13.1 Krebs Cycle Oxidation of acetyl CoA produces NADH, FADH 2 & ATP Energy from acetyl CoA bonds transferred to? Where in

More information

macromolecule: monomer: polymer: a. The elements found in carbohydrates occur in a specific ratio. Describe that ratio.

macromolecule: monomer: polymer: a. The elements found in carbohydrates occur in a specific ratio. Describe that ratio. NAME: DATE: Biological Macromolecule Poster Project HOUR: BIOLOGY You and your table mates will be researching and creating an informational poster on one of four biological macromolecules: carbohydrates,

More information

Cell Biology. Summary Notes 2

Cell Biology. Summary Notes 2 Cell Biology Summary Notes 2 Name Class These notes contain a summary of key facts. When revising, you will still need to refer to your jotter to remind yourself of the experimental and practical work

More information

1. Enzymes. Biochemical Reactions. Chapter 5: Microbial Metabolism. 1. Enzymes. 2. ATP Production. 3. Autotrophic Processes

1. Enzymes. Biochemical Reactions. Chapter 5: Microbial Metabolism. 1. Enzymes. 2. ATP Production. 3. Autotrophic Processes Chapter 5: Microbial Metabolism 1. Enzymes 2. ATP Production 3. Autotrophic Processes 1. Enzymes Biochemical Reactions All living cells depend on biochemical reactions to maintain homeostasis. All of the

More information

Cellular Energy Acquisition

Cellular Energy Acquisition Cellular Energy Acquisition 1. Organisms that can manufacture their own chemical energy sources are called. 2. depend on energy stored in chemical bonds by autotrophs for their food energy. 3. Simple molecules

More information

INTRODUCTION TO CELLULAR RESPIRATION. Copyright 2009 Pearson Education, Inc.

INTRODUCTION TO CELLULAR RESPIRATION. Copyright 2009 Pearson Education, Inc. INTRODUCTION TO CELLULAR RESPIRATION 6.1 Photosynthesis and cellular respiration provide energy for life Energy is necessary for life processes These include growth, transport, manufacture, movement, reproduction,

More information