The microarray block. Outline. Microarray experiments. Microarray Technologies. Outline

Size: px
Start display at page:

Download "The microarray block. Outline. Microarray experiments. Microarray Technologies. Outline"

Transcription

1 The microarray block Bioinformatics March 006 Microarray data analysis John Gustafsson Mathematical statistics Chalmers Lectures DNA microarray technology overview (KS) of microarray data (JG) How to use microarray technology and what to do with the results (BG) Computere exercise A case study using Bioconductor (JG) Microarray experiments Outline Biological Question or Hypothesis Labwork Microarray experiments Data analysis steps Introduction to the Computer Exercise Biological verification and interpretation Statistics and ranking To consider all these parts is extremely important for a satisfying result. Outline Microarray experiments Technologies design acquisition and analysis Data analysis steps Introduction to the Computer Exercise Microarray Technologies Spotted two-channel cdna Up to spots on a single glass-slides Two sources of RNA on each array labeled with red (Cy5) and green (Cy3) Can be bought or produced One slide costs from 100 euro 1

2 Microarray Technologies Affymetrix Each gene has seveal PM and MM One source on each array Can only be bought One chip costs from 00 euro design Depends heavily on the biological question Different types of designs are: directs comparison, common reference and time course Differs between cdna and Affymetrix type of microarrays design design Direct Comparison Time course with direct comparisons A B T 1 T T 3 T 4 Common Reference Time course with common reference A B T 1 T T 3 T 4 C. Ref. C. Ref. acquisition and analysis acquisition and analysis Print-tip area cdna Microarray

3 Outline Microarray experiments Data analysis R and Bioconductor Visualization and exploration of data Introduction to the Computer Exercise R and Bioconductor R is a powerful statistical software that is open source and free R is available for many platforms (Windows, Linux, Solaris, ), see Bioconductor is a collection of R packages for analysis of biological data of various kind, see LIMMA Linear Models for Microarray An R-package for analysis of microarray data Originally intended for spotted cdna microarrays but it is possible to analyze Affymetrix data as well Relatively easy to use and can handle almost any experimental design Contains most of the functions needed for a basic microarray analysis More information of LIMMA is available at Data Representation (cdna) To increase visualization, the following transformation is usually done R M = log R logg = log G 1 A = ( log R + logg) M reflects the fold change and A the average spot intensity MA-plot Data Representation (Affy) A model that takes into account the different affinity of the probes is fitted to the PM s The MM s is usually discarded The result is a log value for each gene (signal) MA-values can be created by comparing two Affymetrix arrays 3

4 Visualization Very important for quality control, and understanding the data Visualization of spatial patterns Visualization of intensity dependent bias: MA-plots Visualization of variance: box-plots swirl.1 Box-plot M M A swirl.1 swirl. swirl.3 swirl.4 loess Necessary to remove red or green bias Which subset to normalize with? Can be intensity-dependent. Ad-hoc solution: The loess function. Can be spatially dependent. A solution: print-tip loess normalization Normalizing between arrays: Adjusting the distribution Labwork A robust way to remove bias and intensity dependent trends. A curve is fitted using a robust weighted least square to the MA-plot and is then subtracted from the M-value. Can be done both locally (print-tip loess) and globally (global loess). Computationally intensive for large datasets (i.e. many genes). 4

5 loess To decide which genes that are regulated we need a statistic or ranking function The most common hypothesis are H 0 : gene g is not regulated H A : gene g is regulated, but other hypothesis might also be interesting Example of statistics used are: M-value threshold, t- statistic and moderated t-statistic M-value threshold M-value threshold Reject H 0 if M g > T Reject H 0 if M g > T Pros Easy to use and implement Fast and works with any number of arrays Easy to understand Easy to calculate significance under the right assumptions Cons Does not take the variance of a gene into account t-statistic Labwork M g Reject H 0 if > T. S / n Pros Takes the variance into account Easy to use and implement Easy to calculate significance under right assumptions Cons Very sensitive to genes with small variance Need many arrays to work satisfactory t-statistic M g Reject H 0 if > T. S / n 5

6 moderated t- statistic Labwork moderated t- statistic M g Reject H 0 if > T. S / n + a M g Reject H 0 if > T. S / n + a Pros Takes the variance into account Robust Works well with few arrays (>) Cons Numerical methods is needed to calculate significance. Outline Microarray experiments Data analysis steps Introduction to the Computer Exercise Introduction to Computer Exercise Aims To understand a complete microarray analysis To understand the need for normalization To understand the difference between different statistics To use the LIMMA-package and understand some its structure The SWIRL dataset ~8000 genes on four arrays from zebrafish. Direct comparison of WT vs BMP mutant. Dye swaps - two arrays with WT Cy3, mutant Cy5 and two arrays with WT Cy5, mutant Cy3. Questions at issue What happens in the mutant? (Exploative approach) What happens with the BMP gene? What should happen in a ideal experiment? Acknowledgements The lecture is partially based on slides by Erik Kristiansson and Petter Mostad 6

7 Extra slides Array Layout cdna microarrays are printed using sets of printtips This creates blocks containing rows and columns In order to visualize correctly each spot, its spatial position on the chip must be inferred An object containing the number of rows and columns of blocks, and the number of rows and columns of spots within blocks must be created Multiple testing adjustments The raw p-values are valid only individually Several ways to deal with this, for example controlling family wise error rate, or controlling the false discovery rate The Holm method will control the family wise error rate: gives few significant genes The FDR method controls the false discovery rate: how many false positives (genes that only appear to be diff. expr.) one can expect On normalization of trends Attention: Trends might be confounded with interesting information might conceal this interesting information Solution: Randomize! Example: Spatial trends in microarrays (can randomize gene position), however not possible for D-gels (cannot randomize protein position) 7

8 8

Basics of microarrays. Petter Mostad 2003

Basics of microarrays. Petter Mostad 2003 Basics of microarrays Petter Mostad 2003 Why microarrays? Microarrays work by hybridizing strands of DNA in a sample against complementary DNA in spots on a chip. Expression analysis measure relative amounts

More information

Microarray Data Analysis. Data quality assessment and normalization

Microarray Data Analysis. Data quality assessment and normalization Microarray Data Analysis Data quality assessment and normalization Outline Microarray data quality: diagnostic plots Pre-processing cdna chips Image analysis Normalization Non-specific filtering Preprocessing

More information

Dealing with noise in microarray analysis

Dealing with noise in microarray analysis Dealing with noise in microarray analysis Analysis flow Quantification Normalization Filtering Data analysis Outline Systematic noise Between and within arrays Considerations of normalization in experimental

More information

Introduction to Gene Expression, Microarray Technology, and BioConductor. Utah State University Bioinformatics: Problems and Solutions Summer 2006

Introduction to Gene Expression, Microarray Technology, and BioConductor. Utah State University Bioinformatics: Problems and Solutions Summer 2006 Introduction to Gene Expression, Microarray Technology, and BioConductor Utah State University Bioinformatics: Problems and Solutions Summer 2006 1 Vocabulary - Review Gene: hereditary DNA sequence at

More information

Multiple One-Sample or Paired T-Tests

Multiple One-Sample or Paired T-Tests Chapter 610 Multiple One-Sample or Paired T-Tests Introduction This chapter describes how to estimate power and sample size (number of arrays) for paired and one sample highthroughput studies using the.

More information

Analysis of gene expression data. Ulf Leser and Philippe Thomas

Analysis of gene expression data. Ulf Leser and Philippe Thomas Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:

More information

Microarray Data Analysis. Statistical methods to detect differentially expressed genes

Microarray Data Analysis. Statistical methods to detect differentially expressed genes Microarray Data Analysis Statistical methods to detect differentially expressed genes Outline The class comparison problem Statistical tests Calculation of p-values Permutations tests The volcano plot

More information

Multiple testing with gene expression array data

Multiple testing with gene expression array data Multiple testing with gene expression array data Anja von Heydebreck Max Planck Institute for Molecular Genetics, Dept. Computational Molecular Biology, Berlin, Germany heydebre@molgen.mpg.de Slides partly

More information

PREPROCESSING MICROARRAY DATA. Background correction Normalization Summarization Transforms

PREPROCESSING MICROARRAY DATA. Background correction Normalization Summarization Transforms PREPROCESSING MICROARRAY DATA Background correction Normalization Summarization Transforms Microarray studies life cycle Biological question Experimental design Failed Microarray experiment Quality Measurement

More information

Microarray Data Analysis

Microarray Data Analysis Microarray Data Analysis ECS 289A a) Oligonucleotide and b) Spotted Arrays Lochart and Winzeler 2000 Microarray Data Plate 1 Plate 2 Plate 10 Gene 1 Gene 2 Gene 3 0.013 2.14 Each entry is the relative

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Gene Expression Analysis

Gene Expression Analysis Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands

More information

Contrast Normalization of Oligonucleotide Arrays MAGNUS ÅSTRAND ABSTRACT

Contrast Normalization of Oligonucleotide Arrays MAGNUS ÅSTRAND ABSTRACT JOURNAL OF COMPUTATIONAL BIOLOGY Volume 0, Number, 003 Mary Ann Liebert, Inc. Pp. 95 0 Contrast Normalization of Oligonucleotide Arrays MAGNUS ÅSTRAND ABSTRACT Affymetrix high-density oligonucleotide array

More information

Sample Size Estimation while Controlling False Discovery Rate for Microarray Experiments Using the ssize.fdr Package

Sample Size Estimation while Controlling False Discovery Rate for Microarray Experiments Using the ssize.fdr Package CONTRIBUTED RESEARCH ARTICLES 47 Sample Size Estimation while Controlling False Discovery Rate for Microarray Experiments Using the ssize.fdr Package by Megan Orr and Peng Liu Introduction Microarray experiments

More information

Introduction to Differential Expression Analysis. Microarray Experiment Steps. Most Common Types of Data Analysis

Introduction to Differential Expression Analysis. Microarray Experiment Steps. Most Common Types of Data Analysis Introduction to Differential Expression Analysis Microarray Experiment Steps Biological question Experimental design Microarray experiment Database Data Analysis Biological verification and interpretation

More information

Data Normalization and Standardization the benefits of pre-processing microarray data

Data Normalization and Standardization the benefits of pre-processing microarray data Data Normalization and Standardization the benefits of pre-processing microarray data Ben Bolstad Statistics, University of California, Berkeley bmb@bmbolstad.com http://bmbolstad.com 1 Outline Introduction

More information

Normalizing cdna microarray data

Normalizing cdna microarray data Normalizing cdna microarray data 1 There are many sources of systematic variation in microarray experiments which affect the measured gene expression level. Normalization is the term used to describe the

More information

Microarray Data Analysis. A step by step analysis using BRB-Array Tools

Microarray Data Analysis. A step by step analysis using BRB-Array Tools Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.

More information

Microarray Technology and Analysis

Microarray Technology and Analysis Data Analysis and Modeling Methods Microarray Technology and Analysis bhaibeka@ulb.ac.be Université Libre de Bruxelles Institut Jules Bordet Table of Contents Microarray Technology A FFYMETRIX c Microarray

More information

Intensity-dependent normalization in microarray analysis: a note of concern

Intensity-dependent normalization in microarray analysis: a note of concern Bernoulli 10(6), 2004, 943 949 Intensity-dependent normalization in microarray analysis: a note of concern MEI-LING TING LEE 1 and GEORGE A. WHITMORE 2 1 Channing Laboratory, HMS/BHW, Harvard Medical School,

More information

Microarray Analysis. Roger Payne (& David Baird) VSN International, 5 The Waterhouse, Waterhouse Street, Hemel Hempstead, UK

Microarray Analysis. Roger Payne (& David Baird) VSN International, 5 The Waterhouse, Waterhouse Street, Hemel Hempstead, UK Microarray Analysis Roger Payne (& David Baird) VSN International, 5 The Waterhouse, Waterhouse Street, Hemel Hempstead, UK Wageningen, 18 th June 2008 GenStat microarray facilities GenStat has menus to

More information

Microarray Analysis (a little) with R. Andy Pohl, Lowe Lab Jan 22, 2003

Microarray Analysis (a little) with R. Andy Pohl, Lowe Lab Jan 22, 2003 Microarray Analysis (a little) with R Andy Pohl, Lowe Lab Jan 22, 2003 Overview 1. Basic Analysis Strategy 2. R 3. An R package for microarrays: Bioconductor and using the marray packages. 4. Bioconductor

More information

Microarray Analysis Using R/Bioconductor

Microarray Analysis Using R/Bioconductor Microarray Analysis Using R/Bioconductor Reddy Gali, Ph.D. rgali@hms.harvard.edu h"p://catalyst.harvard.edu Agenda Introduction to microarrays Workflow of a gene expression microarray experiment Publishing

More information

DNA Microarray Experiments and Analysis

DNA Microarray Experiments and Analysis DNA Microarray Experiments and Analysis John Wyrick MBios 503 12/6/2004 mrna level Down Up Mechanics of DNA Microarrays complex mixture of mrna molecules Fluorescent Dye Gene 1 Gene 2...Gene 6200 UACGGCUUAGCAGGUCAUUGG

More information

Image analysis of cdna microarray data Marit Holden Norsk Regnesentral

Image analysis of cdna microarray data Marit Holden Norsk Regnesentral Image analysis of cdna microarray data Marit Holden al Marit.Holden@nr.no Paper by Y. H. Yang, M. J. Buckley, S. Dudoit and T. P. Speed. Comparison of methods for image analysis on cdna microarray data.

More information

Introduction to DNA Microarray Technologies

Introduction to DNA Microarray Technologies Introduction to DNA Microarray Technologies Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course Winter 2002 Copyright 2002, all rights reserved Outline Basic

More information

Analysis of cdna microarray expression data Computer Exercise Part I

Analysis of cdna microarray expression data Computer Exercise Part I Analysis of cdna microarray expression data Computer Exercise Part I Organized by The Linnaeus Centre for Bioinformatics and The WCN Expression Array Facility at Uppsala University 1 Table of Contents

More information

MICROARRAY. Measures Gene Expression. Global - Genome wide scale entire genome -30,000 genes. Relative expression levels between two groups

MICROARRAY. Measures Gene Expression. Global - Genome wide scale entire genome -30,000 genes. Relative expression levels between two groups MICROARRAY Measures Gene Expression Global - Genome wide scale entire genome -30,000 genes Relative expression levels between two groups Treatment Control Key components Array Immobilised target Labeled

More information

Affymetrix GeneChips Oligonucleotide Microarrays

Affymetrix GeneChips Oligonucleotide Microarrays Affymetrix GeneChips Oligonucleotide Microarrays Affymetrix Qiagen Many commercial microarray platforms are available: Amersham Biosciences MWG Biotech Rosetta (Merck) Agilent Clontech, BD Biosciences

More information

DNA Microarrays in Medicine Expressing yourself one pixel at a time

DNA Microarrays in Medicine Expressing yourself one pixel at a time DNA Microarrays in Medicine Expressing yourself one pixel at a time J. Patrick Vandersluis, Ph.D. HealthRx Corporation www.healthrx.com Patrick@HealthRx.com Agenda The Data of Biological Systems Review

More information

Course on Microarray Gene Expression Analysis

Course on Microarray Gene Expression Analysis Course on Microarray Gene Expression Analysis ::: Differential Expression Analysis Daniel Rico drico@cnio.es Bioinformatics Unit CNIO Upregulation or No Change Downregulation Image analysis comparison

More information

Statistical Methods and Software for the Analysis of Microarray Experiments

Statistical Methods and Software for the Analysis of Microarray Experiments Statistical Methods and Software for the Analysis of Microarray Experiments www.stat.berkeley.edu/~sandrine/docs/talks/mbi04/mbi.html Nicholas P. Jewell and Sandrine Dudoit Division of Biostatistics, UC

More information

Supervised analysis of gene expression data

Supervised analysis of gene expression data Supervised analysis of gene expression data Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information

More information

Introduction to microarray technology Data analysis (prefiltering, normalization, gene identification)

Introduction to microarray technology Data analysis (prefiltering, normalization, gene identification) Computational Biology I Introduction to microarray technology Data analysis (prefiltering, normalization, gene identification) Introduction to Microarray Technology H. Yang Central Dogma DNA (genome sequencing)

More information

Lecture 12 Small & Large Scale Expression Analysis. Microarray Data Analysis

Lecture 12 Small & Large Scale Expression Analysis. Microarray Data Analysis Lecture 12 Small & Large Scale Expression Analysis M. Saleet Jafri Program in Bioinformatics and Computational Biology George Mason University Microarray Data Analysis Gene chips allow the simultaneous

More information

Microarray Analysis. Chao-Jen Wong Fred Hutchinson Cancer Research Center December, 2010

Microarray Analysis. Chao-Jen Wong Fred Hutchinson Cancer Research Center December, 2010 Microarray Analysis Chao-Jen Wong Fred Hutchinson Cancer Research Center 9-10 December, 2010 Basics Moderated t-tests Using limma p-value Correction Resources Introduction Identify differentially expressed

More information

Analyzing Roche NimbleGen Data in Partek Express : A MAQC Study

Analyzing Roche NimbleGen Data in Partek Express : A MAQC Study Analyzing Roche NimbleGen Data in Partek Express : A MAQC Study This tutorial will provide a step-by-step walk through for analyzing a gene expression data set using the Partek Express software package.

More information

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from

More information

Data Processing and Quality Control (QC)

Data Processing and Quality Control (QC) Data Processing and Quality Control (QC) Overview Main concepts Controls Probe & sample QC Filtering Normalisation & batch effect Examples Assessing controls Most platforms for methylation quantification

More information

Introduction to DNA microarray technologies. Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang

Introduction to DNA microarray technologies. Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Introduction to DNA microarray technologies Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Outline Basic principles cdna microarrays Affymetrix oligonucleotide chips DNA microarrays

More information

(cdna) Microarray Experimental Steps. (A) Attach single-strand DNA segments for each of

(cdna) Microarray Experimental Steps. (A) Attach single-strand DNA segments for each of (cdna) Microarray Experimental Steps (A) Attach single-strand DNA segments for each of i = 1,..., N (eg = 1.e4) Genes robotically to N p distinct tiny spots on treated membrane or glass slide (eg p = 30).

More information

I Just Received My Microarray Data, Now What? Danny Park MGH-PGA (ParaBioSys) Sat April 24, 2004

I Just Received My Microarray Data, Now What? Danny Park MGH-PGA (ParaBioSys) Sat April 24, 2004 I Just Received My Microarray Data, Now What? Danny Park MGH-PGA (ParaBioSys) Sat April 24, 2004 I Just Received My Microarray Data Where did this come from? A description of the process from RNA to raw

More information

Comparison of transcription factor binding sites from ChIP-seq experiments

Comparison of transcription factor binding sites from ChIP-seq experiments Comparison of transcription factor binding sites from ChIP-seq experiments by Colin Diesh The University of Colorado, Boulder Department of Computer Science May, 2013 The Thesis Committee for Colin Diesh

More information

Typical Experiments. One-color experiment. Two-color experiment. RNA extraction. RNA labeling

Typical Experiments. One-color experiment. Two-color experiment. RNA extraction. RNA labeling Microarray analysis Outline Define the common question The methods Supervised analysis of two groups How Multiple comparisons correction Primary vs. Metastasis tumor cells (An example) Caveats Unsupervised

More information

Microarray Data Analysis - A Brief Overview. R Group Rongkun Shen

Microarray Data Analysis - A Brief Overview. R Group Rongkun Shen Microarray Data Analysis - A Brief Overview R Group Rongkun Shen 2008-02-11 R R is an environment and a computer programming language R is free, open-source, and runs on UNIX/Linux, Windows and Mac R language

More information

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray

More information

Microarray analysis. What makes one cell different from another? liver vs. brain. Cancerous vs. non-cancerous. Treatment vs.

Microarray analysis. What makes one cell different from another? liver vs. brain. Cancerous vs. non-cancerous. Treatment vs. What makes one cell different from another? Microarray analysis liver vs. brain Cancerous vs. non-cancerous CS426, week 12 Golan Yona Treatment vs. control There are about 100,000 genes in mammalian genome

More information

Transcriptomics Bioinformatics. Dr. Hubert Rehrauer

Transcriptomics Bioinformatics. Dr. Hubert Rehrauer Transcriptomics Bioinformatics Dr. Hubert Rehrauer Outline Introduction Data processing and analysis More applications and validation Issues Bioinformatics From Wikipedia: Bioinformatics and computational

More information

MS&E 226: Small Data. Lecture 17: Additional topics in inference (v1) Ramesh Johari

MS&E 226: Small Data. Lecture 17: Additional topics in inference (v1) Ramesh Johari MS&E 226: Small Data Lecture 17: Additional topics in inference (v1) Ramesh Johari ramesh.johari@stanford.edu 1 / 34 Warnings 2 / 34 Modeling assumptions: Regression Remember that most of the inference

More information

Microarray Normalization James Diggans

Microarray Normalization James Diggans Microarray Normalization James Diggans jdiggans@mitre.org Slides courtesy of Dr. Brandon Higgs Outline Importance of normalization Feature extraction (pin-spotted arrays) Two-channel arrays MvA plots Global

More information

Microarrays. Using. Statistics and Data Analysis. for. R and Bioconductor. Sorin Draghici. Second Edition

Microarrays. Using. Statistics and Data Analysis. for. R and Bioconductor. Sorin Draghici. Second Edition Chapman & Hall/CRC Mathematical and Computational Biology Series Statistics and Data Analysis for Microarrays Using R and Bioconductor Second Edition Sorin Draghici CRC Press Taylor & Francis Group Boca

More information

Data Acquisition. DNA microarrays. The functional genomics pipeline. Experimental design affects outcome data analysis

Data Acquisition. DNA microarrays. The functional genomics pipeline. Experimental design affects outcome data analysis Data Acquisition DNA microarrays The functional genomics pipeline Experimental design affects outcome data analysis Data acquisition microarray processing Data preprocessing scaling/normalization/filtering

More information

Expression Measures. Robust Multi-array Average or Robust Mult-chip Average (RMA)

Expression Measures. Robust Multi-array Average or Robust Mult-chip Average (RMA) Expression Measures Robust Multi-array Average or Robust Mult-chip Average (RMA) The RMA method for computing an expression measure begins by computing background-corrected perfect match intensities for

More information

Intro to DNA Microarrays

Intro to DNA Microarrays Intro to DNA Microarrays Judy Wieber BBSI @ Pitt 2007 Department of Computational Biology University of Pittsburgh School of Medicine May 25, 2007 Also called DNA chips biochips gene chips gene arrays

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

Affymetrix.CEL Files. Preprocessing for Affymetrix GeneChip Data. Methods. MAS 5.0 Signal: Background Adjustment

Affymetrix.CEL Files. Preprocessing for Affymetrix GeneChip Data. Methods. MAS 5.0 Signal: Background Adjustment Preprocessing for Affymetrix GeneChip Data 1/18/11 Copyright 11 Dan Nettleton Affymetrix.CEL Files A.CEL file contains one number representing signal intensity for each probe cell on a single GeneChip..CEL

More information

Statistical Analysis for Microarray & Next-Generation Sequencing Studies

Statistical Analysis for Microarray & Next-Generation Sequencing Studies Statistical Analysis for Microarray & Next-Generation Sequencing Studies Using the right tools and interpreting the results Jonathan Gerstenhaber Field Application Specialist Partek Inc. Who is Partek?

More information

The analysis of microarray data

The analysis of microarray data The analysis of microarray data Ramesh Hariharan Strand Genomics Private Limited, and Indian Institute of Science, Bangalore, India, 560080 Tel: +91 80 361 1349; Fax: +91 80 361 8996; E-mail: ramesh@ strandgenomics.com

More information

SAS MACROS AND SAS JMP GENOMICS FOR ANALYSIS OF MICROARRAY GENE EXPRESSION DATA

SAS MACROS AND SAS JMP GENOMICS FOR ANALYSIS OF MICROARRAY GENE EXPRESSION DATA SAS MACROS AND SAS JMP GENOMICS FOR ANALYSIS OF MICROARRAY GENE EXPRESSION DATA J. Sreekumar Central Tuber Crops Research Institute Sreekariyam, Thiruvananthapuram - 695 017 Sreejyothi_in@yahoo.com 1.

More information

Microarray Data Analysis. Prof. Anastasios Bezerianos Andrei Dragomir Ioannis Maraziotis

Microarray Data Analysis. Prof. Anastasios Bezerianos Andrei Dragomir Ioannis Maraziotis Microarray Data Analysis Prof. Anastasios Bezerianos Andrei Dragomir Ioannis Maraziotis Process overview 1- sample 2- reference sample excitation scanning laser 1 laser 2 Cy3: ~550 nm Cy5: ~650 nm cdna

More information

Microarray Scanner Calibration Slide. User s Guide. Part Number: DS 01

Microarray Scanner Calibration Slide. User s Guide. Part Number: DS 01 Microarray Scanner Calibration Slide User s Guide Part Number: DS 01 Table of Contents Precautions... 3 Description... 4 Specifications... 4 Application summary... 4 General operating instructions... 5

More information

Different types of microarrays

Different types of microarrays Different types of microarrays # of samples hybridized Method of generating probes cdna Library Synthesized Single-channel Affymetrix (25-mer) NimbleGen (50-75-mer) Agilent (60-mer) Illumina (50-mer) Dual-channel

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Direct versus indirect designs for cdna microarray experiments

Direct versus indirect designs for cdna microarray experiments Direct versus indirect designs for cdna microarray experiments Terence P. Speed,2 and Yee Hwa Yang April 8, 2002 Technical report # 66, April 2002. Department of Statistics, University of California, Berkeley.

More information

Normalization of cdna Microarray Data

Normalization of cdna Microarray Data Citation: Smyth, G. K., and Speed, T. P. (2003). Normalization of cdna microarray data. Methods 31, 265-273. [PubMed ID 14597310] Normalization of cdna Microarray Data Gordon K. Smyth 1 and Terry Speed

More information

Microarray Analysis. Visualization and Functional Analysis

Microarray Analysis. Visualization and Functional Analysis Microarray Analysis Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Microarray pipeline so far Design experiment

More information

Central dogma of molecular biology: The state of a cell at any given time is governed

Central dogma of molecular biology: The state of a cell at any given time is governed Lecture 2: Microarrays Central dogma of molecular biology: The state of a cell at any given time is governed by which of its genes are expressed at that time. - Transcription, in which expressed DNA sequences

More information

Study Using Illumina Microarray Technology

Study Using Illumina Microarray Technology Gene Expression Analysis in Partek Express : An Age Study Using Illumina Microarray Technology This tutorial will provide step-by-step directions for analyzing an Illumina gene expression data set using

More information

Gene Expression Analysis Processing, Querying and Visualizing Gene Expression Data CANB 7640

Gene Expression Analysis Processing, Querying and Visualizing Gene Expression Data CANB 7640 Gene Expression Analysis Processing, Querying and Visualizing Gene Expression Data CANB 7640 Aik Choon Tan, Ph.D. Associate Professor of Bioinformatics Division of Medical Oncology Department of Medicine

More information

Analysis of Illumina Gene Expression Microarray Data

Analysis of Illumina Gene Expression Microarray Data Analysis of Illumina Gene Expression Microarray Data Asta Laiho, Msc. Tech. Bioinformatics research engineer The Finnish DNA Microarray Centre Turku Centre for Biotechnology, Finland The Finnish DNA Microarray

More information

Introduction to microarray analysis and tools

Introduction to microarray analysis and tools Introduction to microarray analysis and tools Module B: Survey of Microarray Analysis Tools Commercial Tools Agnes Viale, Ph.D. Genomics Core lab MSKCC Microarray assay life cycle Biological Question Data

More information

DNA Microarray Analysis

DNA Microarray Analysis DNA Microarray Analysis Course #27612 5-23 January 2009 DTU Center for Biological Sequence analysis (CBS) Teachers of the course [last year] Data pre-processing Statistics Dimension Reduction Programming

More information

Microarray Experimental Design Workshop

Microarray Experimental Design Workshop Microarray Experimental Design Workshop Ann Hess Center for Bioinformatics and Department of Statistics hess@stat.colostate.edu Welcome Experimental design is an important step when planning a microarray

More information

Introduction to cycle package

Introduction to cycle package Introduction to cycle package Matthias E. Futschik SysBioLab, University of Algarve, Faro, Portugal URL: http://cycle.sysbiolab.eu October 17, 2016 Contents 1 Overview 1 2 Installation requirements 2 3

More information

A model-based analysis of microarray experimental error and normalisation

A model-based analysis of microarray experimental error and normalisation Nucleic Acids Research, 2003, Vol. 31, No. 16 e96 DOI: 10.1093/nar/gng097 A model-based analysis of microarray experimental error and normalisation Yongxiang Fang 1,2, Andrew Brass 1,2, David C. Hoyle

More information

Design of microarray experiments

Design of microarray experiments Practical microarray analysis experimental design Design of microarray experiments Ulrich Mansmann mansmann@imbi.uni-heidelberg.de Practical microarray analysis October 2003 Heidelberg Heidelberg, October

More information

Tamoxifen Resistance in Breast Cancer

Tamoxifen Resistance in Breast Cancer Gene Expression Analysis : Tamoxifen Resistance in Breast Cancer B. Haibe-Kains 1,2 G. Bontempi 2 C. Sotiriou 1 1 Unité Microarray, Institut Jules Bordet 2 Machine Learning Group, Université Libre de Bruxelles

More information

PANP - a New Method of Gene Detection on Oligonucleotide Expression Arrays

PANP - a New Method of Gene Detection on Oligonucleotide Expression Arrays PANP - a New Method of Gene Detection on Oligonucleotide Expression Arrays Peter Warren 1,2, Jadwiga Bienkowska 1, 3, Paolo G. V. Martini 1, Jennifer Jackson 1, and Deanne M. Taylor 1,2 1 Systems Biology

More information

Tutorial: RMA Analysis using the Microarray Platform Website

Tutorial: RMA Analysis using the Microarray Platform Website Tutorial: RMA Analysis using the Microarray Platform Website I Overview Objective of Tutorial This tutorial provides an introduction to data analysis using a data processing method known as RMA (Robust

More information

mrna and mirna Data Analysis in Partek Genomics Suite

mrna and mirna Data Analysis in Partek Genomics Suite mrna and mirna Data Analysis in Partek Genomics Suite HANDS-ON TRAINING University of Minnesota May2014 Xiaowen Wang Field Application Specialist Partek Incorporated Contents Partek Main Dialog....3 mirna

More information

Gene expression: Microarray data analysis

Gene expression: Microarray data analysis Gene expression: Microarray data analysis Compare gene expression in this cell type after viral infection relative to a knockout in samples from patients after drug treatment at a later developmental time

More information

Software and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University

Software and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University Software and Methods for the Analysis of Affymetrix GeneChip Data Rafael A Irizarry Department of Biostatistics Johns Hopkins University Outline Overview Bioconductor Project Examples 1: Gene Annotation

More information

DNA Microarray Bioinformatics

DNA Microarray Bioinformatics DNA Microarray Bioinformatics Course #27611 Project It s not just the genes we have It s how we use them Jeppe Skytte Spicker Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6 K GlnR C1 C4 C7 Course

More information

A Graphical Users Interface to Normalize Microarray Data

A Graphical Users Interface to Normalize Microarray Data DSC 2003 Working Papers (Draft Versions) http://www.ci.tuwien.ac.at/conferences/dsc-2003/ A Graphical Users Interface to Normalize Microarray Data Fatima Sanchez Cabo, Zlatko Trajanoski, Kwang-Hyun Cho

More information

Statistical issues in the analysis of microarray data

Statistical issues in the analysis of microarray data Statistical issues in the analysis of microarray data Daniel Gerhard Institute of Biostatistics Leibniz University of Hannover ESNATS Summerschool, Zermatt D. Gerhard (LUH) Analysis of microarray data

More information

2004/4/28. Microarray Data Analysis

2004/4/28. Microarray Data Analysis 2004/4/28 Microarray Data Analysis Outlines Overview of Microarray Data Analysis Preprocessing: Image Processing, Normalization Finding Differentially Expressed Genes Fold Changes Method Inferential Statistics

More information

Quality Assessment of Exon and Gene Arrays

Quality Assessment of Exon and Gene Arrays Quality Assessment of Exon and Gene Arrays I. Introduction In this white paper we describe some quality assessment procedures that are computed from CEL files from Whole Transcript (WT) based arrays such

More information

Introduction to The Analysis of Microarray Data by dchip

Introduction to The Analysis of Microarray Data by dchip Introduction to The Analysis of Microarray Data by dchip Guide for the First Use of The Program Dana Farber Cancer Institute Microarray Core Facility Outline Low Level Analysis Normalization Calculation

More information

Hypothesis Testing. Wolfgang Huber, Bernd Klaus, EMBL

Hypothesis Testing. Wolfgang Huber, Bernd Klaus, EMBL Hypothesis Testing Wolfgang Huber, Bernd Klaus, EMBL Karl Popper (1902-1994) Logical asymmetry between verification and falsifiability. No number of positive outcomes at the level of experimental testing

More information

Real-Time Quantitative PCR Data Analysis

Real-Time Quantitative PCR Data Analysis Real-Time Quantitative PCR Data Analysis Josep Lluís Mosquera UNITAT D ESTADÍSTICA I BIOINFORMÀTICA OUTLINE Recapitulation Normalization Absolute Quantification Relative Quantification Data Analysis Pipeline

More information

Introduction to Quantitative Research Analysis and SPSS. SW242 Session 6 Slides

Introduction to Quantitative Research Analysis and SPSS. SW242 Session 6 Slides Introduction to Quantitative Research Analysis and SPSS SW242 Session 6 Slides 2 Creation & Description of a Data Set Ø Four Levels of Measurement Nominal, ordinal, interval, ratio Ø Variable Types Independent

More information

Microarray technology

Microarray technology 07 Microarray Microarray technology Data acquisition Image processing Data analysis alessandro bogliolo isti information science and technology institute 1/17 Microarray technology Array Type Spot Density

More information

Microarray analysis at a glance from low-level data processing to data analysis

Microarray analysis at a glance from low-level data processing to data analysis Microarray analysis at a glance from low-level data processing to data analysis Olga Troyanskaya Many of the slides about SMD borrowed/modified from Gavin Sherlock et al. (Stanford) Admin Slides, readings,

More information

KTH Microarray Center

KTH Microarray Center KTH Microarray Center School of Biotechnology KTH - Royal Institute of Technology Gene Expression Service Revised January 2008 1 Contents Introduction... 3 Gene Expression Service... 3 Preparing and sending

More information

Statistical analysis of microarray data: a Bayesian approach

Statistical analysis of microarray data: a Bayesian approach Biostatistics (003), 4, 4,pp. 597 60 Printed in Great Britain Statistical analysis of microarray data: a Bayesian approach RAPHAEL GTTARD University of Washington, Department of Statistics, Box 3543, Seattle,

More information

BIOINFORMATICS. Faster cyclic loess: normalizing RNA arrays via linear models. Karla V. Ballman, Diane E. Grill, Ann L. Oberg and Terry M.

BIOINFORMATICS. Faster cyclic loess: normalizing RNA arrays via linear models. Karla V. Ballman, Diane E. Grill, Ann L. Oberg and Terry M. BIOINFORMATICS Vol. 0 no. 16 004, pages 778 786 doi:10.1093/bioinformatics/bth37 Faster cyclic loess: normalizing RNA arrays via linear models Karla V. Ballman, Diane E. Grill, Ann L. Oberg and Terry M.

More information

Service courses for graduate students in degree programs other than the MS or PhD programs in Biostatistics.

Service courses for graduate students in degree programs other than the MS or PhD programs in Biostatistics. Course Catalog In order to be assured that all prerequisites are met, students must acquire a permission number from the education coordinator prior to enrolling in any Biostatistics course. Courses are

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Row Quantile Normalisation of Microarrays

Row Quantile Normalisation of Microarrays Row Quantile Normalisation of Microarrays W. B. Langdon Departments of Mathematical Sciences and Biological Sciences University of Essex, CO4 3SQ Technical Report CES-484 ISSN: 1744-8050 23 June 2008 Abstract

More information