Experiment 2: DNA fingerprinting for microbial source tracking

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Experiment 2: DNA fingerprinting for microbial source tracking"

Transcription

1 Experiment 2: DNA fingerprinting for microbial source tracking Goal: To fingerprint strains of E. coli, and determine the source, as best as possible, for each of the strains. Introduction The Clean Water Act, as well as common sense, requires that bodies of water maintain a certain standard of purity, that standard depending on the use of the water. Much of the potential pollution is controlled at point sources, which are defined as any kind of discernable pipe or ditch, and are regulated by law. However, many bodies of water still fail to meet CWA standards due to high levels of contamination by fecal bacteria. Fecal contamination is considered to be one of the most difficult challenges facing environmental scientists trying to protect water for drinking, recreation or other uses, because it does not enter at point sources. Until very recently, it has been impossible to identify the nonpoint sources of microbial pollution. Fortunately, recently developed molecular techniques have made that possible. Several methods have been used some are phenotype-based, such as antimicrobial resistance profiles, and some are genotype based, including restriction fingerprinting and PCR-based fingerprinting techniques. This work has led to the development of Microbial Source Tracking (MST) to locate and identify sources of contamination. MST relies on the fact that E. coli and other bacteria reproduce clonally. This means that all cells from a single source can be expected to be genetically nearly identical to each other, but genetically different from cells from other sources. In addition, clones (strains) of E. coli are restricted to certain hosts to which they are highly adapted. Those adapted strains reside within the host species for long periods of time, passing from parent to offspring, and are shed constantly. Once identified, those resident strains can be reliably assigned to their respective hosts. Individual clones can also be recognized when they are collected at different sites, making it possible to track them upstream to their source. We will be trying PCR-based fingerprinting methods developed by Versalovic et al (1994) and de Bruijn (1992). Both methods are called rep-pcr because they use PCR to amplify repetitive regions of the cells DNA. Some examples of repetitive regions include: duplicated genes, interspersed repetitive extragenic palindromes (REP; extragenic means they are outside of the coding genes), enterobacterial repetitive intergenic consensus (ERIC) sequences (found between genes of enteric bacteria), and the BOX element. The location of the repetitive sequences within the genome is highly variable between strains of the same 11

2 species. When primers that are complimentary to the repetitive sequences are used in PCR, multiple regions are amplified, each representing a different genomic region located between two repetitive regions. Separation of the bands by electrophoresis on an agarose gel yields patterns that are unique for each strain of bacterium. Representative image of REP-PCR gel of a Bacillus sp., showing the differences between different strains within the species. Fingerprinting is considered to be a Library Dependent Method for identification of bacterial strains. This means that, for any watershed, E. coli strains must be isolated from suspected fecal sources, such as feedlots or water treatment facilities, and characterized, to compile a database of local strains. Then, when strains from different sites are fingerprinted, those fingerprints are identified by comparing them to the ones in the library. It is obvious, then, that development of an adequate library is the first step in microbial source tracking. 12

3 Overview of Experiment 2 In this experiment we will be fingerprinting E. coli strains that were (hypothetically) collected at four different sites in a single watershed. Each team will have four E. coli cultures that represent the E. coli population at the site. Each strain will be subjected to two PCR fingerprinting reactions one using the BOX A1R primer that is complimentary to a region in the BOX element, and one using forward and reverse ERIC primers that are complimentary to the enterobacterial repetitive intergenic consensus (ERIC) sequences. Both of these reactions should give good fingerprints, but we may find that one is more useful than the other. We (the instructors) have sampled four sites in a single watershed (see map on page 16), and isolated E. coli from the water. Your team will receive four of the strains from one site. Your job, as a class, is to fingerprint all of the strains, and determine the source, as best as possible, for each of the strains. Procedure 1. Centrifuge your E. coli tubes at maximum speed for 1 min to collect cells at the bottom of the tube. Pour off supernatant carefully. Add 500 µl of sterile dh 2 O. Mix cells with pipette or vortex. Centrifuge again, and again pour off supernatant. Resuspend cells in 200 µl dh 2 O. Keep cells on ice. 2. Prepare PCR master mixes in 1.5 ml tubes, on ice, as follows: For BOX-PCR For ERIC-PCR Sterile dh 2 O 116 µl Sterile dh 2 O 116 µl Buffer (5X) 55 µl Buffer 55 µl DMSO 13.8 µl DMSO 13.8 µl BOX primer (10 µm) 14.3 µl ERIC-f primer 7.2 µl dntps (4 mm) 27.5 µl ERIC-r primer 7.2 µl BSA (1 mg/ml) 22 µl dntps 27.5 µl Taq polymerase 4.4 µl BSA 22 µl Taq polymerase 4.4 µl Briefly vortex the tubes to mix ingredients, then spin for one or two seconds. 3. Arrange ten tubes on your rack, in two sets of five. Label the tubes as best you can with team number and tube number. Keep the rack on ice. 13

4 4. Add 46 µl of BOX master mix to five of the tubes, and 46 µl of ERIC master mix to the other five tubes. Record on paper which tube will contain which sample, and whether it s BOX- or ERIC-PCR. The fifth tube in each set is for the negative controls. 5. Resuspend E. coli cells if necessary. For each sample, add 4 µl of cell suspension to the appropriately labeled BOX-PCR tube and the appropriately labeled ERIC-PCR tube. Add 4 µl sterile dh 2 O to last tubes. Close all caps. 6. Spin the tubes briefly to remove any air bubbles, then place in the PCR machine. The parameters for this PCR are: 95 C 7 min 35 cycles of 94 C 1 min 52 C 1 min 65 C 8 min 65 C 8 min It will take nearly 7 hours for the reaction to be completed. 6. Make the agarose gel. We will use a 1.5% gel to separate the bands. 7. When the PCR is done, add 10 µl of loading dye to each tube, and pipette up and down to mix. Load 50 µl of sample per well. Run at 120 V for 45 min. Stain with methylene blue as before. 14

5 Results and data analysis 1. Compare the fingerprints of your four strains. Are they all alike? How many different strains did you find? 2. Next, compare your fingerprints to those of the other teams. Are any of your strains found in other samples? 3. On the map, indicate where each strain is found. Can you hypothesize which strains may be cattle-related? Bird-related? Which strains might be adapted to human intestines? 4. Where would you be most interested in sampling next? 15

6 Split Rock Creek Watershed Site A: Cattle Ranch Site B: Wildlife Conservation Area Site D: Boat Launch Site C: Town of Splitrock 16

7 Primer sequences Box elements (from Koeuth et al, 1995) BOX A1R CTACGGCAAGGCGACGCTGACG ERIC sequences (from Versalovic et al, 1991) ERIC2 AAGTAAGTGACTGGGGTGAGCG ERIC1R ATGTAAGCTCCTGGGGATTCAC PCR master mix, per 50 µl reaction Sterile dh 2 O 21.1 µl Buffer (5X) 10.0 µl DMSO 2.5 µl Primer (10 µm) 2.6 µl (or 1.3 µl each forward and reverse primer) dntps (4 mm) 5.0 µl BSA (1 mg/ml) 4.0 µl Taq polymerase 0.8 µl Cell suspension 4.0 µl 50 µl References de Bruijn, F.J Use of repetitive (repetitive extragenic palindromic and enterobacterial repetitive intergenic consensus) sequences and the polymerase chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria. Applied and Environmental Microbiology 58: Dombek, P.E., L.K. Johnson, S.T. Zimmerley and M.J. Sadowsky Use of repetitive DNA sequences and the PCR to differentiate Escherichia coli isolates from human and animal sources. Applied and Environmental Microbiology 66: Koeuth, T., J. Versalovic and J.R. Lupski Differential sequence conservation of interspersed repetitive Streptococcus pneumoniae BOX elements in diverse bacteria. Genome Research 5:

8 Versalovic J., T. Koeuth and J.R. Lupski Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Research 19: Versalovic, J., M. Schneider, F.J. debruijn and J.R. Lupski Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods in Molecular and Cellular Biology 5:

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Experiment 1: Determining the presence of E. coli and H. pylori in water samples, using PCR

Experiment 1: Determining the presence of E. coli and H. pylori in water samples, using PCR Experiment 1: Determining the presence of E. coli and H. pylori in water samples, using PCR Goal: To sample water for the presence of E. coli, Shiga toxin-producing strains of E. coli, and Helicobacter

More information

E. coli Bacterial Source Tracking in Texas

E. coli Bacterial Source Tracking in Texas E. coli Bacterial Source Tracking in Texas George D. Di Giovanni, Ph.D. Associate Professor, Environmental Microbiology Texas A&M Agricultural Research and Extension Center, El Paso Acknowledgments Co-Principal

More information

Isolation and Electrophoresis of Plasmid DNA

Isolation and Electrophoresis of Plasmid DNA Name Date Isolation and Electrophoresis of Plasmid DNA Prior to lab you should be able to: o Explain what cloning a gene accomplishes for a geneticist. o Describe what a plasmid is. o Describe the function

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

Exercise 5: Detection of a Human Alu Element by PCR

Exercise 5: Detection of a Human Alu Element by PCR Exercise 5: Detection of a Human Alu Element by PCR (adapted from Dolan DNA Learning Center, Cold Spring Harbor Laboratory, NY and Science Outreach, Washington University, St. Louis, MO) Background Information

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) jmvizcaino@vet.ucm.es Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #6 NAME DATE HOUR RECOMBINANT DNA GENETIC ENGINEERING Molecular Genetics Activity #6 page 1 GENETIC ENGINEERING Molecular Genetics Activity #6 page 2 PART I: PRODUCING

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

Use of Bacterial Source Tracking to Characterize Texas Watersheds

Use of Bacterial Source Tracking to Characterize Texas Watersheds Use of Bacterial Source Tracking to Characterize Texas Watersheds Kevin Wagner 1, George Di Giovanni 2, Terry Gentry 3, Elizabeth Casarez 2, Emily Martin 3 1 Texas Water Resources Institute; 2 University

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet PCR Pre-Lab (pg. 1-3) PCR Pre-Lab Answers (pg. 4-7) RNAi Pre-Lab (pg. 8) RNAi Pre-Lab Answers (pg. 9-10 Gel Electrophoresis Worksheet (pg.

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

DNA Isolation Kit for Cells and Tissues

DNA Isolation Kit for Cells and Tissues DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency

More information

Crime Scenes and Genes

Crime Scenes and Genes Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)

More information

Biotechnology. Biotechnology s Laboratories. Lab Name Location Person in Charge Programs Served Courses Served. Biotechnology Department

Biotechnology. Biotechnology s Laboratories. Lab Name Location Person in Charge Programs Served Courses Served. Biotechnology Department Biotechnology s oratories Biotechnology Name Location Person in Charge Programs Served Courses Served General Biology W12-039 Zahra Yassin General Microbiology M12-132 Aisha Echtibi General (Basic Course)

More information

LAB 16 HUMAN DNA TYPING USING POLYMERASE CHAIN REACTION (PCR)

LAB 16 HUMAN DNA TYPING USING POLYMERASE CHAIN REACTION (PCR) LAB 16 HUMAN DNA TYPING USING PCR LAB 16 HUMAN DNA TYPING USING POLYMERASE CHAIN REACTION (PCR) STUDENT GUIDE GOAL The goal of this lab is to use polymerase chain reaction (PCR) to compare a human DNA

More information

Lab 5: DNA Fingerprinting

Lab 5: DNA Fingerprinting Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the

More information

Quick Guide Lesson 1 Cheek Cell DNA Template Preparation

Quick Guide Lesson 1 Cheek Cell DNA Template Preparation Quick Guide Lesson 1 Cheek Cell DNA Template Preparation 1. Label one 1.5 ml micro test tube with your initials. Label one screwcap tube containing 200 µl of InstaGene matrix with your initials. 2. Obtain

More information

CLONING IN ESCHERICHIA COLI

CLONING IN ESCHERICHIA COLI CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

UltraClean Soil DNA Isolation Kit

UltraClean Soil DNA Isolation Kit PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction

More information

Fecal Source Tracking in Iowa

Fecal Source Tracking in Iowa January 2004 Water Fact Sheet 2004-1 Fecal Source Tracking in Iowa Elevated fecal indicator bacteria levels in Iowa s surface waters are of concern to recreational users because these bacteria indicate

More information

The Effects of Plasmid on Genotype and Phenotype (Revised 1/31/96) Introduction

The Effects of Plasmid on Genotype and Phenotype (Revised 1/31/96) Introduction The Effects of Plasmid on Genotype and Phenotype (Revised 1/31/96) Introduction Plasmids are small circular DNA molecules that often found in bacteria in addition to the large circular DNA molecule of

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript

More information

3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD)

3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) 3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) - 1 R 3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) enibacterium salmoninarum infections can occur at any life stage in salmonid

More information

Legionella pneumophila Detection Kit (Real-Time)

Legionella pneumophila Detection Kit (Real-Time) Unzipping Genes P r o d u c t I n f o r m a t i o n MBPCR028 Legionella pneumophila Detection Kit (Real-Time) Description: Legionella pneumophila is a gram-negative, non-encapsulated, aerobic bacillus

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Transformation Protocol

Transformation Protocol To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic

More information

GEL ELECTROPHORESIS OF PLASMID DNA

GEL ELECTROPHORESIS OF PLASMID DNA Purpose: In this lab you will determine the size of a circular piece of bacterial DNA (a plasmid) by cutting it into smaller pieces with enzymes and finding the size of the pieces using agarose gel electrophoresis.

More information

QuickClean 96-Well Plasmid Miniprep Kit

QuickClean 96-Well Plasmid Miniprep Kit QuickClean 96-Well Plasmid Miniprep Kit L00237 Technical Manual No. TM 0231 Version 0712007 I Description.. 1 II Kit Contents.. 1 III Applications 2 IV Key Features.. 2 V Storage.. 2 VI Plasmid Miniprep

More information

Biotechnology. Selective breeding Use of microbes (bacteria & yeast)

Biotechnology. Selective breeding Use of microbes (bacteria & yeast) Biotechnology bio and technology The use of living organisms to solve problems or make useful products. Biotechnology has been practiced for the last 10,000 years. Selective breeding Use of microbes (bacteria

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Denaturing Gradient Gel Electrophoresis (DGGE)

Denaturing Gradient Gel Electrophoresis (DGGE) Craig Tepper 9/10 Modified from Laboratory of Microbial Ecology, University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background Information Denaturing gradient gel electrophoresis (DGGE)

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Denaturing Gradient Gel Electrophoresis (DGGE)

Denaturing Gradient Gel Electrophoresis (DGGE) Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient

More information

Cloning GFP into Mammalian cells

Cloning GFP into Mammalian cells Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period Chapter 20: Biotechnology The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult

More information

AxyPrep Blood Genomic DNA Miniprep Kit

AxyPrep Blood Genomic DNA Miniprep Kit AxyPrep Blood Genomic DNA Miniprep Kit For the purification of genomic DNA from whole blood Kit contents, storage and stability Cat. No. AP-MN-BL-GDNA-50 AP-MN-BL-GDNA-250 Kit size 50 preps 250 preps Miniprep

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure TCB No. 2011-007 May 2013 Technical Bulletin GS FLX and GS Junior Systems Short Fragment Removal for the Amplicon Library Preparation Procedure Introduction Some library preparation methods may result

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

LAB 11 PLASMID DNA MINIPREP

LAB 11 PLASMID DNA MINIPREP LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

E.Z.N.A. Plant Seed Direct PCR Kit

E.Z.N.A. Plant Seed Direct PCR Kit E.Z.N.A. Plant Seed Direct PCR Kit TQ2900-00 TQ2900-01 20 preps 100 preps June 2013 E.Z.N.A. Plant Seed Direct PCR Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3 Suggested

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Plasmid showing the operon for ampicilin resistance (ori) and the gene for ampicillin resistance (amp R )

Plasmid showing the operon for ampicilin resistance (ori) and the gene for ampicillin resistance (amp R ) AP Biology Name AP Lab 8: Biotechnology (Bacterial Transformation) The bacterium Escherichia coli (E. coli) is a common inhabitant of the human colon and can be easily grown in inexpensive suspension culture.

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Super One-step RT-PCR Kit for Virus Detection

Super One-step RT-PCR Kit for Virus Detection Super One-step RT-PCR Kit for Virus Detection For fast and sensitive one-step RT-PCR with highly specificity www.tiangen.com/en SD121221 Super One-step RT-PCR Kit Kit Contents Contents Cat. no. SD103 SD103

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Genetic Transformation Part 1

Genetic Transformation Part 1 Genetic Transformation Part 1 The beginning of an exploration of genetic transformation and the influence of environment on gene expression. * CONTENTS 1 Objectives... 1 1.1 Experimental Goal... 1 1.2

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells DNA CLONING DNA CLONING: amplification of unique DNA molecules In vitro-pcr In vivo-in different host cells POLYMERASE CHAIN REACTION (PCR) PCR THE POLYMERASE CHAIN REACTION (PCR) PROVIDES AN EXTREMELY

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Procedure for RNA isolation from human muscle or fat

Procedure for RNA isolation from human muscle or fat Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe

More information

Transformation 1. Introduction: 221 Lab Manual.KCBurke

Transformation 1. Introduction: 221 Lab Manual.KCBurke Transformation 1 http://www.cdc.gov/drugresistance/about.html Antibiotic resistance is a critical problem in healthcare today. How do bacteria become resistant to antibiotics? In this lab we will focus

More information

PTC DNA Fingerprint Gel

PTC DNA Fingerprint Gel BIO 141 PTC DNA Fingerprint Analysis (Modified 3/14) PTC DNA Fingerprint Gel taster non- non- non- non- 100 bp taster taster taster taster taster taster taster ladder Tt tt Tt TT tt tt Tt tt 500 bp 300

More information

Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction

Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction Bio 3A Lab: DNA Isolation and the Polymerase Chain Reaction Objectives Understand the process of DNA isolation Perform DNA isolation using cheek cells Use thermal cycler and Taq polymerase to perform DNA

More information

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information