Effect of maternal nutrition on fetal adipocyte development 1. Department of Animal and Range Sciences, South Dakota State University BEEF

Transcription

1 Effect of mternl nutrition on fetl dipocyte development 1 T. D. Jennings 2, K. R. Underwood 3, A. E. Wertz Lutz 4, nd A. D. Wever 3 Deprtment of Animl nd Rnge Sciences, South Dkot Stte University BEEF SUMMARY The ojective of this experiment ws to determine the effects of mternl nutrition on the expression of genes in fetl tissues. Genes of interest were selected ecuse ech hs een demonstrted previously to influence ody composition. Twenty two Angus cross red heifers (BW = 1161 ± 19 ls) rndomly were ssigned to three dietry tretments. Mternl dietry tretments were formulted nd intke ws controlled to provide 150% (HIGH), 100% (INT), nd 80% (LOW) of mintennce energy requirements for growing pregnnt Angus heifers (NRC, 2000). Heifers were on dietry tretment from d 85 to d 180 of gesttion, t which point fetuses were removed vi cesren section nd muscle, sucutneous ft, nd liver smples were collected. At tril initition dm BW ws similr etween tretment groups. Dm BW differed (P = 0.002) t the end of the tretment period s result of dietry tretment. Finl BW ws lowest for the LOW dms, intermedite for INT dms, nd highest for HIGH dms. Both rift thickness nd rieye re were incresed in the HIGH tretment group compred with LOW nd INT dms (P < 0.05). Thus, dm growth ws influenced y diet during tretment period. Dietry tretment did not influence fetl weight, crown rump length, liver weight, or right hind leg weight of the fetus. Reltive gene expression for predipocyte fctor 1 ws more highly expressed (P < 0.05) in HIGH heifers s compred with INT nd LOW heifers. These preliminry results suggest tht fetl growth chrcteristics re not ffected y mnipultion of mternl nutrition during mid gesttion in eef cows. However, gene expression differences could potentilly led to differences in composition of growth, nd wrrnts further investigtion. INTRODUCTION Vlue dded eef progrms such s Certified Angus Beef, Sterling Silver, nd Certified Hereford Beef ring incresed revenue to livestock producers. However, the ntgonistic reltionship of input cost nd livestock prices often offset potentil profit. Identifying methods to gin premiums pid y vlue dded progrms would help ese the finncil urden of eef production. Rpid growth of the io fuel industry over recent yers hs contriuted to incresed cost of finishing cttle. The smll improvement in mrling score chieved y extending dys on feed will not offset the current price of prolonged feeding. Therefore, lterntive mens tht llow cttle to rech their genetic potentil must e identified. Insted of plcing emphsis the finishing phse to improve qulity grdes, one possile method would e to lter the nutrition sttus of the dm. 1 This project ws funded y the South Dkot Beef Industry Council nd the South Dkot Agriculturl Experiment Sttion. 2 Grdute student. 3 Assistnt professor. 4 Associte professor. 64

2 Most reserch regrding the influence of nutrition on mrling focuses on postntl growth. However, severl studies with sheep, humns, nd rts hve reported dipose tissue in the fetus cn e mnipulted y mternl nutrition (Clrke et l., 1998; Bisphm et l., 2003; Singhl et l., 2003; Ford et l., 2007). Recent reserch in sheep indictes tht mternl nutrition during gesttion influences intrmusculr dipocyte development of the fetuses (Tong et l., 2008). Therefore, it my e possile to influence intrmusculr dipocyte development in cttle through mnipultion of mternl nutrition during gesttion. A predipocyte is n undifferentited dipocyte. Predipocyte fctor 1 (pref 1) is present in predipocyte cell memrnes nd is highly expressed in undifferentited predipocytes tht re not yet cple of depositing ft. Yet, the expression of pref 1 is sent in mture dipocytes. Sul et l., (2000) proposed tht pref 1 ppers to e produced y predipocytes nd prevents differentition to mture dipocytes. Therefore, incresed expression of pref 1 could e used to identify predipocytes in fetl tissues. Consumers hve shown willingness to py for higher qulity, more flvorful, nd juicier eef (Pltter et l., 2005). Unfortuntely, the mjority of new post ntl dipose tissue is primrily relegted to sucutneous ft, sem ft, nd viscerl ft, which ll hve negtive effects on yield grde (Fust et l., 1978; Miller et l., 1984; Vlet et l., 2002). Proper nutrient mngement during fetl development my llow for increses in intrmusculr ft without decresing cutility. Studying the response of nutrient restriction nd over feeding during mid to lte gesttion could identify feeding methods to improve mrling. It ws hypothesized tht fetuses from overfed eef cows will hve incresed intrmusculr dipose development. The ojective of this experiment ws to oserve the effect tht positive nd negtive mternl nutrient sttus hve on gene expression responsile for differentition of fetl dipocytes. MATERIALS AND METHODS Forty five Angus crossred heifers of similr genetic ckground were rtificilly inseminted using sexed (femle selected) semen from single Angus ull to remove potentil effects of genetics nd sex. All procedures were pproved y the SDSU Animl Cre nd Use Committee, nd cesren sections were performed y the university veterinrin. Heifers were synchronized nd inseminted within the sme week. Before rtificil insemintion, sucutneous ft thickness ws mesured etween the 12 th nd 13 th ris t the three qurter position of the Longissimus muscle (LM) using n Alok 500V rel time ultrsound mchine (Alok, Wllingford, CT) to estlish initil ft thickness (FT). Body condition score (BCS) for ech heifer ws determined. Heifers received common diet until reeding, nd throughout erly gesttion (d 85). Mngement of heifers ws conducted t remote site pretretment. Pregnncy sttus ws evluted t d 44 of gesttion, nd 23 heifers were determined to e pregnnt. Heifers were trnsported to the South Dkot Stte University (SDSU), nd red heifers (n = 23) were ssigned rndomly to dietry tretment on d 85 of gesttion. During tretment heifers were housed t the SDSU feedlot. Dietry tretment groups were: low (n = 8; LOW; 1152 ± 32 l of initil BW), intermedite (n = 7; INT; 1180 ± 34 l of initil BW), nd high (n = 8; HIGH; 1150 ± 32 l of initil BW). All dietry tretments were formulted in ccordnce to the eef cttle NRC (2000). Heifers were offered feed twice dily; diets re reported in Tle 1. The LOW, INT, nd HIGH diets were formulted nd offered t n mount to chieve 80%, 100%, nd 150% mintennce energy requirements for growing pregnnt Angus heifer. Heifers were llowed d liitum ccess to wter. Tretment diets were initited on d 85 of gesttion nd continued through d 180 of gesttion when cesren sections were performed. Body weight ws recorded t the eginning nd end of tretment period nd used to determine dm growth during tretment. Intermedite weights to 65

3 monitor growth performnce were reported t 14 d intervls. Ultrsound mesurements for FT nd rieye re (REA) were recorded 12 d prior to tretment initition nd t d 170 of gesttion to determine dm ody condition chnges during tretment. Intermedite ultrsound mesurements were recorded t 28 d intervls throughout tretment to monitor dm ody condition. Blood smples were collected from ech tretment group efore the eginning of dietry tretment (d 80), nd gin t d 130 nd 177 of gesttion. Tle 1. Dry mtter nd nutrient contents of diets Tretments Ingredients LOW INT HIGH Grss hy Whet strw Dry rolled corn Soy hulls Low supplement 5.00 High supplement Clculted nutrient composition Crude protein, % C, % P, % NEg, Mcl/ l NEm, Mcl/ l TDN, % % Dry mtter sis. Provided vitmins nd minerls to meet nutrient requirements (Beef NRC, 2000). Tle 2. % Dry mtter intke nd composition Item LOW INT HIGH DMI, l/d NE m intke, Mcl/d % NE m req CP intke, l/d MP intke, l/d % MP req c NE m intke expressed s percentge of requirement predicted y Beef NRC, Predicted sed on degrdility of protein sources included in the diet. c MP requirement predicted using the eqution 3.8 x BW(kg) 0.75 MP intke then ws expressed s percentge of MP requirement. Twenty three heifers were used t tril initition; however one heifer orted t pproximtely d 164 of gesttion. Therefore, twenty two (n = 22) heifers received stnding left side cesren section, on d 179, 180, or 181 of gesttion. Anesthesi ws performed y field lock infusion of the proposed incision site in line lock pttern using ml of 2% lidocine to desensitize the incision site. This ws comined with either low cudl epidurl mg xylzine comined with 3 5 ml of 2% 66

4 lidocine, or n intrvenous sedtion/nlgesi with xylzine ( mg/100 l BW)/Liqumycin Torugesic (0.8 1ml). Bnmine (2 ml/100 l BW) ws given IV in the jugulr vein nd LA 200 ws given IV (4.5 ml/100 l BW) in the jugulr vein for post surgicl mngement. Heifers were oserved twice dily for two weeks following surgery for infection, loss of ppetite, nd to insure pssing of plcent. Fetl lood smples from the umilicl vein nd hert were collected into K 3 EDTA vcutiner tues, nd stored on ice until processing. Fetl BW nd crown rump length were recorded nd following lood smple collection ech fetus ws exsnguinted y the umilicl vein. Smples from the LM were collected from the left nd right sides of the fetus y peeling ck the hide nd removing 1 inch section of tissue on ech side of the 13 th ri; muscle nd ny visile sucutneous ft locted over the LM were quickly diced, nd snp frozen in liquid nitrogen. Brisket ft, udder ft nd liver smples lso were removed, nd snp frozen in liquid nitrogen. All fetl tissue smples were processed nd frozen within 25 minutes of removl from the dm. Rel Time PCR TRI Regent RT RNA, DNA, protein isoltion regent (Moleculr Reserch Center, Inc. Cincinnti, OH) ws used to extrct mrna from fetl LM smples. Muscle smples were powdered using mortr, pestle, nd liquid nitrogen. Approximtely 100 mg of powdered muscle ws plced into 1 ml of TRI Regent RT. DNse I, Amplifiction Grde kit (Invitrogen, Roche Moleculr Systems, Inc., Foster City, Cliforni) ws used to remove genomic DNA contmintion, nd to dilute the RNA concentrtion (200 ng/µl). A high cpcity cdna reverse trnscription kit (Applied Biosystems, Crlsd, CA) converted RNA to cdna. A Bio Rd MyCycler Thermocycler (Bio Rd Lortories, Hercules, CA) ws reverse trnscried ccording to mnufcturer s instructions. Rel time quntittive PCR nlysis using reverse trnscried cdna ws performed with SYBR Green RT PCR kit from Bio Rd. Primer sets re indicted in Tle 3. Fold chnge ws clculted y REST 2008 (Reltive Expression Softwre Tool V2.0.07, Corett Reserch Pty, Ltd., Sydney, Austrli). REST 2008 incorportes RT PCR rection efficiencies, reference gene normliztion, nd cycle thresholds vlues to determine sttisticl differences etween tretment smples nd controls. Tle 3. Primer sequence for genes of interest Gene Primer sequence Anneling temperture Pref 1 forwrd 5' TGTTGCGCAAGAAGAAGAACCTGC 3' 60 C reverse 5' AAGAACAGACCGCACAGAGAGACA 3' 60 C PPIA forwrd 5' CATGCCCTCTTTCACCTTGCCAAA 3' 60 C reverse 5' AGCATACAGGTCCTGGCATCTTGT 3' 60 C Pref 1 = predipocyte fctor 1, PPIA = peptidylprolyl isomerse A. Blood Smples nd Anlysis Blood smples from the hert nd umilicl cord were centrifuged t 1,100 x g t 4 C for 30 minutes. Plsm ws seprted into 1 ml liquots nd frozen for susequent nlysis of leptin, ghrelin, insulin, growth hormone, nd non esterified ftty cid concentrtion. To prevent protein degrdtion, the 1 ml liquot designted for ghrelin ws cidified with 50 μl of 1 N HCl nd treted with 10 µl of 10mg/mL solution of phenylmethylsulfonyl fluoride (Sigm, St. Louis, MO). 67

5 Dm performnce nd fetl growth chrcteristics were nlyzed using the GLM procedure of SAS (SAS Inst. Inc., Cry, NC) with dietry tretment group s the min effect. Dry mtter intke ws clculted using pen s the experimentl unit. Lest squre mens were used to seprte differences in tretment mens tht resulted from dietry tretment. Rel time PCR gene expression dt were nlyzed using REST 2008 (Corett Reserch Pty, Ltd., Sydney, Austrli) to clculte fold chnge difference etween LOW, HIGH, nd INT which served s the control. Dm Growth Performnce RESULTS Initil BW ws similr etween tretment groups. Totl BW gin, ADG for dms during the tretment period nd finl dm BW ws gretest (P < 0.05) in the HIGH heifers, intermedite for INT heifers, nd lowest for LOW heifers (Tle 4). Heifers in the LOW tretment groups were lighter in weight thn INT nd HIGH heifers (P < 0.05). Averge dily gins (Tle 4) for LOW, INT, nd HIGH were 0.97, 1.47, nd 1.90 l/d, respectively nd differed (P < 0.05) s result of tretment. Tle 4. Dm mesures of performnce during mid gesttion (85 to 180 d) tretment period Item LOW INT HIGH SEM P vlue Initil BW, l Finl BW, l c c ADG, l/d 0.97 c 1.47 c Totl gin, l 92.3 c c Initil FT, in e Finl FT, in e 0.21 c 0.22 c < Initil REA, in 2f Finl REA, in 2f 13.5 c 13.9 c Dietry tretment offered to dms from 85 to 180 d of gesttion; LOW 79% NE m requirement; INT 92% NE m requirement; HIGH 150% NE m requirement., c, d Mens within rows tht do not hve common superscripts differ, P < e Ultrsound mesured ft thickness (FT); Initil mesure 12 d prior to initition of dietry tretments nd finl mesured following 84 d of dietry tretment. f Ultrsound mesured rieye re; Initil mesure 12 d prior to initition of dietry tretments nd finl mesured following 84 d of dietry tretment. Dm Body Composition The tretment diets contriuted to differences in ody condition. Sucutneous ft chnged over time. Ultrsound ft thickness of HIGH heifers ws greter thn INT nd LOW heifers (P < 0.05); ut similr for INT nd LOW dms (Tle 4). In ddition, HIGH heifers hd greter finl REA thn INT nd LOW heifers (P < 0.05), which were similr. Fetl Dt Tretment did not influence fetl weight (Tle 5) which indictes tht the dm ws le to provide the necessry nutrients to the fetus. There were no differences in crown rump length, liver weight, or right hind leg weight s result of mternl nutrition during mid gesttion. 68

6 Tle 5. Mesures of fetl performnce Vrile LOW INT HIGH SEM P vlue BW, l LW, l CRL, in RLW, l BW = fetl ody weight, LW = fetl liver weight, CRL = crown rump length, RLW = right hind leg weight. Dietry tretment offered to dms from 85 to 180 d of gesttion; LOW 79% NE m requirement; INT 92% NE m requirement; HIGH 150% NE m requirement. Rel time RT PCR nlysis on fetl LM smples reveled differences in pref 1 gene expression with mnipultion of mternl nutrition. The LOW nd HIGH tretments were compred to INT, which served s the control nd its fold chnge set equls to 1.0. The HIGH diets resulted in incresed expression (P < 0.05) of pref 1 when compred with fetuses from INT nd LOW dms (Figure 1). Expression of pref Pref 1 Expression Fold Chnge LOW INT HIGH Tretment groups Figure 1. Reltive gene expression for predipocyte fctor 1 on fetl longissimus dorsi. Diets were formulted nd intke controlled to meet energy requirements t 79 (LOW), 92 (INT), nd 150 (HIGH) percent of mintennce requirements (NRC, 2000). Brs represent men tretment fold chnge. Fold chnges for LOW nd HIGH re compred to INT which serves s the control group nd equls 1.0. Brs ering different letters differ (P < 0.05). ws similr etween LOW nd INT fetuses. Higher expression of pref 1 in LM of HIGH fetuses suggests tht either greter predipocytes re present in the HIGH fetuses nd re not yet present in LOW nd 69

7 INT fetuses, or it my suggest tht differentition of predipocytes to mture dipocyte in intrmusculr dipose tissue is slowed in HIGH ecuse pref 1 inhiits predipocyte differentition. IMPLICATIONS These preliminry dt suggest tht mnipulting the mternl nutrition of eef cows in mid gesttion does not ffect the growth chrcteristics of the fetus. However, differences in gene expression wrrnt further investigtion s this could potentilly led to differences in composition of growth prticulrly intrmusculr ft deposition. LITERATURE CITED Bisphm, J., G. S. Goplkrishnn, J. Dndre, V. Wilson, H. Budge, D. H. Keisler, P. F. Broughton, T. Stephenson, nd M. E. Symonds Mternl endocrine dpttion throughout pregnncy to nutritionl mnipultion: Consequences for mternl plsm leptin nd cortisol nd the progrmming of fetl dipose tissue development. Endocrinology 144: Clrke L., L. Hesmn, D. T. Juniper, M. E. Symond Mternl nutrition in erly mid gesttion nd plcentl size in sheep. Brit. J. Nutr. 79: Fust, I. M., P. R. Johnson, J. S. Stern, nd J. Hirsch Dietinduced dipocyte numer increse in dult rts: A new model of oesity. Am. J. Physiol. 235:E279 E286. Ford, S.P., B. W. Hess, M. M. Schwope, M. J. Nijlnd, J. S. Gilert, K. A. Vonnhme, W.J. Mens, H. Hn nd P.W. Nthnielsz Mternl undernutrition during erly to mid gesttion in the ewe results in ltered growth, diposity, nd glucose tolernce in mle offspring. J. Anim. Sci. 85: NRC Nutrient Requirements of Beef Cttle. 7th rev. ed. Ntionl Acd. Press, Wshington, DC. Miller, W. H., Jr., I. M. Fust, nd J. Hirsch Demonstrtion of de novo production of dipocytes in dult rts y iochemicl nd rdioutogrphic techniques. J. Lipid Res. 25: Pltter, W. J., J. D. Ttum, K. E. Belk, S. R. Koontz, P. L. Chpmn, nd G. C. Smith Effects of mrling nd sher force on consumers willingness to py for eef strip loin steks. J. Anim. Sci. 83: Singhl, A., J. Wells, T. J. Cole, M. Fewtrell, nd A. Lucs Progrmming of len ody mss: link etween irth weight, oesity, nd crdiovsculr disese? Am. J. Clin. Nutr. 77: Sul, H.S., C. Sms, B. Mei, nd L. Zhou Function of pref 1 s n inhiitor of dipocyte differentition. Interntionl Journl of Oesity. 24, Suppl 4, S15 S19. Tong, J., M. J. Zhu, K. R. Underwood, B. W. Hess, S. P. Ford, nd M. Du Amp ctivted protein kinse nd dipogenesis in sheep fetl skeletl muscle nd 3T3 L1 cells. J. Anim. Sci. 86: Vlet, P., G. Tvernier, I. Cstn Lurell, J. S. Sulnier Blche, nd D. Lngin Understnding dipose tissue development from trnsgenic niml models. J. Lipid Res. 43: