Effect of maternal nutrition on fetal adipocyte development 1. Department of Animal and Range Sciences, South Dakota State University BEEF
|
|
- Leon Simpson
- 7 years ago
- Views:
Transcription
1 Effect of mternl nutrition on fetl dipocyte development 1 T. D. Jennings 2, K. R. Underwood 3, A. E. Wertz Lutz 4, nd A. D. Wever 3 Deprtment of Animl nd Rnge Sciences, South Dkot Stte University BEEF SUMMARY The ojective of this experiment ws to determine the effects of mternl nutrition on the expression of genes in fetl tissues. Genes of interest were selected ecuse ech hs een demonstrted previously to influence ody composition. Twenty two Angus cross red heifers (BW = 1161 ± 19 ls) rndomly were ssigned to three dietry tretments. Mternl dietry tretments were formulted nd intke ws controlled to provide 150% (HIGH), 100% (INT), nd 80% (LOW) of mintennce energy requirements for growing pregnnt Angus heifers (NRC, 2000). Heifers were on dietry tretment from d 85 to d 180 of gesttion, t which point fetuses were removed vi cesren section nd muscle, sucutneous ft, nd liver smples were collected. At tril initition dm BW ws similr etween tretment groups. Dm BW differed (P = 0.002) t the end of the tretment period s result of dietry tretment. Finl BW ws lowest for the LOW dms, intermedite for INT dms, nd highest for HIGH dms. Both rift thickness nd rieye re were incresed in the HIGH tretment group compred with LOW nd INT dms (P < 0.05). Thus, dm growth ws influenced y diet during tretment period. Dietry tretment did not influence fetl weight, crown rump length, liver weight, or right hind leg weight of the fetus. Reltive gene expression for predipocyte fctor 1 ws more highly expressed (P < 0.05) in HIGH heifers s compred with INT nd LOW heifers. These preliminry results suggest tht fetl growth chrcteristics re not ffected y mnipultion of mternl nutrition during mid gesttion in eef cows. However, gene expression differences could potentilly led to differences in composition of growth, nd wrrnts further investigtion. INTRODUCTION Vlue dded eef progrms such s Certified Angus Beef, Sterling Silver, nd Certified Hereford Beef ring incresed revenue to livestock producers. However, the ntgonistic reltionship of input cost nd livestock prices often offset potentil profit. Identifying methods to gin premiums pid y vlue dded progrms would help ese the finncil urden of eef production. Rpid growth of the io fuel industry over recent yers hs contriuted to incresed cost of finishing cttle. The smll improvement in mrling score chieved y extending dys on feed will not offset the current price of prolonged feeding. Therefore, lterntive mens tht llow cttle to rech their genetic potentil must e identified. Insted of plcing emphsis the finishing phse to improve qulity grdes, one possile method would e to lter the nutrition sttus of the dm. 1 This project ws funded y the South Dkot Beef Industry Council nd the South Dkot Agriculturl Experiment Sttion. 2 Grdute student. 3 Assistnt professor. 4 Associte professor. 64
2 Most reserch regrding the influence of nutrition on mrling focuses on postntl growth. However, severl studies with sheep, humns, nd rts hve reported dipose tissue in the fetus cn e mnipulted y mternl nutrition (Clrke et l., 1998; Bisphm et l., 2003; Singhl et l., 2003; Ford et l., 2007). Recent reserch in sheep indictes tht mternl nutrition during gesttion influences intrmusculr dipocyte development of the fetuses (Tong et l., 2008). Therefore, it my e possile to influence intrmusculr dipocyte development in cttle through mnipultion of mternl nutrition during gesttion. A predipocyte is n undifferentited dipocyte. Predipocyte fctor 1 (pref 1) is present in predipocyte cell memrnes nd is highly expressed in undifferentited predipocytes tht re not yet cple of depositing ft. Yet, the expression of pref 1 is sent in mture dipocytes. Sul et l., (2000) proposed tht pref 1 ppers to e produced y predipocytes nd prevents differentition to mture dipocytes. Therefore, incresed expression of pref 1 could e used to identify predipocytes in fetl tissues. Consumers hve shown willingness to py for higher qulity, more flvorful, nd juicier eef (Pltter et l., 2005). Unfortuntely, the mjority of new post ntl dipose tissue is primrily relegted to sucutneous ft, sem ft, nd viscerl ft, which ll hve negtive effects on yield grde (Fust et l., 1978; Miller et l., 1984; Vlet et l., 2002). Proper nutrient mngement during fetl development my llow for increses in intrmusculr ft without decresing cutility. Studying the response of nutrient restriction nd over feeding during mid to lte gesttion could identify feeding methods to improve mrling. It ws hypothesized tht fetuses from overfed eef cows will hve incresed intrmusculr dipose development. The ojective of this experiment ws to oserve the effect tht positive nd negtive mternl nutrient sttus hve on gene expression responsile for differentition of fetl dipocytes. MATERIALS AND METHODS Forty five Angus crossred heifers of similr genetic ckground were rtificilly inseminted using sexed (femle selected) semen from single Angus ull to remove potentil effects of genetics nd sex. All procedures were pproved y the SDSU Animl Cre nd Use Committee, nd cesren sections were performed y the university veterinrin. Heifers were synchronized nd inseminted within the sme week. Before rtificil insemintion, sucutneous ft thickness ws mesured etween the 12 th nd 13 th ris t the three qurter position of the Longissimus muscle (LM) using n Alok 500V rel time ultrsound mchine (Alok, Wllingford, CT) to estlish initil ft thickness (FT). Body condition score (BCS) for ech heifer ws determined. Heifers received common diet until reeding, nd throughout erly gesttion (d 85). Mngement of heifers ws conducted t remote site pretretment. Pregnncy sttus ws evluted t d 44 of gesttion, nd 23 heifers were determined to e pregnnt. Heifers were trnsported to the South Dkot Stte University (SDSU), nd red heifers (n = 23) were ssigned rndomly to dietry tretment on d 85 of gesttion. During tretment heifers were housed t the SDSU feedlot. Dietry tretment groups were: low (n = 8; LOW; 1152 ± 32 l of initil BW), intermedite (n = 7; INT; 1180 ± 34 l of initil BW), nd high (n = 8; HIGH; 1150 ± 32 l of initil BW). All dietry tretments were formulted in ccordnce to the eef cttle NRC (2000). Heifers were offered feed twice dily; diets re reported in Tle 1. The LOW, INT, nd HIGH diets were formulted nd offered t n mount to chieve 80%, 100%, nd 150% mintennce energy requirements for growing pregnnt Angus heifer. Heifers were llowed d liitum ccess to wter. Tretment diets were initited on d 85 of gesttion nd continued through d 180 of gesttion when cesren sections were performed. Body weight ws recorded t the eginning nd end of tretment period nd used to determine dm growth during tretment. Intermedite weights to 65
3 monitor growth performnce were reported t 14 d intervls. Ultrsound mesurements for FT nd rieye re (REA) were recorded 12 d prior to tretment initition nd t d 170 of gesttion to determine dm ody condition chnges during tretment. Intermedite ultrsound mesurements were recorded t 28 d intervls throughout tretment to monitor dm ody condition. Blood smples were collected from ech tretment group efore the eginning of dietry tretment (d 80), nd gin t d 130 nd 177 of gesttion. Tle 1. Dry mtter nd nutrient contents of diets Tretments Ingredients LOW INT HIGH Grss hy Whet strw Dry rolled corn Soy hulls Low supplement 5.00 High supplement Clculted nutrient composition Crude protein, % C, % P, % NEg, Mcl/ l NEm, Mcl/ l TDN, % % Dry mtter sis. Provided vitmins nd minerls to meet nutrient requirements (Beef NRC, 2000). Tle 2. % Dry mtter intke nd composition Item LOW INT HIGH DMI, l/d NE m intke, Mcl/d % NE m req CP intke, l/d MP intke, l/d % MP req c NE m intke expressed s percentge of requirement predicted y Beef NRC, Predicted sed on degrdility of protein sources included in the diet. c MP requirement predicted using the eqution 3.8 x BW(kg) 0.75 MP intke then ws expressed s percentge of MP requirement. Twenty three heifers were used t tril initition; however one heifer orted t pproximtely d 164 of gesttion. Therefore, twenty two (n = 22) heifers received stnding left side cesren section, on d 179, 180, or 181 of gesttion. Anesthesi ws performed y field lock infusion of the proposed incision site in line lock pttern using ml of 2% lidocine to desensitize the incision site. This ws comined with either low cudl epidurl mg xylzine comined with 3 5 ml of 2% 66
4 lidocine, or n intrvenous sedtion/nlgesi with xylzine ( mg/100 l BW)/Liqumycin Torugesic (0.8 1ml). Bnmine (2 ml/100 l BW) ws given IV in the jugulr vein nd LA 200 ws given IV (4.5 ml/100 l BW) in the jugulr vein for post surgicl mngement. Heifers were oserved twice dily for two weeks following surgery for infection, loss of ppetite, nd to insure pssing of plcent. Fetl lood smples from the umilicl vein nd hert were collected into K 3 EDTA vcutiner tues, nd stored on ice until processing. Fetl BW nd crown rump length were recorded nd following lood smple collection ech fetus ws exsnguinted y the umilicl vein. Smples from the LM were collected from the left nd right sides of the fetus y peeling ck the hide nd removing 1 inch section of tissue on ech side of the 13 th ri; muscle nd ny visile sucutneous ft locted over the LM were quickly diced, nd snp frozen in liquid nitrogen. Brisket ft, udder ft nd liver smples lso were removed, nd snp frozen in liquid nitrogen. All fetl tissue smples were processed nd frozen within 25 minutes of removl from the dm. Rel Time PCR TRI Regent RT RNA, DNA, protein isoltion regent (Moleculr Reserch Center, Inc. Cincinnti, OH) ws used to extrct mrna from fetl LM smples. Muscle smples were powdered using mortr, pestle, nd liquid nitrogen. Approximtely 100 mg of powdered muscle ws plced into 1 ml of TRI Regent RT. DNse I, Amplifiction Grde kit (Invitrogen, Roche Moleculr Systems, Inc., Foster City, Cliforni) ws used to remove genomic DNA contmintion, nd to dilute the RNA concentrtion (200 ng/µl). A high cpcity cdna reverse trnscription kit (Applied Biosystems, Crlsd, CA) converted RNA to cdna. A Bio Rd MyCycler Thermocycler (Bio Rd Lortories, Hercules, CA) ws reverse trnscried ccording to mnufcturer s instructions. Rel time quntittive PCR nlysis using reverse trnscried cdna ws performed with SYBR Green RT PCR kit from Bio Rd. Primer sets re indicted in Tle 3. Fold chnge ws clculted y REST 2008 (Reltive Expression Softwre Tool V2.0.07, Corett Reserch Pty, Ltd., Sydney, Austrli). REST 2008 incorportes RT PCR rection efficiencies, reference gene normliztion, nd cycle thresholds vlues to determine sttisticl differences etween tretment smples nd controls. Tle 3. Primer sequence for genes of interest Gene Primer sequence Anneling temperture Pref 1 forwrd 5' TGTTGCGCAAGAAGAAGAACCTGC 3' 60 C reverse 5' AAGAACAGACCGCACAGAGAGACA 3' 60 C PPIA forwrd 5' CATGCCCTCTTTCACCTTGCCAAA 3' 60 C reverse 5' AGCATACAGGTCCTGGCATCTTGT 3' 60 C Pref 1 = predipocyte fctor 1, PPIA = peptidylprolyl isomerse A. Blood Smples nd Anlysis Blood smples from the hert nd umilicl cord were centrifuged t 1,100 x g t 4 C for 30 minutes. Plsm ws seprted into 1 ml liquots nd frozen for susequent nlysis of leptin, ghrelin, insulin, growth hormone, nd non esterified ftty cid concentrtion. To prevent protein degrdtion, the 1 ml liquot designted for ghrelin ws cidified with 50 μl of 1 N HCl nd treted with 10 µl of 10mg/mL solution of phenylmethylsulfonyl fluoride (Sigm, St. Louis, MO). 67
5 Dm performnce nd fetl growth chrcteristics were nlyzed using the GLM procedure of SAS (SAS Inst. Inc., Cry, NC) with dietry tretment group s the min effect. Dry mtter intke ws clculted using pen s the experimentl unit. Lest squre mens were used to seprte differences in tretment mens tht resulted from dietry tretment. Rel time PCR gene expression dt were nlyzed using REST 2008 (Corett Reserch Pty, Ltd., Sydney, Austrli) to clculte fold chnge difference etween LOW, HIGH, nd INT which served s the control. Dm Growth Performnce RESULTS Initil BW ws similr etween tretment groups. Totl BW gin, ADG for dms during the tretment period nd finl dm BW ws gretest (P < 0.05) in the HIGH heifers, intermedite for INT heifers, nd lowest for LOW heifers (Tle 4). Heifers in the LOW tretment groups were lighter in weight thn INT nd HIGH heifers (P < 0.05). Averge dily gins (Tle 4) for LOW, INT, nd HIGH were 0.97, 1.47, nd 1.90 l/d, respectively nd differed (P < 0.05) s result of tretment. Tle 4. Dm mesures of performnce during mid gesttion (85 to 180 d) tretment period Item LOW INT HIGH SEM P vlue Initil BW, l Finl BW, l c c ADG, l/d 0.97 c 1.47 c Totl gin, l 92.3 c c Initil FT, in e Finl FT, in e 0.21 c 0.22 c < Initil REA, in 2f Finl REA, in 2f 13.5 c 13.9 c Dietry tretment offered to dms from 85 to 180 d of gesttion; LOW 79% NE m requirement; INT 92% NE m requirement; HIGH 150% NE m requirement., c, d Mens within rows tht do not hve common superscripts differ, P < e Ultrsound mesured ft thickness (FT); Initil mesure 12 d prior to initition of dietry tretments nd finl mesured following 84 d of dietry tretment. f Ultrsound mesured rieye re; Initil mesure 12 d prior to initition of dietry tretments nd finl mesured following 84 d of dietry tretment. Dm Body Composition The tretment diets contriuted to differences in ody condition. Sucutneous ft chnged over time. Ultrsound ft thickness of HIGH heifers ws greter thn INT nd LOW heifers (P < 0.05); ut similr for INT nd LOW dms (Tle 4). In ddition, HIGH heifers hd greter finl REA thn INT nd LOW heifers (P < 0.05), which were similr. Fetl Dt Tretment did not influence fetl weight (Tle 5) which indictes tht the dm ws le to provide the necessry nutrients to the fetus. There were no differences in crown rump length, liver weight, or right hind leg weight s result of mternl nutrition during mid gesttion. 68
6 Tle 5. Mesures of fetl performnce Vrile LOW INT HIGH SEM P vlue BW, l LW, l CRL, in RLW, l BW = fetl ody weight, LW = fetl liver weight, CRL = crown rump length, RLW = right hind leg weight. Dietry tretment offered to dms from 85 to 180 d of gesttion; LOW 79% NE m requirement; INT 92% NE m requirement; HIGH 150% NE m requirement. Rel time RT PCR nlysis on fetl LM smples reveled differences in pref 1 gene expression with mnipultion of mternl nutrition. The LOW nd HIGH tretments were compred to INT, which served s the control nd its fold chnge set equls to 1.0. The HIGH diets resulted in incresed expression (P < 0.05) of pref 1 when compred with fetuses from INT nd LOW dms (Figure 1). Expression of pref Pref 1 Expression Fold Chnge LOW INT HIGH Tretment groups Figure 1. Reltive gene expression for predipocyte fctor 1 on fetl longissimus dorsi. Diets were formulted nd intke controlled to meet energy requirements t 79 (LOW), 92 (INT), nd 150 (HIGH) percent of mintennce requirements (NRC, 2000). Brs represent men tretment fold chnge. Fold chnges for LOW nd HIGH re compred to INT which serves s the control group nd equls 1.0. Brs ering different letters differ (P < 0.05). ws similr etween LOW nd INT fetuses. Higher expression of pref 1 in LM of HIGH fetuses suggests tht either greter predipocytes re present in the HIGH fetuses nd re not yet present in LOW nd 69
7 INT fetuses, or it my suggest tht differentition of predipocytes to mture dipocyte in intrmusculr dipose tissue is slowed in HIGH ecuse pref 1 inhiits predipocyte differentition. IMPLICATIONS These preliminry dt suggest tht mnipulting the mternl nutrition of eef cows in mid gesttion does not ffect the growth chrcteristics of the fetus. However, differences in gene expression wrrnt further investigtion s this could potentilly led to differences in composition of growth prticulrly intrmusculr ft deposition. LITERATURE CITED Bisphm, J., G. S. Goplkrishnn, J. Dndre, V. Wilson, H. Budge, D. H. Keisler, P. F. Broughton, T. Stephenson, nd M. E. Symonds Mternl endocrine dpttion throughout pregnncy to nutritionl mnipultion: Consequences for mternl plsm leptin nd cortisol nd the progrmming of fetl dipose tissue development. Endocrinology 144: Clrke L., L. Hesmn, D. T. Juniper, M. E. Symond Mternl nutrition in erly mid gesttion nd plcentl size in sheep. Brit. J. Nutr. 79: Fust, I. M., P. R. Johnson, J. S. Stern, nd J. Hirsch Dietinduced dipocyte numer increse in dult rts: A new model of oesity. Am. J. Physiol. 235:E279 E286. Ford, S.P., B. W. Hess, M. M. Schwope, M. J. Nijlnd, J. S. Gilert, K. A. Vonnhme, W.J. Mens, H. Hn nd P.W. Nthnielsz Mternl undernutrition during erly to mid gesttion in the ewe results in ltered growth, diposity, nd glucose tolernce in mle offspring. J. Anim. Sci. 85: NRC Nutrient Requirements of Beef Cttle. 7th rev. ed. Ntionl Acd. Press, Wshington, DC. Miller, W. H., Jr., I. M. Fust, nd J. Hirsch Demonstrtion of de novo production of dipocytes in dult rts y iochemicl nd rdioutogrphic techniques. J. Lipid Res. 25: Pltter, W. J., J. D. Ttum, K. E. Belk, S. R. Koontz, P. L. Chpmn, nd G. C. Smith Effects of mrling nd sher force on consumers willingness to py for eef strip loin steks. J. Anim. Sci. 83: Singhl, A., J. Wells, T. J. Cole, M. Fewtrell, nd A. Lucs Progrmming of len ody mss: link etween irth weight, oesity, nd crdiovsculr disese? Am. J. Clin. Nutr. 77: Sul, H.S., C. Sms, B. Mei, nd L. Zhou Function of pref 1 s n inhiitor of dipocyte differentition. Interntionl Journl of Oesity. 24, Suppl 4, S15 S19. Tong, J., M. J. Zhu, K. R. Underwood, B. W. Hess, S. P. Ford, nd M. Du Amp ctivted protein kinse nd dipogenesis in sheep fetl skeletl muscle nd 3T3 L1 cells. J. Anim. Sci. 86: Vlet, P., G. Tvernier, I. Cstn Lurell, J. S. Sulnier Blche, nd D. Lngin Understnding dipose tissue development from trnsgenic niml models. J. Lipid Res. 43:
Treatment Spring Late Summer Fall 0.10 5.56 3.85 0.61 6.97 3.01 1.91 3.01 2.13 2.99 5.33 2.50 1.06 3.53 6.10 Mean = 1.33 Mean = 4.88 Mean = 3.
The nlysis of vrince (ANOVA) Although the t-test is one of the most commonly used sttisticl hypothesis tests, it hs limittions. The mjor limittion is tht the t-test cn be used to compre the mens of only
More information2 DIODE CLIPPING and CLAMPING CIRCUITS
2 DIODE CLIPPING nd CLAMPING CIRCUITS 2.1 Ojectives Understnding the operting principle of diode clipping circuit Understnding the operting principle of clmping circuit Understnding the wveform chnge of
More informationSmall Businesses Decisions to Offer Health Insurance to Employees
Smll Businesses Decisions to Offer Helth Insurnce to Employees Ctherine McLughlin nd Adm Swinurn, June 2014 Employer-sponsored helth insurnce (ESI) is the dominnt source of coverge for nonelderly dults
More informationRate and Activation Energy of the Iodination of Acetone
nd Activtion Energ of the Iodintion of Acetone rl N. eer Dte of Eperiment: //00 Florence F. Ls (prtner) Abstrct: The rte, rte lw nd ctivtion energ of the iodintion of cetone re detered b observing the
More informationDlNBVRGH + Sickness Absence Monitoring Report. Executive of the Council. Purpose of report
DlNBVRGH + + THE CITY OF EDINBURGH COUNCIL Sickness Absence Monitoring Report Executive of the Council 8fh My 4 I.I...3 Purpose of report This report quntifies the mount of working time lost s result of
More information1. Find the zeros Find roots. Set function = 0, factor or use quadratic equation if quadratic, graph to find zeros on calculator
AP Clculus Finl Review Sheet When you see the words. This is wht you think of doing. Find the zeros Find roots. Set function =, fctor or use qudrtic eqution if qudrtic, grph to find zeros on clcultor.
More information2013 Flax Weed Control Trial
2013 Flx Weed Control Tril Dr. Hether Drby, UVM Extension Agronomist Susn Monhn, Conner Burke, Eric Cummings, nd Hnnh Hrwood UVM Extension Crops nd Soils Technicins 802-524-6501 Visit us on the web: http://www.uvm.edu/extension/cropsoil
More informationTHE EFFECTS OF INCREASED PROTEIN INTAKE ON KIDNEY SIZE AND FUNCTION
The Journl of Experimentl iology 21, 281 29 (1998) Printed in Gret ritin The Compny of iologists Limited 1998 JE1492 281 THE EFFECTS OF INCRESED PROTEIN INTKE ON KIDNEY SIZE ND FUNCTION KIMERLY. HMMOND
More informationCOVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION
COVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION Nthn S. Boyd nd Eric B. Brennn, USDA-ARS, Orgnic Reserch Progrm, 1636 E. Alisl Street, Slins, CA 93905 Astrct Weed mngement is
More informationAntibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening
Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Q. Wht re nturlly occurring or expected ntiodies? Q. Wht re typicl or unexpected
More informationUtilization of Smoking Cessation Benefits in Medicaid Managed Care, 2009-2013
Utiliztion of Smoking Cesstion Benefits in Medicid Mnged Cre, 2009-2013 Office of Qulity nd Ptient Sfety New York Stte Deprtment of Helth Jnury 2015 Introduction According to the New York Stte Tocco Control
More informationExperiment 6: Friction
Experiment 6: Friction In previous lbs we studied Newton s lws in n idel setting, tht is, one where friction nd ir resistnce were ignored. However, from our everydy experience with motion, we know tht
More informationUnit 6: Exponents and Radicals
Eponents nd Rdicls -: The Rel Numer Sstem Unit : Eponents nd Rdicls Pure Mth 0 Notes Nturl Numers (N): - counting numers. {,,,,, } Whole Numers (W): - counting numers with 0. {0,,,,,, } Integers (I): -
More informationThe Effect of Crumb Rubber Modifier (CRM) on the Performance Properties of Rubberized Binders in HMA pavements
The Effect of Crum Ruer Modifier (CRM) on the Performnce Properties of Ruerized Binders in HMA pvements Soon-Je Lee* Ph.D. Grdute Student Deprtment of Civil Engineering Clemson University Clemson, SC 29634-0911
More information** Dpt. Chemical Engineering, Kasetsart University, Bangkok 10900, Thailand
Modelling nd Simultion of hemicl Processes in Multi Pulse TP Experiment P. Phnwdee* S.O. Shekhtmn +. Jrungmnorom** J.T. Gleves ++ * Dpt. hemicl Engineering, Ksetsrt University, Bngkok 10900, Thilnd + Dpt.hemicl
More informationCS99S Laboratory 2 Preparation Copyright W. J. Dally 2001 October 1, 2001
CS99S Lortory 2 Preprtion Copyright W. J. Dlly 2 Octoer, 2 Ojectives:. Understnd the principle of sttic CMOS gte circuits 2. Build simple logic gtes from MOS trnsistors 3. Evlute these gtes to oserve logic
More informationAppendix D: Completing the Square and the Quadratic Formula. In Appendix A, two special cases of expanding brackets were considered:
Appendi D: Completing the Squre nd the Qudrtic Formul Fctoring qudrtic epressions such s: + 6 + 8 ws one of the topics introduced in Appendi C. Fctoring qudrtic epressions is useful skill tht cn help you
More informationOperations with Polynomials
38 Chpter P Prerequisites P.4 Opertions with Polynomils Wht you should lern: Write polynomils in stndrd form nd identify the leding coefficients nd degrees of polynomils Add nd subtrct polynomils Multiply
More informationMATERIALS AND METHODS Study area: This study was conducted in 2007 in an open-sided house with curtains at the University of
Interntionl Journl of Poultry Science 8 (1): 35-39, 2009 ISSN 1682-8356 Asin Network for Scientific Informtion, 2009 Effect of Different Feed Regimes During the Strter Stge on Productivity nd Crcss Chrcteristics
More informationPolynomial Functions. Polynomial functions in one variable can be written in expanded form as ( )
Polynomil Functions Polynomil functions in one vrible cn be written in expnded form s n n 1 n 2 2 f x = x + x + x + + x + x+ n n 1 n 2 2 1 0 Exmples of polynomils in expnded form re nd 3 8 7 4 = 5 4 +
More informationOr more simply put, when adding or subtracting quantities, their uncertainties add.
Propgtion of Uncertint through Mthemticl Opertions Since the untit of interest in n eperiment is rrel otined mesuring tht untit directl, we must understnd how error propgtes when mthemticl opertions re
More informationRumen inert fat supplements reviewed for dairy cows
Mrch 14, 2005 Volume 77, Numer 11 REPRINT Rumen inert ft supplements reviewed for diry cows The mode of ction for reduced intke when using clcium slts of ftty cids ppers to e primrily due to negtive effects
More informationEconomics Letters 65 (1999) 9 15. macroeconomists. a b, Ruth A. Judson, Ann L. Owen. Received 11 December 1998; accepted 12 May 1999
Economics Letters 65 (1999) 9 15 Estimting dynmic pnel dt models: guide for q mcroeconomists b, * Ruth A. Judson, Ann L. Owen Federl Reserve Bord of Governors, 0th & C Sts., N.W. Wshington, D.C. 0551,
More informationUnit 29: Inference for Two-Way Tables
Unit 29: Inference for Two-Wy Tbles Prerequisites Unit 13, Two-Wy Tbles is prerequisite for this unit. In ddition, students need some bckground in significnce tests, which ws introduced in Unit 25. Additionl
More informationSTATUS OF LAND-BASED WIND ENERGY DEVELOPMENT IN GERMANY
Yer STATUS OF LAND-BASED WIND ENERGY Deutsche WindGurd GmbH - Oldenburger Strße 65-26316 Vrel - Germny +49 (4451)/9515 - info@windgurd.de - www.windgurd.com Annul Added Cpcity [MW] Cumultive Cpcity [MW]
More informationThe Determinants of Private Medical Insurance Prevalence in England
The Determinnts of Privte Medicl Insurnce Prevlence in Englnd Derek R. King, Elis Mossilos LSE Helth nd Socil Cre, London School of Economics nd Politicl Science LSE Helth nd Socil Cre Discussion Pper
More informationTITLE THE PRINCIPLES OF COIN-TAP METHOD OF NON-DESTRUCTIVE TESTING
TITLE THE PRINCIPLES OF COIN-TAP METHOD OF NON-DESTRUCTIVE TESTING Sung Joon Kim*, Dong-Chul Che Kore Aerospce Reserch Institute, 45 Eoeun-Dong, Youseong-Gu, Dejeon, 35-333, Kore Phone : 82-42-86-231 FAX
More informationNQF Level: 2 US No: 7480
NQF Level: 2 US No: 7480 Assessment Guide Primry Agriculture Rtionl nd irrtionl numers nd numer systems Assessor:.......................................... Workplce / Compny:.................................
More informationStudy on enzyme-assisted aqueous extraction of oil from soybean
8 Journl Scientific & Industril Reserch J SCI IND RES VOL 69 NOVEMBER 2010 Vol. 69, November 2010, pp. 8-865 Study on enzyme-ssisted queous extrction oil from soyben Jun-Qing Qin*, De-Hui Qin, Xing-Mo
More informationReasoning to Solve Equations and Inequalities
Lesson4 Resoning to Solve Equtions nd Inequlities In erlier work in this unit, you modeled situtions with severl vriles nd equtions. For exmple, suppose you were given usiness plns for concert showing
More informationMath 135 Circles and Completing the Square Examples
Mth 135 Circles nd Completing the Squre Exmples A perfect squre is number such tht = b 2 for some rel number b. Some exmples of perfect squres re 4 = 2 2, 16 = 4 2, 169 = 13 2. We wish to hve method for
More informationEffect of viscosity on C sugar in Beet sugar factories
ANNUAL TRANSACTIONS OF THE NORDIC RHEOLOGY SOCIETY, VOL. 16, 2008 Effect of on C sugr in Beet sugr fctories Mohmmd Hojjtoleslmy 1, Rez Shokrni 2 nd Ahmd Krsi 3 1 Deprtment of food technology, College of
More informationP.3 Polynomials and Factoring. P.3 an 1. Polynomial STUDY TIP. Example 1 Writing Polynomials in Standard Form. What you should learn
33337_0P03.qp 2/27/06 24 9:3 AM Chpter P Pge 24 Prerequisites P.3 Polynomils nd Fctoring Wht you should lern Polynomils An lgeric epression is collection of vriles nd rel numers. The most common type of
More informationAn Undergraduate Curriculum Evaluation with the Analytic Hierarchy Process
An Undergrdute Curriculum Evlution with the Anlytic Hierrchy Process Les Frir Jessic O. Mtson Jck E. Mtson Deprtment of Industril Engineering P.O. Box 870288 University of Albm Tuscloos, AL. 35487 Abstrct
More informationBasic Analysis of Autarky and Free Trade Models
Bsic Anlysis of Autrky nd Free Trde Models AUTARKY Autrky condition in prticulr commodity mrket refers to sitution in which country does not engge in ny trde in tht commodity with other countries. Consequently
More informationReversing Medications That Cause Bleeding
Reversing Medictions Tht Cuse Bleeding Dine M. Birnbumer, M.D., FACEP Professor of Medicine University of Cliforni, Los Angeles Senior Fculty Deprtment of Emergency Medicine Hrbor-UCLA Medicl Center The
More informationWhy is the NSW prison population falling?
NSW Bureu of Crime Sttistics nd Reserch Bureu Brief Issue pper no. 80 September 2012 Why is the NSW prison popultion flling? Jcqueline Fitzgerld & Simon Corben 1 Aim: After stedily incresing for more thn
More informationEQUATIONS OF LINES AND PLANES
EQUATIONS OF LINES AND PLANES MATH 195, SECTION 59 (VIPUL NAIK) Corresponding mteril in the ook: Section 12.5. Wht students should definitely get: Prmetric eqution of line given in point-direction nd twopoint
More informationHealth insurance exchanges What to expect in 2014
Helth insurnce exchnges Wht to expect in 2014 33096CAEENABC 02/13 The bsics of exchnges As prt of the Affordble Cre Act (ACA or helth cre reform lw), strting in 2014 ALL Americns must hve minimum mount
More informationHealth insurance marketplace What to expect in 2014
Helth insurnce mrketplce Wht to expect in 2014 33096VAEENBVA 06/13 The bsics of the mrketplce As prt of the Affordble Cre Act (ACA or helth cre reform lw), strting in 2014 ALL Americns must hve minimum
More informationHow To Study The Effects Of Music Composition On Children
C-crcs Cognitive - Counselling Reserch & Conference Services (eissn: 2301-2358) Volume I Effects of Music Composition Intervention on Elementry School Children b M. Hogenes, B. Vn Oers, R. F. W. Diekstr,
More informationProject Recovery. . It Can Be Done
Project Recovery. It Cn Be Done IPM Conference Wshington, D.C. Nov 4-7, 200 Wlt Lipke Oklhom City Air Logistics Center Tinker AFB, OK Overview Mngement Reserve Project Sttus Indictors Performnce Correction
More informationCHARACTERIZATION OF HASS AVOCADO PROLEPTIC AND SYLLEPTIC SHOOT PROPORTION IN VALPARAISO REGION, CHILE
Proceedings VI World Avocdo Congress (Acts VI Congreso Mundil del Agucte) 2007. Viñ Del Mr, Chile. 12 16 Nov. 2007. ISBN No 978-956-17-0413-8. CHARACTERIZATION OF HASS AVOCADO PROLEPTIC AND SYLLEPTIC SHOOT
More informationSimulation of operation modes of isochronous cyclotron by a new interative method
NUKLEONIKA 27;52(1):29 34 ORIGINAL PAPER Simultion of opertion modes of isochronous cyclotron y new intertive method Ryszrd Trszkiewicz, Mrek Tlch, Jcek Sulikowski, Henryk Doruch, Tdeusz Norys, Artur Srok,
More informationJaERM Software-as-a-Solution Package
JERM Softwre-s--Solution Pckge Enterprise Risk Mngement ( ERM ) Public listed compnies nd orgnistions providing finncil services re required by Monetry Authority of Singpore ( MAS ) nd/or Singpore Stock
More informationEcon 4721 Money and Banking Problem Set 2 Answer Key
Econ 472 Money nd Bnking Problem Set 2 Answer Key Problem (35 points) Consider n overlpping genertions model in which consumers live for two periods. The number of people born in ech genertion grows in
More informationINITIATION OF THERAPY Patient-specific considerations for initiation of apixaban therapy include the following:
UNC HEALTH CARE GUIDELINE Mngement of Apixn in Adults Apixn (Eliquis ) is n orl nticogulnt tht cts s fctor X inhiitor. It is pproved y the FDA for the prevention of stroke nd systemic emolism in ptients
More informationAll pay auctions with certain and uncertain prizes a comment
CENTER FOR RESEARC IN ECONOMICS AND MANAGEMENT CREAM Publiction No. 1-2015 All py uctions with certin nd uncertin prizes comment Christin Riis All py uctions with certin nd uncertin prizes comment Christin
More informationGraphs on Logarithmic and Semilogarithmic Paper
0CH_PHClter_TMSETE_ 3//00 :3 PM Pge Grphs on Logrithmic nd Semilogrithmic Pper OBJECTIVES When ou hve completed this chpter, ou should be ble to: Mke grphs on logrithmic nd semilogrithmic pper. Grph empiricl
More informationPSYCHROMETRICS: HEATING & HUMIDIFYING or COOLING & DEHUMIDIFYING
PSYCHROMETRICS: HEATING & HUMIDIYING or COOLING & DEHUMIDIYING I) Objective The objective of this experiment is to exmine the stte of moist ir s it enters nd psses through the ir hndling unit. When ether
More informationBayesian Updating with Continuous Priors Class 13, 18.05, Spring 2014 Jeremy Orloff and Jonathan Bloom
Byesin Updting with Continuous Priors Clss 3, 8.05, Spring 04 Jeremy Orloff nd Jonthn Bloom Lerning Gols. Understnd prmeterized fmily of distriutions s representing continuous rnge of hypotheses for the
More informationPROBLEMS 13 - APPLICATIONS OF DERIVATIVES Page 1
PROBLEMS - APPLICATIONS OF DERIVATIVES Pge ( ) Wter seeps out of conicl filter t the constnt rte of 5 cc / sec. When the height of wter level in the cone is 5 cm, find the rte t which the height decreses.
More informationHelicopter Theme and Variations
Helicopter Theme nd Vritions Or, Some Experimentl Designs Employing Pper Helicopters Some possible explntory vribles re: Who drops the helicopter The length of the rotor bldes The height from which the
More informationSmall Business Cloud Services
Smll Business Cloud Services Summry. We re thick in the midst of historic se-chnge in computing. Like the emergence of personl computers, grphicl user interfces, nd mobile devices, the cloud is lredy profoundly
More information, and the number of electrons is -19. e e 1.60 10 C. The negatively charged electrons move in the direction opposite to the conventional current flow.
Prolem 1. f current of 80.0 ma exists in metl wire, how mny electrons flow pst given cross section of the wire in 10.0 min? Sketch the directions of the current nd the electrons motion. Solution: The chrge
More informationUplift Capacity of K-Series Open Web Steel Joist Seats. Florida, Gainesville, FL 32611; email: psgreen@ce.ufl.edu
Uplift Cpcity of K-Series Open Web Steel Joist Sets Perry S. Green, Ph.D, M.ASCE 1 nd Thoms Sputo, Ph.D., P.E., M.ASCE 2 1 Assistnt Professor, Deprtment of Civil nd Costl Engineering, University of Florid,
More informationEnterprise Risk Management Software Buyer s Guide
Enterprise Risk Mngement Softwre Buyer s Guide 1. Wht is Enterprise Risk Mngement? 2. Gols of n ERM Progrm 3. Why Implement ERM 4. Steps to Implementing Successful ERM Progrm 5. Key Performnce Indictors
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationHow To Set Up A Network For Your Business
Why Network is n Essentil Productivity Tool for Any Smll Business TechAdvisory.org SME Reports sponsored by Effective technology is essentil for smll businesses looking to increse their productivity. Computer
More informationMultiplication and Division - Left to Right. Addition and Subtraction - Left to Right.
Order of Opertions r of Opertions Alger P lese Prenthesis - Do ll grouped opertions first. E cuse Eponents - Second M D er Multipliction nd Division - Left to Right. A unt S hniqu Addition nd Sutrction
More informationBasic Ultrasound Views
Bsic Ultrsound Views 2 Kenneth D. Horton K.D. Horton Echo/Vsculr Lortory, Intermountin Medicl Center, Murry, UT, USA e-mil: kd.horton@comcst.net T.P. Arhm (ed.), Cse Bsed Echocrdiogrphy, DOI: 10.1007/978-1-84996-151-6_2,
More informationFirm Objectives. The Theory of the Firm II. Cost Minimization Mathematical Approach. First order conditions. Cost Minimization Graphical Approach
Pro. Jy Bhttchry Spring 200 The Theory o the Firm II st lecture we covered: production unctions Tody: Cost minimiztion Firm s supply under cost minimiztion Short vs. long run cost curves Firm Ojectives
More informationMATH 150 HOMEWORK 4 SOLUTIONS
MATH 150 HOMEWORK 4 SOLUTIONS Section 1.8 Show tht the product of two of the numbers 65 1000 8 2001 + 3 177, 79 1212 9 2399 + 2 2001, nd 24 4493 5 8192 + 7 1777 is nonnegtive. Is your proof constructive
More informationWarnings and Precautions Never Share a Humalog KwikPen, Cartridge, Reusable Pen Compatible with Lilly 3 ml Cartridges, or Syringe Between
1 HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include ll the informtion needed to use HUMALOG sfely nd effectively. See full prescriing informtion for HUMALOG. HUMALOG (insulin lispro
More informationTurfgrass and Environmental Research Online
Turfgrss nd Environmentl Reserch Online...Using Science to Benefit Golf USGA s Turfgrss nd Environmentl Reserch Progrm jointly funded coopertive study with GCSAA s Environmentl Institute for Golf to evlute
More informationPerformance analysis model for big data applications in cloud computing
Butist Villlpndo et l. Journl of Cloud Computing: Advnces, Systems nd Applictions 2014, 3:19 RESEARCH Performnce nlysis model for big dt pplictions in cloud computing Luis Edurdo Butist Villlpndo 1,2,
More informationEffects of overnutrition and undernutrition on in vitro fertilization (IVF) and early embryonic development in sheep
Effets of overnutrition nd undernutrition on in vitro fertiliztion (IVF) nd erly emryoni development in sheep A.T. Grzul-Bilsk, E. Borowzyk, W. Arndt, J. Evoniuk, M. O Neil, J.J. Bilski, R.M. Weigl, Jmes
More informationUnderstanding Basic Analog Ideal Op Amps
Appliction Report SLAA068A - April 2000 Understnding Bsic Anlog Idel Op Amps Ron Mncini Mixed Signl Products ABSTRACT This ppliction report develops the equtions for the idel opertionl mplifier (op mp).
More informationHow To Network A Smll Business
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More information1. In the Bohr model, compare the magnitudes of the electron s kinetic and potential energies in orbit. What does this imply?
Assignment 3: Bohr s model nd lser fundmentls 1. In the Bohr model, compre the mgnitudes of the electron s kinetic nd potentil energies in orit. Wht does this imply? When n electron moves in n orit, the
More informationImmunoglobulins in Umbilical Cord Plasma
Arch. Dis. Childh., 1968, 43, 161. Immunoglobulins in Umbilicl Cord Plsm III: Hemolytic Disese of Newborn nd Respirtory Distress Syndrome RIC McKAY, HAZL THOM, nd DRK GRAY From the Deprtment of Child Helth,
More informationPhysics 43 Homework Set 9 Chapter 40 Key
Physics 43 Homework Set 9 Chpter 4 Key. The wve function for n electron tht is confined to x nm is. Find the normliztion constnt. b. Wht is the probbility of finding the electron in. nm-wide region t x
More information2006 IPCC Software for National Greenhouse Gas Inventories: Application and use for India
2006 IPCC Softwre for Ntionl Greenhouse Gs Inventories: Appliction nd use for Indi Presenttion for NGGIP Side Event Bonn, June 8, 2013 Prof. Amit Grg (mitgrg@iimhd.ernet.in), INDIA GHG Inventory Softwre
More informationRotating DC Motors Part II
Rotting Motors rt II II.1 Motor Equivlent Circuit The next step in our consiertion of motors is to evelop n equivlent circuit which cn be use to better unerstn motor opertion. The rmtures in rel motors
More informationModule 2. Analysis of Statically Indeterminate Structures by the Matrix Force Method. Version 2 CE IIT, Kharagpur
Module Anlysis of Stticlly Indeterminte Structures by the Mtrix Force Method Version CE IIT, Khrgpur esson 9 The Force Method of Anlysis: Bems (Continued) Version CE IIT, Khrgpur Instructionl Objectives
More informationwww.mathsbox.org.uk e.g. f(x) = x domain x 0 (cannot find the square root of negative values)
www.mthsbo.org.uk CORE SUMMARY NOTES Functions A function is rule which genertes ectl ONE OUTPUT for EVERY INPUT. To be defined full the function hs RULE tells ou how to clculte the output from the input
More informationpersons withdrawing from addiction is given by summarizing over individuals with different ages and numbers of years of addiction remaining:
COST- BENEFIT ANALYSIS OF NARCOTIC ADDICTION TREATMENT PROGRAMS with Specil Reference to Age Irving Leveson,l New York City Plnning Commission Introduction Efforts to del with consequences of poverty,
More informationRotational Equilibrium: A Question of Balance
Prt of the IEEE Techer In-Service Progrm - Lesson Focus Demonstrte the concept of rottionl equilirium. Lesson Synopsis The Rottionl Equilirium ctivity encourges students to explore the sic concepts of
More informationExample 27.1 Draw a Venn diagram to show the relationship between counting numbers, whole numbers, integers, and rational numbers.
2 Rtionl Numbers Integers such s 5 were importnt when solving the eqution x+5 = 0. In similr wy, frctions re importnt for solving equtions like 2x = 1. Wht bout equtions like 2x + 1 = 0? Equtions of this
More informationEffects of Testosterone Replacement on Renal Function and Apoptosis on Mesangial and Renal Tubule Cells in Rats
Yongo Act medic 21;41:37 44 Effects of Testosterone Replcement on Renl Function nd Apoptosis on Mesngil nd Renl Tuule Cells in Rts Kuniysu Murok Deprtment of Urology nd First Deprtment of Pthology, Tottori
More informationMaternal Diet and Risk of Childhood Acute Lymphoblastic Leukemia
Reserch Articles Mternl Diet nd Risk of Childhood Acute Lympholstic Leukemi Mrilyn L. Kwn, PhD Christopher D. Jensen, PhD, MPH Gldys Block, PhD Mrk L. Hudes, PhD c Lis W. Chu, PhD c Ptrici A. Buffler,
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationEffect of in vitro B-6 Vitameric Forms on Lymphocyte Proliferation in Healthy Young Women with Oral Vitamin B-6 Supplementation
J Community Nutrition 7279 ~ 84, 2005 Originl Article Effect of in vitro B-6 Vitmeric Forms on Lymphocyte Prolifertion in Helthy Young Women with Orl Vitmin B-6 Supplementtion Ho Kyung Kwk, 1)2) Jmes E.
More informationThreshold Population Levels for Rural Retail Businesses in North Dakota, 2000
Agribusiness & Applied Economics Miscellneous Report No. 191 July 2002 Threshold Popultion Levels for Rurl Retil Businesses in North Dkot, 2000 Rndl C. Coon nd F. Lrry Leistritz Deprtment of Agribusiness
More informationTHE PARAMETERS OF TRAPS IN K-FELDSPARS AND THE TL BLEACHING EFFICIENCY
GEOCHRONOMETRIA Vol. 2, pp 15-2, 21 Journl on Methods nd Applictions of Asolute Chronology THE PARAMETERS OF TRAPS IN K-FELDSPARS AND THE TL BLEACHING EFFICIENCY ALICJA CHRUŒCIÑSKA 1, HUBERT L. OCZKOWSKI
More informationAN ANALYTICAL HIERARCHY PROCESS METHODOLOGY TO EVALUATE IT SOLUTIONS FOR ORGANIZATIONS
AN ANALYTICAL HIERARCHY PROCESS METHODOLOGY TO EVALUATE IT SOLUTIONS FOR ORGANIZATIONS Spiros Vsilkos (), Chrysostomos D. Stylios (),(b), John Groflkis (c) () Dept. of Telemtics Center, Computer Technology
More informationSolenoid Operated Proportional Directional Control Valve (with Pressure Compensation, Multiple Valve Series)
Solenoid Operted Proportionl Directionl Control Vlve (with Pressure Compenstion, Multiple Vlve Series) Hydrulic circuit (Exmple) v Fetures hese stcking type control vlves show pressure compensted type
More information2015 EDITION. AVMA Report on Veterinary Compensation
2015 EDITION AVMA Report on Veterinry Compenstion AVMA Report on Veterinry Compenstion 2015 EDITION Copyright 2015 by the All rights reserved. ISBN-13: 978-1-882691-31-9 AVMA Report on Veterinry Compenstion
More informationNutrition Programs Enhance Exercise Effects on Body Composition and Resting Blood Pressure
All rights reserved: reproduction in whole or prt not permitted. All permission requests to reproduce or dpt published mteril must be directed to the journl office in Conshohocken, PA, no other persons
More informationAdditional Protocol to the Convention on Human Rights and Biomedicine concerning Genetic Testing for Health Purposes
Council of Europe Trety Series - No. 203 Additionl Protocol to the Convention on Humn Rights nd Biomedicine concerning Genetic Testing for Helth Purposes Strsourg, 27.XI.2008 2 CETS 203 Humn Rights nd
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationSwine Health Impact on Carcass Contamination and Human Foodborne Risk
Reserch Articles Swine Helth Impct on Crcss Contmintion nd Humn Foodorne Risk H. Scott Hurd, DVM, PhD Jen Brudvig, DVM, MPH Jmes Dickson, PhD Jovn Mircet, DVM c Miroslv Polovinski c Nel Mtthews, MS, PhD
More informationRecent health policy efforts have targeted healthcare
Medicre Clim Processors Reimursement nd G-CSF Choice Among Non-Hodgkin Lymphom Ptients At Glnce Prcticl Implictions p 148 Author Informtion p 153 Full text nd PDF www.jplive.com Originl Reserch Xioyun
More informationUtilization of Magnesium Hydroxide Produced by Magnesia Hydration as Fire Retardant for Nylon 6-6,6
C O M U N I C A Ç Ã O Utiliztion of Mgnesium Hydroxide Produced y Mgnesi Hydrtion s Fire Retrdnt for Nylon 6-6,6 Sôni D.F. Roch Deprtmento de Engenhri Químic, UFMG Virgíni S.T. Ciminelli Deprtmento de
More informationMAX. As an increasingly larger share of Medicaid enrollees MEDICAID POLICY BRIEF
MAX CENTERS FOR MEDICARE & MEDICAID SERVICES MEDICAID POLICY BRIEF Brief 14 December 2012 The Avilbility nd Usbility of Behviorl Helth Orgniztion Encounter Dt in MAX 2009 Jessic Nysenbum, Ellen Bouchery,
More informationTarget: 10 mg/day within several days Schizophrenia in adolescents (2.1) Oral: Start at 2.5-5 mg once daily; Target: 10 mg/day
HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include ll the informtion needed to use ZYPREXA sfely nd effectively. See full prescribing informtion for ZYPREXA. ZYPREXA (olnzpine) Tblet
More informationFactoring Polynomials
Fctoring Polynomils Some definitions (not necessrily ll for secondry school mthemtics): A polynomil is the sum of one or more terms, in which ech term consists of product of constnt nd one or more vribles
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationCzech J. Anim. Sci., 59, 2014 (9): 391 398
Czech J. Anim. Sci., 59, 2014 (9): 391 398 Originl Pper Effect of dietry eicospentenoic nd docoshexenoic cid on expression of rt liver genes controlling cholesterol homeostsis nd on plsm cholesterol level
More information