Small RNA cloning protocol Louise Chappell and Attila Molnár

Transcription

1 INTRODUCTION The small RNA cloning procedure is based on adapter ligation (see Figure 1). The adapter oligonucleotides are used for priming reverse transcription and for defining the orientation and sequence of the cloned small RNAs. This protocol is isotope free, utilises unmodified small RNAs and is routinely used to characterise mirnas and sirnas from various plant tissues. The total nucleic acid (TNA) isolation is adapted from White and Kaper (1989). Our small RNA cloning protocol results from modifications of protocols originally published by the Tuschl, Bartel and Carrington groups (Elbashir et al., 2001; Pfeffer et al., 2003; Lau et al., 2001; Llave et al., 2002) and may be cited as Chappell et al., SMALL RNA CLONING PROTOCOL The gel purified small RNAs are ligated directly to a non-phosphorylated 5 -adapter oligonucleotide using T4 RNA ligase. The ligation products are separated from the excess of 5 - adapter on a 15% denaturing polyacrylamide gel and are subsequently ligated to a 5 - phosphorylated 3 -adapter oligonucleotide with a blocked 3 -hydroxyl terminus. The final ligation products are separated from the excess of 3 -adapter and are subjected to reverse transcription and PCR amplification. The gel purified PCR products are digested with EcoRI and NcoI restriction enzymes and subsequently concatamerised using T4 DNA ligase. The concatamers are ligated into an EcoRI-NcoI digested cloning vector and then TOP10 cells are transformed with the recombinant plasmids. Individual colonies are screened for the size of concatamer inserts by PCR and selected PCR fragments are purified and submitted for sequencing. The small RNA sequences are extracted from the sequence manually or automatically using software tools (e.g., Staden Package or software developed in-house). 1

2 Schematic diagram of small RNA cloning steps 2

3 Isolate total nucleic acid (TNA) 1. Grind g wt or virus infected plant tissue with liquid nitrogen in a mortar. 2. Transfer homogenized material to a sterile Falcon tube containing 6 ml of phenol and 6 ml of extraction buffer. Mix immediately by vortexing for 15 sec. Centrifuge 15 min at 3,500 X g, at room temperature. The maximum centrifugation force for the recommended tube is 3,500 X g, this can be increased if glass tubes (i.e., Corex) are used instead. 3. Transfer the upper phase to a fresh tube, avoiding precipitated material from the interface. Add 6 ml 25:24:1 phenol/chloroform/isoamyl alcohol and repeat the extraction as described in step 2. The interface contains precipitated proteins. If a large precipitate forms after the first phenol/chloroform/isoamyl alcohol extraction, additional extraction may be required to remove all proteins including endogenous RNases. 4. Transfer the upper phase to a new tube. Add 6 ml 24:1 chloroform/isoamyl alcohol. Vortex 15 sec and centrifuge 5 min at 3,500 X g, 4 o C. 5. Again, transfer the upper phase to a sterile tube and precipitate the total nucleic acid by adding 1/20 volumes of 4 M sodium acetate, ph 5.2, and 3 volumes absolute ethanol. Mix by inversion and incubate min on ice or store at -20 o C overnight. 6. Recover the TNA by centrifuging for 30 min at 3,500 X g, 4 o C. Remove the supernatant by aspiration. 7. To remove residual salts rinse the pellet with equal volumes of 80% ethanol used for precipitation and centrifuge immediately 5 min as described in step 6. Avoid resuspending the TNA pellet in 80% upper ethanol, because short RNAs are soluble to some extent in 80% ethanol in the absence of salt. 8. Remove the ethanol by aspiration without disturbing the pellet and collect the residual ethanol at the bottom of the tube by an additional 10-sec centrifugation. Remove the residual liquid completely using a small pipette tip and dry the tube at room temperature for 5-10 minutes. 3

4 9. Place the tube on ice, dissolve the pellet in 200 µl RNase-free water and transfer the RNA to a siliconised microcentrifuge tube placed on ice. Dilute 2 µl into 1 ml water to estimate the concentration of the total RNA by measuring the absorbance (A 260 ) in a 1 cm quartz cuvette. Store the remaining TNA extract at -70 o C. Quality of RNA can be checked by denaturing 2-5 µl of sample with one volume of gel-loading solution at 65 C for 5 min and analyzing on a 1% agarose gel. The phenol-chloroform extraction provides the highest yield, although other RNA isolation methods (e.g., Trizol reagent) may also be used. The relatively small amount of genomic DNA in TNA will not interfere with further processes. Avoid commercial RNA isolation kits with silica-gel membrane purification because the small RNA fraction does not bind to the column. LiCl precipitation must also be avoided because small RNAs do not co-precipitate with long RNA transcripts. The regular reaction tubes may absorb the low molecular weight nucleic acids to some extent. Use siliconised reaction tubes where possible. Purify small RNA from total nucleic acid 10. Mix µg of total nucleic acid with one volume of gel-loading solution. Denature the nucleic acid solution by incubating the tube for 5-10 min at 65 C. Load the sample in the centre wells of a 15-well 15% denaturing polyacrylamide gel (20 X 16 X 0.15 cm, 50- ml gel volume). Before assembling the apparatus, wash all parts with detergent (e.g., washing up liquid) and rinse with sterile distilled water and ethanol. To heat up the system and to remove persulphate prerun the gel at ~350V (7 W) for 30 min. Carefully wash every well with buffer using a syringe immediately prior to loading the samples. 11. Load 40 µl of denatured (5 min at 65 C) 10-nt DNA oligo ladder. Leave one well empty between the sample and the size marker to avoid contamination. It is important to apply the 10-nt DNA oligo ladder in a similar volume as the total nucleic acid sample to ensure similar gel running behaviour. 12. Separate the small RNAs by running the gel at ~350V (7 W) for ~2.5 hrs using 0.5X TBE buffer until the bromophenol blue dye of the gel-loading solution reaches the bottom of the gel. 4

5 13. Dismantle the gel-running apparatus and stain the gel by soaking in 100 ml of 0.5X TBE buffer containing 0.25 µg/ml ethidium bromide for 10 min. Visualise the nucleic acids in the gel using a 360 nm UV transilluminator. To protect your gel from RNase contamination, cover the transilluminator with plastic wrap. 14. Excise the gel slice encompassing 18 to 28 nt small RNAs defined by the mobility of the DNA size markers (excise between the 20-nt and 30-nt ssdna oligos). RNA migrates slightly slower than DNA of the same sequence and length. Avoid unnecessarily long UV exposure, which will damage the nucleic acids. 15. Cut the gel slice into 1 X 1 mm cubes, transfer to a pre-weighed Falcon tube and weigh the gel slices. Elute the small RNAs from the gel by adding 3 volumes of RNase-free 0.3 M NaCl and incubate the tube at 4 o C overnight under constant agitation (i.e., using rotor shaker or rocker). 16. Transfer the supernatant to a fresh tube (keep at 4 o C) and repeat the elution with 2 volumes of RNase-free 0.3 M NaCl for 6-8 hrs at 4 o C. The more elution buffer, the higher the efficiency of recovery. 3 ml of supernatant can be precipitated in a 15-ml Falcon tube. Large volumes of gel may require greater amounts of extraction buffer for efficient elution, which can either be precipitated in a larger tube or split into multiple 15-ml tubes. 17. Combine the supernatants by pipetting and pellet residual polyacrylamide by centrifugation ( 10 min) at 3,500 X g, 4 o C. Transfer the supernatant to a new tube avoiding polyacrylamide from the bottom and precipitate the RNA from the upper phase by adding glycogen to a final concentration of 2 µg/ml and 3 volumes of absolute ethanol. Incubate samples overnight at -20 o C. 5

6 Ligate the 5 adapter to small RNAs 18. Collect the RNA pellet as described in steps 6-8. Place the tube on ice and dissolve the pellet in 24 µl RNase-free water. To dissolve the pellet completely add the water on top of the pellet and leave the tube undisturbed for min. Vortex briefly and collect the sample at the bottom of the tube by 10-sec centrifugation. 19. Transfer the RNA to a siliconised microcentrifuge tube and add 4 µl of 100 µm of 5 - ADAPTER (see Table 1) and 6 µl of DMSO. 20. Denature both the isolated small RNA and the 5 -ADAPTER by incubating the tube for 1 min at 90 C. Place the tube immediately on ice for 1 min. 21. Add 4 µl of 10X PAN ligation buffer, 1 µl of RNAguard and 1 µl of T4 RNA ligase, mix gently and incubate the tube for 1 hr at 37 C. 22. Add one volume of gel-loading solution and denature the nucleic acids by incubating the tube for 5 min at 65 C. 23. Load the sample in two centre wells of a 15-well 15% denaturing polyacrylamide gel (20 X 16 X 0.15 cm, 50-ml gel volume). Load the size marker (DNA oligo ladder) as described in step Run the gel for ~2.5 hrs at ~350 V (7 W) using 0.5X TBE buffer until the bromophenol blue dye of the gel-loading solution reaches the bottom of the gel. 25. Stain the gel and visualise the nucleic acids as described in step 13. Excise the gel slice encompassing 36 to 46 nt ligated small RNAs defined by the mobility of the DNA size markers (excise between the 30-nt and 60-nt ssdna oligos). 26. Elute the ligation products from the gel slice with RNase-free 0.3 M NaCl as described in step 15 and Combine the supernatants in one tube and pellet residual polyacrylamide by centrifugation ( 10 min) at 3,500 X g, 4 o C. Transfer the supernatant to a new tube and precipitate the RNA by adding glycogen (2 µg/ml) and 3 volumes of absolute ethanol and incubate at -20 o C overnight. 6

7 Ligate the 3 adapter to small RNAs 28. Collect the RNA pellet as described in steps 6-8. Dissolve the pellet in 24 µl RNase-free water as described in step Transfer the RNA to a siliconised microcentrifuge tube and add 4 µl of 100 µm of 5 - phosphorylated 3 -ADAPTER (see Table 1) and 6 µl of DMSO. 30. Denature the RNA by incubating the tube for 1 min at 90 C. Place the tube immediately on ice for 1 min. 31. Add 4 µl of 10X PAN ligation buffer, 1 µl of RNAguard and 1µl of T4 RNA ligase, mix gently, and incubate the tube for 1 hr at 37 C. 32. Add one volume of gel-loading solution and denature the nucleic acids by incubating the tube for 5 min at 65 C. 33. Load the sample in two centre wells of a 15-well 15% denaturing polyacrylamide gel (20 X 16 X 0.1 cm, 50-ml gel volume). Load the size marker (DNA oligo ladder) as described in step Run the gel for ~2.5 hrs at ~350 V (7 W) using 0.5X TBE buffer until the bromophenol blue dye of the gel-loading solution reaches the bottom of the gel. 35. Stain the gel and visualise the nucleic acids as described in step 13. Excise the gel slice encompassing 54 to 64 nt ligated small RNAs defined by the mobility of the DNA size markers (excise between the 50-nt and 80-nt ssdna oligos). 36. Elute the ligation products from the gel slice with RNase-free 0.3 M NaCl as described in step 15 and Combine the supernatants in one tube and pellet residual polyacrylamide by centrifugation ( 10 min) at 3,500 X g, 4 o C. 38. Transfer the supernatant to a new tube and precipitate the RNA by adding 1 µl of 100 µm PCR 3 primer (primer for reverse transcription, see Table 1), glycogen to a final concentration of 2 µg/ml and 3 volumes of absolute ethanol and incubate at -20 o C overnight. 7

8 Perform reverse transcription on adapter ligated small RNA 39. Collect the RNA pellet as described in steps 6-8. Dissolve the pellet in 11.1 µl RNase-free water as described in step Transfer the RNA to a siliconised microcentrifuge tube and denature the nucleic acids by incubating the tube for 1 min at 90 o C. Place the tube immediately on ice for 1 min. 41. Add 3 µl of 0.1 M DTT, 6 µl of 5X first-strand buffer, 8.4 µl of 2 mm dntps and incubate the tube for 3 min at 50 o C. Add 1.5 µl of reverse transcriptase and incubate 30 min at 42 o C and then 30 min at 50 o C. 42. Hydrolyse the RNA by adding 80 µl of 150 mm KOH/20mM Tris-base and incubate for 10 min at 90 o C. 43. To neutralize the solution, add 80 µl of 150 mm HCl. Amplify the cdnas by PCR 44. Mix 50 µl of neutralized reverse transcription reaction with 50 µl of 10X PCR buffer, 50 µl of 2 mm dntps, 5 µl of 100 µm PCR 5 primer (see Table 1), 5 µl of 100 µm PCR 3 primer (see Table 1), 330 µl water and 10 µl of Taq polymerase. Divide the reaction mixture between five 200 µl-pcr tubes. Store the remaining reverse transcription reaction at - 20 o C. 45. Run a PCR using the parameters below: 1 cycle: 2 min 94 o C 25 cycles: 1 min 94 o C 1 min 50 o C 1 min 72 o C 1 cycle: 5 min 72 o C 46. Recombine the PCR reactions in one 1.7-ml Eppendorf tube and add 500 µl of 25:24:1 phenol/chloroform/isoamyl alcohol. Mix by vortexing for 10 sec and centrifuge 5-10 min at maximum speed (16,000 X g) in a table top centrifuge. 47. Transfer the upper phase to a new tube, avoiding precipitated material from the interface. Add 500 µl of 24:1 chloroform/isoamyl alcohol. Vortex 10 sec and centrifuge for 3 min at 16,000 X g. 8

9 48. Again, transfer the upper phase to a new siliconised tube and precipitate the DNA by adding 1/20 volumes of 4 M sodium acetate, ph 5.2, glycogen (2 µg/ml) and 2.5 to 3 volumes absolute ethanol. Mix by inversion and incubate at least 1 hr on ice or store at - 20 o C overnight. Purify the cdnas from native polyacrylamide gel 49. Recover the DNA by centrifuging for 15 min at 16,000 X g, 4 o C, rinse the pellet with 1 ml of 80% ethanol and centrifuge immediately 5 min at 16,000 X g, 4 o C. 50. Remove the supernatant completely by aspiration but do not allow the pellet to dry. Dissolve the pellet in 50 µl water. If the pellet is completely dried the short DNA molecules will be denatured. Renaturation may result in imperfect rehybridization which interferes with subsequent steps. 51. Add 10 µl of 6X DNA loading solution and load the sample in two to 4 centre wells of a 15-well 15% native polyacrylamide gel (20 X 16 X 0.15 cm, 50-ml gel volume). A native polyacrylamide gel is used to separate the cdnas in non-denaturing conditions, addition of formamide to the sample, denaturation by heating and pre-running of the gel are not required. 52. Load 1 µg of 20-bp DNA ladder in a similar volume as the cdna sample to ensure similar gel running behaviour. Leave one well empty between the sample and the size marker to avoid contamination. 53. Separate the cdnas by running the gel at ~350 V (8 W) for ~3 hrs using 0.5X TBE buffer until the bromophenol blue dye of the gel-loading solution reaches the bottom of the gel. 54. Dismantle the gel-running apparatus and stain the gel by soaking in 100 ml of 0.5X TBE buffer containing 0.25 µg/ml ethidium bromide for 10 min. Visualise the nucleic acids in the gel using a 360 nm UV transilluminator. A double band ~40 and 60~ bp is often visible in the gel. The ~40-bp band corresponds to amplified ligation product of directly joined 5 and 3 adapter oligonucleotides without a small RNA insert. 55. Excise the gel slice encompassing 59 to 65 bp cdnas defined by the mobility of the DNA size marker. 56. Elute the DNA from the gel slice with 0.3 M NaCl as described in step 15 and 16. 9

10 57. Combine the supernatants in one tube and pellet residual polyacrylamide by centrifugation ( 10 min) at 3,500 X g, 4 o C. Precipitate the upper phase by adding 1/20 volumes of 4M sodium acetate, ph 5.2, glycogen (2 µg/ml) and 3 volumes of absolute ethanol and incubate at -20 o C overnight. Digest cdna with EcoRI and NcoI restriction enzymes 58. Collect the DNA pellet as described in steps 6-7. Remove the supernatant completely by aspiration but do not allow the pellet to dry. Dissolve the pellet in 85 µl water. Keep 5 µl of undigested material for further analyses. 59. Add 10 µl of 10X buffer H, 5 µl of EcoRI and 5µl of NcoI restriction endonuclease and incubate the tube for 4-5 hrs at 37 o C. 60. Analyse whether the restriction digestion is complete by separating 5 µl of the digested sample and 5 µl of the undigested sample on a 2% agarose gel containing ethidium bromide. Use a 20-bp DNA ladder as a size marker. The undigested PCR product should be ~ 60 bp, the digested PCR product should be ~ 50 bp. 61. Add 200 µl 1X TE buffer and perform a 300-µl 25:24:1 phenol/chloroform/isoamyl alcohol extraction and one 300-µl chloroform extraction as described in steps Precipitate the DNA by adding 1/20 volumes of 4 M sodium acetate, ph 5.2, glycogen (2 µg/ml) and 2.5 volumes absolute ethanol. Mix by inversion and incubate at least 1 hr on ice. Concatamerise EcoRI and NcoI digested DNA (optional) 62. Collect the DNA by centrifugation as described in step 49. Remove the ethanol completely by aspiration but do not allow the pellet to dry. Dissolve the pellet in 8 µl water. 63. Add 1 µl of 10X T4 DNA ligase buffer and 1 µl of T4 DNA ligase. Incubate for 1 hr at room temperature or 16 o C overnight. 10

11 64. Stop the reaction by adding 40 µl of 1X TE and purify the DNA with QIAquick PCR Purification kit as described by the manufacturer (QIAGEN). Elute the DNA with 30 µl of 10 mm Tris-HCl, ph 8.5 and concentrate the sample to one third of the original volume using Speed-Vac concentrator. This step is important to enrich for long concatamers. Only DNA fragments longer than 100 bp can be recovered from QIAquick column. Ligate concatamers into EcoRI and NcoI restriction-digested cloning vector 65. Digest 3 µg of pgem-t Easy vector with 1.5 µl of EcoRI and 1.5 µl of NcoI restriction endonuclease in 50 µl of 1X H buffer for 2 hrs at 37 o C. Verify that the restriction digestion is complete by separating 3 µl of the digested vector and 180 ng of the undigested vector on a 2% agarose gel containing ethidium bromide. 66. Purify the EcoRI and NcoI restriction-digested cloning vector with QIAquick PCR Purification kit according to the manufacturer (QIAGEN). Elute the DNA with 50 µl of 10 mm Tris-HCl, ph Ligate 5 µl of purified concatamer DNA or EcoRI and NcoI restriction-digested cdna into EcoRI and NcoI restriction-digested cloning vector using Rapid DNA Ligation kit as described by the manufacturer (Roche). 68. Transform TOP10 cells (Invitrogen) or other supercompetent E. coli cells using 5 µl of ligation reaction according to the manufacturer. Add 500 µl of SOC and plate out µl aliquots on LB Amp agar plates containing IPTG and X-gal for blue-white selection. Grow the colonies overnight at 37 o C. Screen colonies for concatamer inserts by PCR 69. Fill the wells of a 96-well thermocycler-compatible microtiter plate with 20 µl of PCR mixture containing 2 µl of 10X PCR buffer, 2 µl of 2 mm dntps, 0.2 µl of 100 µm primer M13 F (see Table 1), 0.2 µl of 100 µm primer M13 R (see Table 1), 0.7 µl of 1% W-1, 14.7 µl water and 0.2 µl of Taq polymerase. 11

12 70. Pick individual white colonies from the agar plate using a pipette tip and restreak on a master plate. Transfer the same pipette tips to the wells of the microtiter plate filled with the PCR mixture and resuspend the remaining colony by pipetting up and down. Small inserts might not interfere with LacZ translation therefore light blue colonies may also be analysed. 71. Run a PCR using the following parameters: 1 cycle: 2 min 94 o C 30 cycles: 30 sec 94 o C 30 sec 55 o C 1 min 72 o C 1 cycle: 5 min 72 o C 72. Separate 5 µl of the PCR products on a 2% standard agarose gel using a 100-bp DNA ladder as a size marker. The expected size of the PCR product from the empty vector is 249 bp. PCR products containing single cdna are ~260 bp. PCR products equivalent or longer than 400 bp contain at least three small RNA sequences. 73. Purify the remaining PCR with the QIAquick PCR purification kit as described by the manufacturer (QIAGEN). Sequence or submit the purified PCR product for automated sequencing using M13 F or M13 R primers. Instead of using QIAquick column SAP/Exo I reaction may be used to prepare PCR products for sequencing. CRITICAL PARAMETERS AND TROUBLESHOOTING One of the most critical parameter of small RNA cloning is the quality of total nucleic acid extract. Virus infected plant tissues displaying severe symptoms such as necrosis and chlorosis contain large amounts of apoptotic cells. The small RNA library prepared from those tissues would mainly comprise degradation products of abundant endogenous RNAs including rrnas and trnas. It is therefore recommended to harvest plant material at an early stage of infection. Analyses of the quality of TNA on an agarose gel and the detection of viral RNA by Northern hybridization are recommended before starting the cloning protocol. Avoid nuclease contamination throughout the procedure. Use sterile solutions and disposable plasticware, keep the tube containing RNA solution on ice prior to enzymatic reactions. 12

13 The success of small RNA cloning also depends on the quality of adapter oligonucleotides. To avoid mis-ligation caused by truncated adapter oligonucleotides, gel purification is recommended prior to ligation. Alternatively, gel purified oligonucleotides can also be purchased from RNA synthesis companies. If the cdna of your virus of interest contains one or more of the restriction enzyme recognition sites used for cloning the concatamers in this procedure, design additional primers to ensure that every possible small RNA sequence will be represented in the small RNA library. Concatamerization can reduce the expense of sequencing of small RNAs, however small RNA libraries enriched in concatamers might be less representative of all small RNAs present in the cells therefore direct cloning of restriction enzyme digested cdnas may be performed. The low amounts of small RNAs and ligation products can be absorbed by the walls of untreated reaction tubes. To increase recovery rate after precipitation steps, always use siliconised tubes where possible. If hundreds of small RNA sequences will be analysed, it is recommended to develop software tools for analysing and archiving the small RNAs. LITERATURE CITED Chappell, L., Baulcombe, D. and Molnár, A Isolation and cloning of small RNAs from virus-infected plants. In Current Protocols in Microbiology (R. Coico, T. Kowalik, J.M. Quarles, B. Stevenson, R.K. Taylor, A.E. Simon and T. Downey eds.) pp. 16H H.2.17 John Wiley & Sons, Hoboken, N.J. Elbashir, S.M., Lendeckel, W., and Tuschl, T RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15: Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294: Llave, C., Kasschau, K.D., Rector, M.A., and Carrington, J.C Endogenous and silencingassociated small RNAs in plants. Plant Cell 14: Pfeffer, S., Lagos-Quintana, M., and Tuschl, T Cloning of small RNA molecules. In Current Protocols in Molecular Biology, Vol. 4. (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl eds.) John Wiley & Sons Inc. White, J.L., and Kaper, J.M A simple method for detection of viral satellite RNAs in small 13

14 tissue samples. J. Virol. Methods 23: MATERIALS 10X EB (see Reagents and Solutions) Extraction buffer (see Reagents and Solutions) Tris-buffered water-saturated phenol, ph :24:1 (v/v/v) phenol/chloroform/isoamyl alcohol Chloroform 4 M sodium acetate ph 5.2 Absolute ethanol Gel-loading solution (see Reagents and Solutions) µg of total RNA isolated from virus infected or wt tissues DNA oligos and adapters (see Table 1) 10-nt DNA oligo ladder (see Reagents and Solutions) 15-well 15% denaturing polyacrylamide gel (20 X 16 X 0.15 cm, 50-ml gel volume, see Reagents and Solutions) 5X TBE (see Reagents and Solutions) 10 mg/ml ethidium bromide 0.3 M NaCl 20 mg/ml glycogen (Roche) 10X PAN ligation buffer (see Reagents and Solutions) Dimethyl sulfoxide (DMSO) 40 U/µl T4 RNA ligase (Amersham Pharmacia) 0.1 M dithiothreitol (DTT) 31 U/µl RNAguard (Amersham Pharmacia) 5X first strand buffer (Invitrogen) 200 U/µl reverse transcriptase (Superscript II, RNase H -, Invitrogen) 2 mm dntps (datp, dctp, dgtp, dttp, 2 mm each) 150 mm KOH/20mM Tris base 150 mm HCl 10X PCR buffer (Roche) 5 U/µl Taq polymerase (Roche) 14

15 6X DNA loading solution (Fermentas) 15-well 15% native polyacrylamide gel (20 X 16 X 0.15 cm, 50-ml gel volume, see Reagents and Solutions) 20-bp PCR low DNA ladder (Sigma) 10 U/µl EcoRI (Roche) 10 U/µl NcoI (Roche) 10X buffer H (Roche) 2% (w/v) standard agarose gel 10X TE (see Reagents and Solutions) 10X T4 DNA ligase buffer (New England Biolabs) 400 U/µl T4 DNA ligase (New England Biolabs) QIAquick PCR purification kit (QIAGEN) pgem-t Easy cloning vector (Promega) Rapid DNA Ligation kit (Roche) TOP10 cells (Invitrogen) SOC LB 1% (w/v) W-1 (Invitrogen) 20% (w/v) IPTG 2% (w/v) X-gal 100-bp DNA ladder (Fermentas) Pestle and mortar Liquid nitrogen FALCON BLUE 15 ml Polypropylene conical tube Refrigerated laboratory centrifuge with swing out rotors (Sigma 4K15C) Spectrophotometer and 1-cm quartz cuvette Plastic wrap 360-nm UV transilluminator 1.7-ml siliconised polypropylene microcentrifuge tubes (Sigma) Table top centrifuge (Eppendorf 5415 D) Speed-Vac concentrator 15

16 200-µl PCR tubes Thermal Cycler 96-well Thermocycler-compatible microtiter plates 37 o C incubator REAGENTS AND SOLUTIONS Use deionized, distilled and autoclaved water in all recipes and protocol steps. EB, 10X 1 M Glycine 100 mm EDTA 1 M NaCl Adjust to ph 9.5, autoclave and store at room temperature. Avoid direct sunlight. Extraction buffer 1X EB 2% SDS Prepare freshly, keep at room temperature until use Gel-loading solution 10 ml deionized formamide 200 µl 0,5 M EDTA, ph mg xylene cyanol FF 1 mg bromophenol blue Store up to 1 year at 4 o C TBE, 5X 54 g of Tris base 27.5 g of boric acid 20 ml of 0.5 M EDTA, ph 8.0 Adjust volume to 1 litre with water and sterilise by autoclaving, store at room temperature 16

17 TE, 10X 100 mm Tris-HCl, ph mm EDTA, ph 8.0 Sterilize by autoclaving and store at room temperature. 15% denaturing polyacrylamide gel (50-ml gel volume) 21 g urea 2.5 ml 10X TBE ml of 40% (w/v) 19:1 acrylamide:bis-acrylamide Adjust volume to 50 ml with water, dissolve the urea by mixing with magnetic stirring Add 350 µl of 10% (w/v) ammonium persulphate (APS) and 17.5 µl of TEMED Mix thoroughly and pour immediately 10-nt DNA oligo ladder Mix DNA markers (see Table 1, 3 µm each) in water Add 1 volumes of gel-loading solution Store up to 1 year at -20 o C PAN ligation buffer, 10X 0.5 M Tris-HCl, ph M MgCl M ß-mercaptoethanol 2 mm ATP 1 mg/ml acetylated BSA Store up to 1 year at -20 o C 15% native polyacrylamide gel (50-ml gel volume) 2.5 ml 10X TBE ml of 40% (w/v) 19:1 acrylamide:bis-acrylamide ml water 17

18 Add 350 µl of 10% (w/v) ammonium persulphate (APS) and 17.5 µl of TEMED 18

19 Table 1 Oligonucleotides and their corresponding sequences a Oligonucleotide Sequence a 5 -ADAPTER 5 TGGGAATTCCTCACTrArArA 3 3 -ADAPTER 5 ruruructatccatggactgtidt 3 PCR 5 primer 5 CATGGGAATTCCTCACTAAA 3 PCR 3 primer 5 TACAGTCCATGGATAGAAA 3 M13 F primer 5 TTCCCAGTCACGACGTT 3 M13 R primer 5 CAGGAAACAGCTATGAC 3 20-nt DNA marker 5 GCGCTCTTGACTCGTTGTGC 3 30-nt DNA marker 5 ACGTGTCGACATCACGCTGGAAATGATACA 3 40-nt DNA marker 5 GATAATACGACTCACTATAGGGCCAGGGCGCAGATTGAGC 3 50-nt DNA marker 5 ACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTA CTTTCTCTTA 3 61-nt DNA marker 5 ATGGATCCCTCGAGGTCGACCCTAGGTGGTCTCATCCTCA GTTCGAGAAGTAACCCGGGAT 3 71-nt DNA marker 5 ATGACTAGTAGTAGGCTCTCTCTGTCCTTGAGGATGATGC TCAAGTCTAGCTCTAAGCTGCTCAAGCTCTC 3 80-nt DNA marker 5 AGTCTTCTCATCCATAGAAGCAGTAGTAGGAATATCGTAA TCAAGAGCACCAGATGAAGAGATCTTCTTGAATCTGTTAG 3 a A, C, G, T, DNA residues; ra, ru, RNA residues;, 5 phosphate; idt, 3 -inverted deoxy thymidine 19