A cell based bioluminescence assay reveals dose dependent and contextual repression of AP 1 driven gene expression by BACH2

Transcription

1 Vol.:( ) OPEN A cell sed ioluminescence ssy revels dose dependent nd contextul repression of AP driven gene expression y Pngiot Vrdk,2, Teres Lozno 2, Christopher Bot 3, Jonthn Ellery 3, Srh K. Whiteside,2, Chrlotte J. Iminowski,2, Sturt Frrow 3, Simon Wlker 4, Hnneke Okkenhug 4, Jie Yng,2, Klus Okkenhug, Pul Kuo,2 & Rhul Roychoudhuri,2* Wheres effector CD4 + nd CD8 + T cells promote immune ctivtion nd cn drive clernce of infections nd cncer, CD4 + regultory T (T reg ) cells suppress their function, contriuting to oth immune homeostsis nd cncer immunosuppression. The trnscription fctor functions s pervsive regultor of T cell differentition, promoting development of CD4 + T reg cells nd suppressing the effector functions of multiple effector T cell (T eff ) lineges. Here, we report the development of stle cell-sed ioluminescence ssy of the trnscription fctor ctivity of. Tetrcyclineinducile expression resulted in suppression of phorol 2-myristte 3-cette (PMA)/ ionomycin-driven ctivtion of luciferse reporter contining /AP- trget sequences from the mouse Ifng + 8k enhncer. expression repressed the luciferse signl in dose-dependent mnner ut this ctivity ws olished t high levels of AP- signlling, suggesting contextul regultion of AP- driven gene expression y. Finlly, using the reporter ssy developed, we find tht the histone decetylse 3 (HDAC3)-selective inhiitor, RGFP966, inhiits -medited repression of signl-driven luciferse expression. In ddition to enling mechnistic studies, this cellsed reporter my enle identifiction of smll molecule gonists or ntgonists of function for drug development. CD8 + nd CD4 + conventionl T (T conv ) cells drive immune ctivtion nd promote clernce of infections nd cncer. However, their function cn lso provoke utoimmune nd llergic inflmmtion. The immune system therefore employs vriety of suppressive mechnisms, known s immunoregultory mechnisms, which ct oth intrinsiclly within T conv cells nd extrinsiclly to restrin excessive T cell ctivtion. Immunoregultory mechnisms lso suppress eneficil nti-tumour T cell responses to drive deleterious immunosuppression in cncer. Importnt mong extrinsic immunoregultory mechnisms is the ctivity of CD4 + regultory T (T reg ) cells which limit T conv cell function nd promote immune homeostsis nd tumour immunosuppression 6. Immunoregultory mechnisms re therefore importnt trgets for the development of new therpies imed t treting inflmmtory diseses, disorders of excessive immunopthology nd cncer. Approprite control of T cell differentition nd function requires tht they re le to rpidly regulte their gene expression progrms in response to extrinsic signls. Such cpcity is provided y trnscription fctors (TFs), which ind to the ville repertoire of regultory DNA elements in distinct lymphocyte susets to progrm cell type specific gene expression 7. Signl-dependent TFs control the response of specific cell types to extrinsic stimuli. In T cells, sic leucine zipper (Zip) TFs of the ctivtor protein (AP-) fmily ind to DNA s heterodimers nd contriute to ctivtion of gene expression in response to T cell receptor (TCR) signlling 8. AP- TFs, including Jun (c-jun, JunD, JunB), Fos (c-fos, Fos, Fosl, Fosl2) nd BATF (BATF, BATF2, BATF3), Deprtment of Pthology, University of Cmridge, Tennis Court Rod, Cmridge CB2 QP, UK. 2 Lortory of Lymphocyte Signlling nd Development, Brhm Institute, Cmridge CB22 3AT, UK. 3 CRUK Therpeutic Discovery Lortories, Brhm Reserch Cmpus, Cmridge CB22 3AT, UK. 4 Imging Fcility, Brhm Institute, Cmridge CB22 3AT, UK. * emil: rr257@cm.c.uk Scientific Reports (22) :892

2 Vol:.( ) contin Zip domins enling them to form heterodimeric complexes t plindromic 2-O-Tetrdecnoylphorol-3-cette (TPA) response elements (TRE; 5 -TGA(C/G)TCA-3 ) within regultory DNA 9,. Upon TCR-signlling, AP- complexes trnslocte to the nucleus where they ind to TRE of genes ssocited with T eff cell differentition nd function. is 92 kd trnscriptionl repressor of the Zip TF fmily nd is predominntly expressed in lymphocytes 2. It functions s n importnt regultor of immune ctivtion nd trnscriptionl repression. intrinsiclly regultes the differentition nd function of multiple conventionl T cell lineges nd is required for efficient development of T reg cells. Deficiency of results in cell-intrinsic defect in T reg cell differentition, such tht C57BL/6 syngenic mice lcking protein expression develop lethl inflmmtion 3. In ddition, promotes tumour immunosuppression in T reg -dependent mnner. Genetic deletion of Bch2 in mice results in incresed clernce of sucutneously syngeneic B6 melnom tumours. Furthermore, the gene in humns is prominent risk locus for multiple utoimmune nd llergic diseses 2. The DNA-inding Zip domin of is locted t the C-terminus of the protein nd is required for its repressive ctivity. In T cells, inds to DNA sequences which emed TRE 4. Through shred possession of Zip domins, nd AP- competitively ind to the sme sites within enhncers,5. It hs een proposed tht such competitive interctions y llow it to repress effector-ssocited gene expression. IFN-γ, encoded y the Ifng gene, is n inflmmtory cytokine tht contriutes to ntivirl nd nti-tumour immunity nd cn contriute to inflmmtion nd immunopthology 6. Ifng expression is mrkedly elevted in mouse Bch2-deficient CD4 + nd CD8 + T cells,7. In ddition, repression of IFN-γ expression is prtilly required for to promote induced T reg (it reg ) cell induction 3. These results suggest tht repression of IFN-γ expression is criticl iologicl function of, ut whether these results derive from direct trnscriptionl repression of the Ifng gene hs not een formlly estlished. Moreover, the immunoregultory function of nd its predominntly lymphocyte-specific gene expression profile mke it potentil trget in development of therpies for utoimmune diseses nd cncer. In this work, we hve developed cell-sed ssy system to report the trnscription fctor ctivity of, wherein tetrcycline-inducile expression represses AP--driven luciferse ctivity. Tetrcycline-inducile expression resulted in suppression of phorol 2-myristte 3-cette (PMA)/ionomycin-driven ctivtion of luciferse reporter contining /AP- trget sequences from the mouse Ifng + 8k enhncer. expression repressed the luciferse signl in dose-dependent mnner ut this ctivity ws olished t high levels of AP- signlling, suggesting contextul control of AP- driven gene expression y. In ddition to enling mechnistic studies, we propose tht this cell-sed reporter will enle identifiction of smll molecule gonists or ntgonists of function for drug development. Results Genertion of cell line sed luciferse reporter ssy of repressor function. A puttive enhncer of the mouse Ifng gene (Ifng + 8k), contining cnonicl TRE nd ound y p3,, nd the AP- fctor JunD in CD4 + nd CD8 + T cells ws identified (Fig. ). A short conctented DNA sequence surrounding the TRE t Ifng + 8 k ws sucloned upstrem of miniml promoter (minp) nd luciferseencoding cdna sequence (Fig. ). We dditionlly sucloned humn cdna inducile expression vector contining CMV promoter nd control elements from the cteril tetrcycline (Tet) resistnce operon. We verified the insert nd surrounding vector sequences in oth constructed plsmids using Snger sequencing (Supplementry Fig. nd 2). The luciferse reporter nd inducile expression vectors were co-trnsfected into Jurkt cells constitutively expressing the Tet repressor protein. Trnsfected cells were selected using ntiiotic selection. Stly trnsfected single-cell clones were isolted using limiting dilution. A tetrcyclineinducile functionl reporter ssy ws estlished in ddition to control reporter lcking inducile expression (Fig. c). In the developed system, the Tet repressor inds to specific sequence upstrem of cdna, inhiiting protein expression. The ddition of tetrcycline results in conformtionl chnge of the Tet repressor protein, preventing its inding, nd llowing to e expressed (Fig. 2). We first exmined whether protein expression is inducile using this system. Cells were treted with or without μg/ml tetrcycline, to induce expression. Lystes were resolved using sodium dodecyl sulphte polycrylmide gel electrophoresis (SDS-PAGE) nd proteins were detected y western lotting. We oserved inducile expression of protein upon tetrcycline tretment of the inducile- reporter line ut not of the control reporter line, wheres expression of the AP- fctors JunB, c-jun nd JunD in totl cellulr lystes ws unchnged (Fig. 2). The specificity of nti- ntiody rectivity ws tested y dding locking peptide during ntiody stining of memrnes, which resulted in olishment of the signl (Supplementry Fig. 3). The inducile- reporter line treted with nd without tetrcycline ws stimulted with PMA/ionomycin to cuse Ifng + 8k enhncer-driven luciferse expression. A ~ 4% reduction of luciferse signl ws oserved in tetrcycline-treted cells, which ws not oserved in the control reporter line (Fig. 2c). These results indicte tht tetrcycline-inducile protein represses signl-driven luciferse gene expression controlled y sequence from the consensus Ifng + 8k enhncer. Dose dependent repression of AP driven gene expression y. To exmine the dosedependency of -medited AP--driven signl repression, we performed tetrcycline titrtion experiments. Inducile- cells were treted with titrted doses of tetrcycline nd their luciferse ctivity ws determined following PMA/ionomycin stimultion (Fig. 3 nd Supplementry Fig. 4). protein expression ws lso exmined y SDS-PAGE nd western lotting (Fig. 3). Luciferse ctivity ws negtively correlted with tetrcycline concentrtion (Supplementry Fig. 5) nd significnt positive liner correltion etween Scientific Reports (22) :

3 Vol.:( ) 27 Ifng c Jurkt cell line pcdna6/tetrcycline repressor protein (Blsticidin) CD4 + CD8 + JunD p3 Input JunD p Electroportion pnl2.2 Ifng +8k reporter (Hygromycin) pcdna4/-inducile vector (Zeocin) Stle selection Vlidtion of ulk cell lines Single cell clones Input.64 CAAAGAGGATGCCCCGTGAGTCACTTACAAACCACAGC Inducile- reporter line +pcdna6/tr +pnl2.2 luciferse reporter +pcdna4/-inducile vector minp NlucP Control reporter line +pcdna6/tr +pnl2.2 luciferse reporter Figure. Design nd genertion of n inducile cell-sed luciferse reporter ssy for -medited repression of AP--driven gene expression. () Anlysis of known, JunD nd p3 inding t the mouse Ifng locus s determined y ChIP-Sequencing of CD8 + nd CD4 + T cells. A -ound puttive enhncer of Ifng, Ifng + 8k, is indicted y the lck tringle. () DNA sequence t Ifng + 8k contining TPA response element (TRE; red letters). This sequence ws conctented three times nd sucloned upstrem of miniml promoter sequence (minp, grey ox) controlling expression of NlucP luciferse cdna sequence in the pnl2.2 reporter vector. (c) Experimentl schem for genertion of clonlly derived inducile- reporter nd control reporter lines. Jurkt cells stly trnsduced with pcdna6/tr vector resulting in expression of the tetrcycline repressor protein were co-trnsfected with luciferse reporter (pnl2.2 Ifng + 8k) nd inducile expression (pcdna4/) vectors. Stly trnsfected cells were selected with hygromycin nd zeocin nd then sujected to single-cell cloning resulting in the genertion of luciferse reporter line with the potentil for inducile expression nd control reporter line lcking -induciility. repression of signl-driven luciferse induction nd protein expression ws oserved (Fig. 3c). Imging of inducile- reporter cells fter 6 h of PMA/ionomycin stimultion lso reveled dose-dependent repression of signl-driven luminescence following tretment of cells with tetrcycline (Fig. 4, ). These dt suggest tht functions s dose-dependent repressor of AP--driven gene expression regulted y sequences derived from the + 8k enhncer of Ifng. Contextul dose dependency of AP driven signl repression y. restrins TCR-driven effector differentition progrmmes within CD8 + T cells. However, despite possessing high levels of expression, nïve T cells re le to differentite into effector cells in the presence of strong levels of TCR stimultion. We sked whether -medited repression of AP--driven gene expression occurs to the sme extent t ny level of AP- ctivtion or whether its repressor function is limited t sturting levels of AP- ctivtion. We therefore stimulted cells with titrted doses of PMA/ionomycin using single concentrtion of tetrcycline per titrtion. Importntly, we oserved loss of -medited luciferse signl repression t higher levels of PMA/ionomycin stimultion (Fig. 5, ). These results suggest tht cpcity to medite AP--driven gene expression repression is reduced in the presence of strong ctivting signls. Thus, dosedependent AP- signl repression y is contextul nd regulted y the strength of ctivtion signlling in the system. medited repression of signl driven luciferse induction is inhiited y the HDAC3 inhiitor RGFP966. There re no known direct ctivtors or inhiitors of function. However, it ws recently shown tht -medited repression of the Prdm gene in B cells is prtilly dependent upon corecruitment of complex contining histone decetylse 3 enzyme (HDAC3). Thus, its repressor function t this locus is inhiited y the HDAC3-selective inhiitor RGFP966 8,9. We therefore exmined whether pre-tretment of cells with RGFP966 would result in inhiition of -medited repression in the developed reporter ssy. We oserved ner-complete loss of -repression of PMA/ionomycin-driven luciferse expression when cells were pre-treted with 2.5 μm RGFP966 (Fig. 6, ). Importntly, RGFP966 tretment did not ffect expression in the ssy (Fig. 6c). These results provide positive control for phrmcologicl inhiition of ctivity in the reporter system developed nd shed light on potentil mechnisms y which represses Ifng expression in T cells. Scientific Reports (22) :

4 Vol:.( ) + Tet TR TR TetO 2 TR TR Tetrcycline [ μg/ml]: Inducile- Control (kd) 25 3 c Normlised luminescence (% RLU) PMA/iono Tetrcycline [ μg/ml] TetO 2 ns *** **** **** Inducile- ns ns **** **** Control c-jun JunB JunD β-ctin Figure 2. -medited repression of AP- driven luciferse expression using the inducile reporter system. () Inducile expression system. Tetrcycline repressor (TR) protein in its ctive form (indicted s circle) inds to the TetO 2 sequence upstrem of cdna sucloned into the pcdna4/ vector inhiiting trnscription of. Tetrcycline (Tet) ddition chnges the conformtion nd inctivtes the tetrcycline repressor (TR) protein (indicted s squre), which is susequently not le to ind to TetO 2 sequence, llowing trnscription to commence. () Western lot for indicted proteins of totl lystes isolted from the clonlly derived inducile- nd control reporter cell lines with or without tetrcycline tretment. (c) Luciferse ctivity in the inducile- nd control reporter lines fter 6 h PMA/ionomycin stimultion with or without pre-tretment with tetrcycline ( μg/ml). Unpired two-tiled Student s t test (c). Dt re representtive of 3 independent experiments with 3 culture replictes per condition. Brs nd error represent men (SD); ns not significnt; ***P <.; ****P <.. Discussion In this study, we hve generted cell-sed luciferse reporter ssy system to fcilitte nlysis of the trnscriptionl repressor function of in vitro. Sequences derived from the mouse Ifng + 8k enhncer sequence ound y oth nd Jun fmily AP- fctors in T cells were used to drive luciferse gene expression. Its signl-driven induction ws repressed y tetrcycline-inducile expression. Our inducile reporter system suggests tht -medited repression of AP--driven gene expression is dose-dependent nd limited t the highest levels of AP- signlling. Previous work hs shown tht represses IFN-γ expression, ut whether this ws the result of direct control of regultory elements of the Ifng gene hd not een tested. These findings suggest tht represses AP--driven induction of Ifng through regultory interctions with AP- fctors t the Ifng + 8k enhncer (Supplementry Fig. 6). In this study, we exmined -medited regultion of Ifng regultory elements in Foxp3-negtive conventionl T cell line. Repression of IFN-γ expression is criticl iologicl function of not only in conventionl CD4 + Th cells nd CD8 + T cells, ut lso during erly it reg cell development, where - medited repression of IFN-γ is required for stiliztion of it reg differentition prior to Foxp3 induction 3. Moreover, we nd others hve shown tht within linege-committed Foxp3 + T reg cells, is re-purposed nd is not required to mintin Foxp3 expression or suppress IFN-γ expression, ut rther locks the TCR-driven trnsition etween resting T reg (rt reg ) nd ctivted T reg (T reg ) sttes 2,2. Given these oservtions, we chose to study the regultion of Ifng expression y in the Foxp3-negtive Jurkt cell line. It would e useful in Scientific Reports (22) :

5 Vol.:( ) Luminescence (RLU x 6 ) PMA/iono Tetrcycline [µg/ml] x -5 x -4 x -3 **** **** **** ns *** ns **** ns *** x -2 x - x /β-ctin protein rtios (normlised) Tetrcycline [μg/ml] β-ctin (kd) c /β-ctin protein rtios (normlised) 5 R 2 =.8996 p = Signl repression (%) -2 Figure 3. Dose-dependent repression of AP--driven gene expression y. () Luciferse ctivity of inducile- reporter line fter 6 h PMA/ionomycin stimultion with or without pre-tretment with indicted titrted doses of tetrcycline. () Western lot nlysis of the undnce of protein within totl protein lystes from cells in (). Quntified nd normlised to β-ctin levels of protein expression re displyed in the r grph (top). (c) Positive correltion etween expression normlised to β-ctin, nd luciferse signl repression t the indicted in () tetrcycline concentrtions. Two-wy ANOVA with Bonferroni correction () nd liner regression nlysis (c). Dt re representtive of 2 independently repeted experiments with 3 culture replictes per condition. Brs nd error represent men (SD); ns not significnt; ***P <.; ****P <.. future studies, however, to exmine the effect of on gene regultion t other loci in T reg cell line, such s the MT-2 humn T reg cell line 22. Stle trnsfection of the reporter system llowed for the effect of on chromtinized reporter to e determined, s opposed to commonly utilized trnsfected plsmid luciferse reporters which re not integrted into the host genome nd therefore exist s non-chromtinized plsmid DNA. This system provided the opportunity to exmine whether -medited repression of gene expression in T cells is in prt dependent upon regultion of chromtin. Histone decetylse 3 enzyme (HDAC3) is found in specific complexes contining NCoR nd NCoR2 nd cn e recruited to chromtin y trnscriptionl repressors 23,24. In B cells, hs een shown to interct with NCoR nd NCoR2 resulting in recruitment of HDAC3 to the Prdm gene. As result, repression of Prdm y is dependent upon the ctivity of HDAC3 8. Consistent with these findings, we oserved tht repression of signl-driven luciferse expression y ws inhiited upon pre-tretment of cells with the HDAC3-specific inhiitor RGFP966. These findings provide n importnt positive control for inhiition of -medited repressor ctivity in the developed ssy system, relevnt to development nd vlidtion of high-throughput screening ssys. It will lso e importnt in future studies to test the extent to which -medited repression of Ifng expression in primry cells requires the histone decetylse function of HDAC3. A functionl reltionship etween nd AP- fctors underlies T cell memory formtion,2. inhiits oth effector nd terminl effector differentition progrmmes under conditions of wek TCR-signlling, contriuting to differentition of memory CD8 + T cells nd long-lived responses following virl infection. In our ssys, loss of -medited repression t high levels of stimultion suggests tht -medited Scientific Reports (22) :

6 Vol:.( ) Brightfield Luminescence Stimultion Tetrcycline (μg/ml) 5 Vehicle PMA/iono Positive luminescent cells (%) Tetrcycline (μg/ml).5. PMA/iono.2 x -2 PMA/iono Figure 4. Bioluminescence imging of -reporter cells. () Imging of inducile- reporter cells 6 h fter PMA/ionomycin stimultion with or without tetrcycline ( μg/ml) tretment. Unstimulted cells were included (indicted s Vehicle). Imges were cptured fter luciferse sustrte ddition using rightfield (left) nd luminescence (right) chnnels. Ech pnel is representtive 3 μm 3 μm cropped re from the overview imge. () Frequency of positive luminescent cells in stimulted inducile- reporter cells following pre-tretment with the indicted doses of tetrcycline. repression is itself regulted y the strength of ctivting signls tht cells receive. This is consistent with requirement for T cells expressing high levels of to nevertheless e le to differentite into effector cells in the presence of strong TCR nd inflmmtory signlling. Indeed, numer of regultory pthwys re known to ffect the post-trnsltionl stility, loclistion nd function of nd n opportunity to further interrogte their role in reductionist system is provided y this ssy. However, such investigtions would need to e complemented y corresponding ssys using more physiologicl systems, including in primry T cells. Finlly, this cell-sed reporter provides n opportunity for identifiction of smll molecule gonists or ntgonists of function using high-throughput screening. Such ssys my enle identifiction of novel therpeutic compounds to either ugment or inhiit the suppressive function of in immune ctivtion. Methods Plsmids nd genertion of inducile nd control reporter cell sed lines. A DNA sequence locted t the puttive Ifng + 8k enhncer contining TRE element (5 CAA AGA GGA TGC CCCG TGA GTC ACTT ACA AAC CAC AGC 3 ) ws conctented three times nd sucloned into the hygromycinresistnt luciferse reporter vector pnl2.2 (N7, Promeg) upstrem of miniml promoter sequence (minp) nd cdna sequence encoding luciferse. A humn cdna sequence ws su-cloned into the multiple cloning site (MCS) of the zeocin-resistnt tetrcycline inducile vector pcdna.4/to (V22, Invitrogen) to generte the pcdna4/-inducile vector. Together with pnl2.2 luciferse reporter, oth plsmids were co-trnsfected into lsticidin-resistnt Jurkt TRex cells (pcdna6/tr) using the Amx Cell Line Nucleofector Kit V (VCA-3, Lonz) following the mnufcturer s instructions. Stly trnsfected cells were selected y culturing cells in the presence of μg/ml hygromycin (687, Invitrogen) nd 2 μg/ml zeocin (R25, Invitrogen) for 2 weeks. For the control line, only the hygromycin resistnt-pnl2.2 luciferse reporter ws trnsfected nd cells were treted with hygromycin lone. Single cell clones were estlished y limiting dilution. Cells Scientific Reports (22) :

7 Vol.:( ) Luminescence (RLU x 6 ) Tetrcycline [μg/ml]: 25/.25 3/.5 5/2.5 /5 2/ [PMA] (ng/ml) / [iono] (μg/ml) 6.E-5 2.4E-4.9E-3.5E-2 3.2E-2 6.2E-2.2E driven repression (%) /.25 3/.5 5/2.5 /5 2/ [PMA] (ng/ml) / [iono] (μg/ml) Figure 5. Contextul signl-responsive repression of luciferse expression y. () Luciferse ctivity in inducile- reporter line fter 6 h stimultion with the indicted concentrtions of PMA/ionomycin, with or without pre-tretment with titrted tetrcycline doses. Concentrtions of tetrcycline re indicted in the figure legend. () Luciferse signl repression t the indicted PMA/ionomycin concentrtions with or without tetrcycline ( μg/ml) pre-tretment. (, ) Dt re representtive of 2 independently repeted experiments with 3 culture replictes per condition. Brs nd error represent men (SD). c Luminescence (RLU x 6 ) Tetrcycline: **** ns Veh RGFP966 Signl repression (%) Tetrcycline: **** ns Veh RGFP966 RGFP966 [2.5 μm]: Tetrcycline [ µg/ml]: β-ctin (kd) Figure 6. -medited repression of luciferse expression is inhiited y the HDAC3 inhiitor molecule RGFP966. (, ), Luciferse ctivity in inducile- reporter line fter 6 h stimultion with PMA/ ionomycin nd pre-tretment with or without μg/ml tetrcycline nd with 2.5 μm of RGFP966 or without (indicted s Veh). (c) Western lot nlysis of the undnce of within totl protein lystes from cells in (, ) treted with or without 2.5 µm RGFP966. Unpired two-tiled Student s t test (, ). (, ) Dt re representtive of 2 independently repeted experiments with 3 culture replictes per condition. Brs nd error represent men (SD); ns not significnt; ****P <.. were cultured in RPMI medium (87585, Gico) contining % tetrcycline free fetl ovine serum (P3-2, PAN Biotech), 5, Units of penicillin streptomycin (5422, Gico),. X glutmx (, Scientific Reports (22) :

8 Vol:.( ) Gico),.25 μg/ml of mphotericin B (52926, Gico) nd μg/ml of lsticidin (R2, Invitrogen) nd mintined fter selection in hlf the concentrtion of the indicted selection ntiiotics t 37 C with 5% CO 2. Snger sequencing nd dt nlysis. Inserts regions of the constructed vectors pnl2.2 Ifng + 8 k reporter nd pcdna.4/-inducile were confirmed using Snger sequencing. Primers were designed for sequencing of pnl2.2 Ifng + 8k reporter vector s follows: Fw: 5 TCG ATA GTA CTA ACA TAC GC 3 nd Rv: 5 GTT GTA GCC GGC TGT CTG TCG 3. A primer wlk strtegy ws followed to verify the pcdna.4/- inducile vector insert nd involved designing five different forwrd nd reverse primer sequences s follows: Fw: 5 CGC AAA TGG GCG GTA GGC GTG 3 ; Fw2: 5 ACG ATG GAT TCA GAG ACG GC 3 ; Fw3: 5 CTT AAG GTC TCT GTT CAG C 3 ; Fw4: 5 AAT CAA AGT CTG CCC TCG 3 ; Fw5: 5 AAT TTA GAA TGT GAA ATC CG 3 ; nd Rv: 5 TAG AAG GCA CAT CGAGG 3 ; Rv2: 5 TTT CTC ACA CAC CAA TTT GC 3 ; Rv3: 5 GAA TAG GAA GAG CAG GAG C 3 ; Rv4: 5 TCC ACA CTT TTC GTT ATG C 3 ; Rv5: 5 TCA TCC TCC TCC TCT CCT GC 3. Sequencing dt were nlysed using FinchTv.4. softwre (Geospiz) nd ChromsPro 2..9 softwre (Technelysium) for pnl2.2 Ifng + 8k reporter nd pcdna4/ inducile-vector respectively. Imges of the confirmed insert sequences were merged fter dt nlysis with Adoe Photoshop CS6 softwre (Adoe Cretive Suite 6 Mster Collection). Luciferse ssy. Clonlly derived cell lines were treted with or without tetrcycline (T832, Sigm- Aldrich) for 8 h. Susequently, cells were stimulted with phorol 2-myristte 3-cette (PMA) (P585, Sigm-Aldrich) nd ionomycin (I634, Sigm-Aldrich) t 25 ng/ml nd.25 μg/ml respectively, if not otherwise stted, for 6 h in replenished culture medium contining tetrcycline. Luciferse expression ws cquired using the Nno-Glo Luciferse Assy System kit (N3, Promeg) following the mnufcturer s instructions. Luciferse signl ws mesured using PHERAstr FS spectrophotometer. Dt were nlysed using GrphPd Prism 8 softwre. Western lotting. Selected clones were treted with or without tetrcycline for 8 h. The cells were hrvested nd wshed twice in phosphte-uffered sline (PBS). Cells were lysed in RIPA uffer (899, Thermo Scientific) contining protese inhiitors (87, Sigm-Aldrich). Totl protein concentrtion ws quntified using BCA ssy (23225, Thermo Scientific) nd normlised protein mount ws loded on SDS- PAGE gels followed y semi-dry western lotting. protein ws detected using -specific ntiody (D3T3G Rit ma, 8775S, Cell Signlling Technology). Detection of Jun fmily memers ws conducted with primry nti-c-jun ntiody (N, clone sc-45, J73, Snt Cruz Biotechnology), nti-junb ntiody (2, clone sc-73, J83, Snt Cruz Biotechnology) nd nti-jund ntiody (329, clone sc-74, A33, Snt Cruz Biotechnology). As loding control β-ctin protein ws stined using nti-β-ctin ntiody (clone AC-74, A5, Sigm-Aldrich). The specificity of nti- ntiody rectivity ws tested y dding specific locking peptide (38475S, Cell Signlling Technology) during primry ntiody stining. Stripping of primry nd secondry ntiodies ws performed y incuting the memrne in Restore Western Blot Stripping Buffer (259, Thermo Scientific) followed y re-proing s descried ove. Protein quntifiction ws conducted using ImgeJ softwre 25. RGFP966 inhiitor tretment. Inducile- reporter cells were plted nd pre-treted with or without μg/ml tetrcycline for 5 h prior to RGFP966 (697, Cymn Chemicl Compny) inhiitor ddition. The tetrcycline pre-treted cells were dditionlly treted with 2.5 μm or without RGFP966 for 2 h following protein extrction or PMA/ionomycin stimultion for 6 h s descried previously. Susequently, protein level detection with western lotting or luciferse ctivity mesurements were performed using methods outlined ove. Imging. Cells from the inducile- reporter line were pre-treted with titrted concentrtions of tetrcycline (nmely.24 μg/ml,.2 μg/ml,.5 μg/ml nd μg/ml) or without for 8 h. Stimultion of cells with PMA/ionomycin t ove concentrtions followed for 5 h. Cells were imged prior nd susequently to luciferse sustrte (Nno-Glo Live Cell Assy System kit (N2, Promeg)) ddition following the mnufcturer s instructions. Luminescence nd rightfield imges were cptured using Nikon Ti-E microscope, Andor ixon Ultr EM-CCD cmer, Nikon 2.8 NA ojective, OKO l environment chmer t C with 5% CO2 nd Nikon Elements with JOBS module softwre. A 3 3 montge of imges ws cquired in ech well with the cmer set to mximum sensitivity (3 EM gin, 5. mplifier gin) using s nd 5 ms exposure times for luminescence nd rightfield chnnels respectively. Imges were processed nd quntified with FIJI 26 using the PureDenoise plug-in 27 to improve the ckground of the luminescence imges nd the StrDist plug-in 28 to crete cell segmenttion msks. Sttisticl nlysis. Sttisticl tests of luciferse ssys were performed using unpired two-tiled Student s t tests nd two-wy ANOVA with Bonferroni multiple comprisons correction where specified. All the luciferse mesurements were conducted with t lest three technicl replictes per condition. Received: 8 My 22; Accepted: 2 Octoer 22 Scientific Reports (22) :

9 Vol.:( ) References. Josefowicz, S. Z., Lu, L. F. & Rudensky, A. Y. Regultory T cells: mechnisms of differentition nd function. Annu Rev Immunol 3, https ://doi.org/.46/nnur ev.immun ol (22). 2. Skguchi, S., Ymguchi, T., Nomur, T. & Ono, M. Regultory T cells nd immune tolernce. Cell 33, https ://doi. org/.6/j.cell (28). 3. Benoist, C. & Mthis, D. Treg cells, life history, nd diversity. Cold Spring Hr Perspect Biol 4, 72. https ://doi.org/./ cshpe rspec t.7 2 (22). 4. Vignli, D. A., Collison, L. W. & Workmn, C. J. How regultory T cells work. Nt Rev Immunol 8, https ://doi.org/.38/ nri23 43 (28). 5. Quezd, S. A., Peggs, K. S., Simpson, T. R. & Allison, J. P. Shifting the equilirium in cncer immunoediting: from tumor tolernce to erdiction. Immunol Rev 24, 4 8. https ://doi.org/./j.6-65x.2.7.x (2). 6. Stockis, J., Roychoudhuri, R. & Hlim, T. Y. F. Regultion of regultory T cells in cncer. Immunology 57, https ://doi. org/./imm.4 (29). 7. Henning, A. N., Roychoudhuri, R. & Restifo, N. P. Epigenetic control of CD8(+) T cell differentition. Nt Rev Immunol 8, https ://doi.org/.38/nri (28). 8. Reinke, A. W., Bek, J., Ashenerg, O. & Keting, A. E. Networks of ZIP protein-protein interctions diversified over illion yers of evolution. Science 34, https ://doi.org/.26/scien ce (23). 9. Turner, R. & Tjin, R. Leucine repets nd n djcent DNA inding domin medite the formtion of functionl cfos-cjun heterodimers. Science 243, https ://doi.org/.26/scien ce (989).. Glover, J. N. & Hrrison, S. C. Crystl structure of the heterodimeric ZIP trnscription fctor c-fos-c-jun ound to DNA. Nture 373, https ://doi.org/.38/ (995).. Roychoudhuri, R. et l. regultes CD8(+) T cell differentition y controlling ccess of AP- fctors to enhncers. Nt Immunol 7, https ://doi.org/.38/ni.344 (26). 2. Igrshi, K., Kuroski, T. & Roychoudhuri, R. BACH trnscription fctors in innte nd dptive immunity. Nt Rev Immunol 7, https ://doi.org/.38/nri (27). 3. Roychoudhuri, R. et l. represses effector progrms to stilize T reg -medited immune homeostsis. Nture 498, https ://doi.org/.38/ntur e29 9 (23). 4. Oyke, T. et l. Bch proteins elong to novel fmily of BTB-sic leucine zipper trnscription fctors tht interct with MfK nd regulte trnscription through the NF-E2 site. Mol Cell Biol 6, https ://doi.org/.28/mc (996). 5. Kuwhr, M. et l. Bch2-Btf interctions control Th2-type immune response y regulting the IL-4 mplifiction loop. Nt Commun 7, https ://doi.org/.38/ncomm s259 6 (26). 6. Ivshkiv, L. B. IFNgmm: signlling, epigenetics nd roles in immunity, metolism, disese nd cncer immunotherpy. Nt Rev Immunol 8, https ://doi.org/.38/s z (28). 7. Roychoudhuri, R., Eil, R. L. & Restifo, N. P. The interply of effector nd regultory T cells in cncer. Curr Opin Immunol 33,. https ://doi.org/.6/j.coi (25). 8. Tnk, H. et l. Epigenetic regultion of the Blimp- gene (Prdm) in B cells involves Bch2 nd histone decetylse 3. J Biol Chem 29, https ://doi.org/.74/jc.m (26). 9. Mlvez, M. et l. HDAC3-selective inhiitor enhnces extinction of cocine-seeking ehvior in persistent mnner. Proc Ntl Acd Sci U S A, https ://doi.org/.73/pns (23). 2. Grnt, F. M. et l. drives quiescence nd mintennce of resting Treg cells to promote homeostsis nd cncer immunosuppression. J Exp Med https ://doi.org/.84/jem.29 7 (22). 2. Sidwell, T. et l. Attenution of TCR-induced trnscription y Bch2 controls regultory T cell differentition nd homeostsis. Nt Commun, 252. https ://doi.org/.38/s (22). 22. Ying, C. et l. Enhncement of regultory T cell-like suppressive function in MT-2 y long-term nd low-dose exposure to sestos. Toxicology 338, https ://doi.org/.6/j.tox (25). 23. Wtson, P. J., Firll, L., Sntos, G. M. & Schwe, J. W. Structure of HDAC3 ound to co-repressor nd inositol tetrphosphte. Nture 48, https ://doi.org/.38/ntur e72 8 (22). 24. Li, J. et l. Both corepressor proteins SMRT nd N-CoR exist in lrge protein complexes contining HDAC3. EMBO J 9, https ://doi.org/.93/emoj / (2). 25. Schneider, C. A., Rsnd, W. S. & Eliceiri, K. W. NIH Imge to ImgeJ: 25 yers of imge nlysis. Nt Methods 9, https ://doi.org/.38/nmeth.289 (22). 26. Schindelin, J. et l. Fiji: n open-source pltform for iologicl-imge nlysis. Nt Methods 9, https ://doi.org/.38/ nmeth.29 (22). 27. Luisier, F., Vonesch, C., Blu, T. & Unser, M. Fst interscle wvelet denoising of Poisson-corrupted imges. Signl Process 9, (2). 28. Schmidt, U., Weigert, M., Broddus, C. & Myers, G. Cell detection with str-convex polygons, in Interntionl Conference on Medicl Imge Computing nd Computer-Assisted Intervention (MICCAI) (Grnd, Spin, 28). Acknowledgements The reserch ws supported y Cncer Reserch UK Grnt C52623/A22597, Wellcome Trust/Royl Society Grnt 5663/Z/4/Z, UK Biotechnology nd Biologicl Sciences Reserch Council Grnts BB/N7794/, BBS/E/B/C427 nd BBS/E/B/C428, nd MRC Grnt MR/S24468/. We thnk Simon Cook for shring of regents. We express thnks to Mrtin Turner nd Geoff Butcher for ides nd discussion. Author contriutions P.V. wrote the mnuscript nd P.V., T.L. nd R.R. designed experiments. P.V., T.L. nd S.W. performed experiments. P.V. nd H.O. nlysed the dt. C.B. nd J.E. provided regents nd ssocited protocols. C.B., J.E., S.W. nd J.Y. dvised on methodology. C.J.I., S.K.W., P.K. nd R.R. edited the mnuscript. R.R., S.F. nd K.O. provided support nd/or supervised the work. Competing interests The uthors declre no competing interests. Additionl informtion Supplementry informtion is ville for this pper t https ://doi.org/.38/s z. Correspondence nd requests for mterils should e ddressed to R.R. Scientific Reports (22) :

10 Vol:.( ) Reprints nd permissions informtion is ville t Pulisher s note Springer Nture remins neutrl with regrd to jurisdictionl clims in pulished mps nd institutionl ffilitions. Open Access This rticle is licensed under Cretive Commons Attriution 4. Interntionl License, which permits use, shring, dpttion, distriution nd reproduction in ny medium or formt, s long s you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons licence, nd indicte if chnges were mde. The imges or other third prty mteril in this rticle re included in the rticle s Cretive Commons licence, unless indicted otherwise in credit line to the mteril. If mteril is not included in the rticle s Cretive Commons licence nd your intended use is not permitted y sttutory regultion or exceeds the permitted use, you will need to otin permission directly from the copyright holder. To view copy of this licence, visit iveco mmons.org/licen ses/y/4./. The Author(s) 22 Scientific Reports (22) :892