Mixed infections of Pepino mosaic virus strains modulate the. evolutionary dynamics of this emergent virus

Size: px
Start display at page:

Download "Mixed infections of Pepino mosaic virus strains modulate the. evolutionary dynamics of this emergent virus"

Transcription

1 Mixed infections of Pepino mosaic virus strains modulate the evolutionary dynamics of this emergent virus P. Gómez 1, R.N. Sempere 1, S.F. Elena,, M.A. Aranda 1,* 1 1 Centro de Edafología y Biología Aplicada del Segura (CEBAS). Consejo Superior de Investigaciones Científicas (CSIC). Apdo. Correos 1, 00 Espinardo (Murcia), Spain Instituto de Biología Molecular y Celular de Plantas (IBMCP). Consejo Superior de Investigaciones Científicas (CSIC)-UPV, 0 Valencia, Spain The Santa Fe Institute, Santa Fe, NM 01, USA * Corresponding author: Miguel A. Aranda Phone: +- Fax: address: 1

2 Pepino mosaic virus (PepMV) is an emerging pathogen that causes severe economic losses in tomato crops (Solanum lycopersicum L.) in the Northern hemisphere, despite persistent attempts of control. In fact, it is considered one of the most significant viral diseases for tomato production worldwide, and it may constitute a good model for the analysis of virus emergence in crops. Here, we have combined a population genetics approach with an analysis of in planta properties of virus strains to explain an observed epidemiological pattern. Hybridization analysis showed that PepMV populations are composed of isolates of two types (PepMV-CH and PepMV-EU) that co-circulate. The CH type isolates are predominant; however, EU isolates have not been displaced but persist mainly in mixed infections. Two molecularly cloned isolates belonging to each type have been used to examine the dynamics of in planta single infections and coinfection, revealing that the CH type has a higher fitness than the EU type. Moreover, coinfections expand the range of susceptible hosts, and coinfected plants remain symptomless several weeks after infection, constituting this a potentially important problem for the disease prevention and management. These results provide an explanation of the observed epidemiological pattern in terms of genetic and ecological interactions among the different viral strains. Thus, mixed infections appear to be contributing to shaping the genetic structure and dynamics of PepMV populations. 1 Running title: Evolutionary dynamics of Pepino mosaic virus

3 Pepino mosaic virus (PepMV; genus Potexvirus, family Flexiviridae) was identified in as the agent responsible for a viral disease of pepino crops (Solanum muricatum) in Peru (0). PepMV in tomato (Solanum lycopersicum) was first reported in The Netherlands in 1 (), but has since spread rapidly in Europe (,,,, 1, ) and beyond (0,,,, ) causing epidemics and severe economic losses (,,, 1,, ). The PepMV host range is limited mainly to the Solanaceae (), and the virus is easily transmitted from plant to plant by contact (0), vectored by bumble-bees (), or seedborne-transmitted (). PepMV infections in tomato are associated with a wide range of leaf symptoms: mild and severe mosaics, bubbling, laminal distortions and stunting (,, 1). Fruit symptoms occur with or without leaf symptoms, and the main impact of PepMV is on fruit quality [irregular lycopene distribution ()] but not on yield (). Therefore, PepMV is currently considered a dangerous pathogen and is included in the European Plant Protection Organization alert list () as one of the most important tomato viruses worldwide (, 1,,, ). The PepMV genome consists of a single, positive-sense, ~00-nt RNA strand containing five open reading frames (ORFs). ORF1 encodes the putative viral polymerase (RdRp) (). ORFs, and encode the triple gene block (TGB) proteins TGBp1, TGBp and TGBp, which are essential for virus movement (,, ). Potato virus X (PVX) TGBp1 is a multifunctional protein that induces plasmodesmal gating, moves from cell to cell, has ATPase and RNA helicase activities, binds viral RNAs, and acts as suppressor of RNA silencing (, -). ORF encodes the coat protein (CP) which, in addition to its structural role, is required for cell-to-cell and longdistance movement (). Finally, two short untranslated sequences flank the coding regions and there is a poly(a) tail at the ' end of the genomic RNA (,, ).

4 Previous studies have shown that Spanish PepMV populations sampled between 000 and 00 were genetically very homogeneous (~% nucleotide identity), most comprising isolates highly similar to the so-called European tomato strain (PepMV- EU). However, a few isolates sampled in 00 in the Murcia region (Southeastern Spain) were distinct and highly similar to the US strain reported in the USA (1). USA isolates (US1 and US) and a Chilean isolate from infected tomato seeds (CH) share only % nucleotide identity with EU isolates (, ). The CH type has been reported recently in greenhouses for tomato production in Poland () and Belgium (). In this last study, CH was predominant in single infections and also frequent in mixed infections with isolates of the EU type (). However, all PepMV types (EU, US1, US and CH) have been found in USA, where the PepMV-EU type has been the most prevalent, and mixed infections were found in samples collected from Arizona, Colorado and Texas (). Several studies of plant virus populations have reported a reduced genetic diversity of populations separated in time or space (1, 0, ) with high virus genetic stability (). Despite of this, how genetic and ecological factors modulate the evolutionary dynamics of viruses and determine epidemiological patterns is still poorly understood (, ). We have characterized the population genetic structure of PepMV in infected samples of commercial tomato crops in the Murcia region (Southeastern Spain) between 00 and 00. Phylogenetic analysis was performed and genetic diversity values among PepMV isolates were estimated to determine the structure of the population and the strength and direction of selection. In addition, biological properties (host range, fitness and virulence) of two cloned isolates of the CH and EU types were studied to understand the evolutionary dynamics of natural PepMV populations.

5 MATERIALS AND METHODS Surveys of tomato crops and PepMV detection. During 00, 00, 00, and 00, we carried out surveys in greenhouses from two areas of the Murcia region (Southeastern Spain), Mazarrón and Águilas. A collection of samples of young leaves from the apices of symptomatic tomato plants was prepared. Total RNA was extracted from samples using Tri-Reagent TM (Sigma Chemical Co, St Louis, MO, 1 USA), dissolved in µl of RNase-free water, and stored at 0 ºC. PepMV was identified by RNA-RNA molecular hybridization in dot-blots using probes that discriminate between the EU and CH isolates. Probes were complementary to positions 1 1 and 11 of the PepMV-EU and PepMV-CH replicase genes, respectively (Fig. 1) (, ). Probes were prepared by transcription with digoxigenin (0) from plasmids pepsp0. () and pep- (CH) and used as previously described (1) Nucleotide sequencing and accession numbers. The variability and genetic structure of PepMV populations were analyzed by sequencing a -nt genomic fragment, which included the complete TGB and CP genes. Twelve isolates from each year, from 00 to 00, were selected randomly. The cdnas were generated by RT- 1 PCR using primers GGGGTACCGCGGGCCCGGGd(T) 0 VN (CE-) and GACATGAARCATTCATACCAAATGGG (CE-0). Purification of cdnas, ligation into pgem-t-easy and transformation of TOP electrocompetent Escherichia coli cells were carried out according to the manufacturer s instructions (Promega, Madison, WI, USA). Two clones were sequenced from each isolate. In all cases,

6 sequences of these two clones were identical, except for two isolates of 00, for which we obtained sequences differing significantly and, most probably (see results) corresponding to mixed infections; both clones were included in this study. The 0 cdnas were sequenced by an external custom service (Secugen, Madrid, Spain). PepMV sequences were deposited in GenBank under accession nos. FJ1 to FJ Phylogenetic and diversity analysis. Multiple sequence alignments were generated using ClustalW () and, whenever necessary, manually adjusted to maximize similarity while maintaining consistency in the reading frames. Phylogenetic and other molecular evolution analyses were conducted with MEGA (0). Phylogenetic trees were constructed by the minimum evolution method () using the close-neighbor-interchange (CNI) algorithm (0) at a search level of 1, using the corresponding best model of nucleotide substitution (see below) to estimate branch lengths by maximum likelihood (1). The statistical reliability of the resulting trees was evaluated by the bootstrap method (00 pseudoreplicates) (1). The genetic distances within each year were computed using Pamilo-Bianchi-Li method (), and were expressed as the number of synonymous (d S ) and nonsynonymous (d N ) substitutions per synonymous and nonsynonymous sites, respectively. In addition, the evolutionary distances per nucleotide site for each viral type (EU and CH) were estimated among all sequence pairs using a maximum likelihood-based method (, ). The best substitution model (based on Akaike s information criterion) was chosen for each ORF: for TGBp1 this was K1 () whereas for TGBp, TGBp and CP it was HKY (). The difference between d N and d S substitution rates was employed as a proxy to determine the direction and intensity of natural selection acting

7 on different amino acid sites. This difference was estimated for each codon position in the alignments using the single likelihood ancestor counting (SLAC) method implemented in the HYPHY package and available online in the server (). Standard errors were computed by the bootstrap method (based on 00 pseudoreplicates). A value d N d S > 0 is taken as evidence for positive or directional selection operating on a given amino acid, whereas values < 0 are a signature for negative or purifying selection Virus inoculation. Isolates PepMV-Sp1 (EU type) and PepMV-PS (CH type) were used to generate agroinfectious clones (to be described elsewhere). N. benthamiana plants were agroinoculated (0) using these clones. Virions were purified from N. benthamiana leaves after extraction and PEG precipitation with two cycles of differential centrifugation (, 0). Virus concentration was estimated by OD readings at 0 nm, with an extinction coefficient ε 0.1% =. (). Virus inoculations were carried out by rubbing carborundum-dusted cotyledons of young but fully expanded leaves with purified virions at 0 µg/ml or µg/ml in single and mixed infections, respectively, in 0 mm sodium phosphate buffer (ph ) Host range. A panel of 1 potential host species from different families was characterized using at least five plants from each host species. Plants were mechanically inoculated with purified virions of isolates PepMV-Sp1 and PepMV-PS in single and mixed infections. Symptoms in inoculated and non-inoculated leaves were recorded days post-inoculation (dpi). Infections were determined by molecular hybridization in dot-blots for all plants at dpi. Three independent replicates were carried out for this experiment. Additionally, a RT-PCR-restriction fragment length polymorphism (RFLP)

8 analysis was performed in order to determine whether recombinant viruses could have arisen and be responsible of infections after mixed inoculations. Reverse transcriptions and subsequent PCR reactions were carried out using Expand High Fidelity PCR enzyme blend (Roche Diagnostics, Ltd., UK), oligo (dt) 0 and GAYCTWGCTCGTGCWTATGCTG (CE-0) as primers, and total RNA extracts from symptomatic non-inoculated leaves as template (1); the restriction enzyme Alu I (New England Biolabs, UK Ltd) was used to digest the PCR products and distinguish between both PepMV types Viral fitness. The fitness of each PepMV isolate in single and mixed infections in tomato (cv. Boludo) was estimated by measuring viral RNA accumulation by real time quantitative PCR (RT-qPCR) with an AB00 System (Applied Biosystems, Foster City, CA, USA) using the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems). A set of tomato plants was mechanically inoculated with purified PepMV-Sp1 and PepMV-PS virions. The inoculated and mock-treated plants were maintained in a greenhouse under controlled conditions (1 h photoperiod, ºC) for up to dpi. All leaves from three plants from each treatment group were homogenized using a Polytron in mm Tris-HCl, mm EDTA (ph ), % SDS. Three biological replicates were processed at, 1,, and dpi. Total RNA was extracted using Tri- Reagent (0 mg/ml). RNA concentrations were quantified in a NanoDrop ND-00 spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware USA), adjusted to 0 ng/µl, and then stored in aliquots at 0 C. Two pairs of primers were designed using the Primer Express software (Applied Biosystems) targeting a region of the RdRp ORF (Fig. 1). The primers for PepMV-Sp1 were CCCAGCATTGCCACACAAG (CE-) and

9 GAGATTTCAAGCTCAGCAATTATGTT (CE-), and those for PepMV-PS were CGGCACTAATGAAACATTGCTTA (CE-) and TATTGGCGCCGCTTCG (CE-). The reaction mix was prepared following manufacturer s instructions (Applied Biosystems). Melting curve analysis at the amplification end-point and no-template controls (NTC) were carried out to ensure product-specific amplification and the absence of primer-dimers. Viral RNAs were used in serial dilutions to generate external standard curves. Viral RNA was extracted for each isolate from 00 µl of purified virion using a standard phenol/chloroform procedure (). RNA concentration was estimated at least twice with a NanoDrop ND-00 spectrophotometer for each preparation, and then -fold serial dilutions ( to ) were prepared using total RNA extract ( ng/µl) from healthy tomatoes as diluent. The slope values were estimated plotting the threshold cycle (C t ) values from two independent assays with three replicates each. The C t value for PepMV-Sp1 was. with R = 0. whereas for PepMV-PS it was. with R = 0.. RNA concentration in each sample (ng of viral RNA per 0 ng of total RNA) was estimated by interpolating individual C t values in the standard curve from two independent RT-qPCR assays. In control experiments, no interference was found when measuring the amount of viral RNA in samples with RNAs mixed from isolates PepMV-Sp1 and PepMV-SP (mimicking double infections) compared to samples with RNA from only one isolate (data not shown). In addition, the severity of viral symptoms induced by PepMV was estimated on the basis of relative growth reduction experienced by infected plants. Fresh weight (g) and height (1) were measured in each set of plants at, 1,, and dpi.

10 Statistical analysis. Data on genetic diversity among synonymous and nonsynonymous positions, viral RNA concentration, and plant fresh weight and height were analyzed using SPSS software (v. 1.0; SPSS Inc., Chicago, IL, USA). Model I analysis of covariance (ANCOVA) using year or dpi as covariables and type of infection or virus as fixed factors were fitted to the data. Correlation between accumulation levels, height and fresh weight of plants were tested using Pearson correlation coefficients. RESULTS PepMV-CH prevailed in tomato crops without excluding PepMV-EU. We examined samples of symptomatic tomato plants obtained during the period from two areas of the Spanish region of Murcia, Mazarrón and Águilas (Table 1), which are used for intensive commercial tomato production. Samples were analyzed by molecular hybridization using probes that discriminate between PepMV-EU and PepMV-CH. In 00, % of the PepMV isolates were of the CH type, and no double infections were observed. In contrast, during 00, 00 and 00, double infections were observed in, and % of the samples, respectively, whereas single PepMV-CH infections were observed in, and % of the samples, respectively, and PepMV-EU was almost exclusively found in mixed infections (Fig. S1 in supplementary material). In total,.% infected samples contained PepMV-CH alone,.% corresponded to mixed infections, and just 1.% of the samples hybridized solely with the PepMV-EU probe. Therefore, it appears that PepMV isolates of the CH type, after a likely introduction in 00 or 00 (1), have spread to become prevalent

11 in the region, though they have not displaced EU isolates, which seemed to have been maintained predominantly in mixed infections Phylogenetic analysis supports the co-circulation of isolates of the CH and EU types. To analyze the phylogenetic relationships among PepMV isolates, we sequenced a -nt genomic fragment of 0 random isolates. This fragment included the triple gene block (TGBp1, TGBp and TGBp) and the coat protein (CP) gene (Fig. 1) and covered approximately % of the complete virus genome. After aligning the sequences, a matrix of genetic distances among isolates was computed as synonymous substitutions per synonymous site. This distance matrix was used to build up a minimum evolution tree for each ORF independently and for all concatenated coding sequences. The different trees were indistinguishable and the tree derived for the concatenated coding sequence is shown as an example in Fig.. A similar tree structure was obtained by maximum parsimony (data not shown). Two well-defined groups were identified, one containing PepMV-EU isolates, the other containing the PepMV-CH isolates. There was no differentiation between isolates collected in different seasons or at different locations (Fig. ). In addition, comparisons of the trees for each ORF revealed no indication of recombination among PepMV types (data not shown), unlike similar analyses performed with other populations of the same virus (, 1). 0 1 Purifying selection restricts diversity in the PepMV population. To ascertain the direction and strength of selection operating in the PepMV population, we evaluated average d S and d N values among pairs of isolates. We analyzed the resulting data by considering the whole population either divided into sub-populations representing isolates by type (CH or EU) (data not shown) or from each year. The amount of

12 genetic diversity significantly differed among synonymous and non-synonymous sites in yearly subpopulations (F 1,0 =., P = 0.00), with the difference becoming increasingly negative with time (F 1,0 =., P < 0.001) but at a rate that was dependent upon the gene analyzed (F,0 =,, P = 0.00) (Fig. ). Indeed, the strongest effect was observed on TGBp, which could reflect the overlap with TGBp (Fig. 1). Similar results have been reported for other viruses with overlapping genes (e.g. Bovine leukaemia virus (0)). We therefore evaluated the strength of selection at single codons, estimated as d N d S, with % confidence interval, and plotted these values for each group of isolates (EU and CH) (Fig. S in the supplementary material). The results showed that none of the codons we analyzed showed significant evidence of positive selection, and that only nine codons were subject to negative selection (Fig. S). In EU isolates, the codons under purifying selection were R, T10 and S1 in TGBp1; H in TGBp; and Q0, S1, E1 and K1 in the CP. In CH isolates, the only codon under purifying selection was G1 (TGBp). Several population neutrality tests were also performed, all supporting the notion that purifying selection is the main force explaining the divergence between CH and EU isolates; accordingly, the number of non-synonymous substitutions was significantly higher within isolates of the same type than between isolates of different types (data not shown). 0 1 Mixed infections expand the PepMV host range. Plants from a panel of 1 potential host species were mechanically inoculated with PepMV-Sp1 (EU type) and PepMV-PS (CH type) either independently or in mixed inoculations. To avoid potential cross-contamination with field isolates, we prepared the inocula using virions purified from N. benthamiana plants previously inoculated using agroinfectious PepMV

13 1 clones. All infected plants showed symptoms, except N. glauca and N. rustica, in which PepMV infected asymptomatically only the inoculated leaves. Single isolates showed essentially the same host range regardless of the isolate, although N. occidentalis and Solanum melongena plants showed more severe stunting when inoculated with PepMV- Sp1 rather than PepMV-PS (Table ). Surprisingly, mixed inoculations extended the PepMV host range (Table ): N. glutinosa and N. tabacum plants could be infected after simultaneous inoculation with both isolates, resulting in occasional mild chlorotic symptoms in non-inoculated leaves (Table ). Since recombinant viruses could have arisen and be responsible of these infections, a RT-PCR-RFLP-based assay was performed on extracts of systemically infected N. glutinosa and N. tabacum plants. If a recombinant virus was responsible of these infections, a single RT-PCR-RFLP pattern would have been observed; however, samples from systemically infected N. glutinosa and N. tabacum plants consistently gave rise to a superposition of the patterns expected for PepMV-Sp1 and PepMV-PS Mixed infections appear to affect PepMV fitness under experimental conditions. The accumulation of PepMV-Sp1 and PepMV-PS in tomato plants was measured to obtain a fitness estimate for each isolate in single and mixed infections. Viral RNA accumulation was measured by RT-qPCR in sets of inoculated tomato plants harvested after, 1,, and dpi. Prior to harvest, we determined also the average height and fresh weight of each set of plants at the different time points after inoculation. Virus accumulation differed significantly depending on the isolate and type of infection (F, = 1., P 0.001). In single infections, PepMV-PS accumulated, on average,.% more than PepMV-Sp1 (F, =., P = 0.0) (Fig. ). However, 1

14 asymmetrical antagonism was observed during mixed infections. The accumulation of PepMV-PS was suppressed (.% averaging across time samples) in the presence of PePMV-Sp1 relative to the viral loads reached in single infections (F, =., P = 0.001), mixed infections did not appear to affect PepMV-Sp1 accumulation (F, = 1., P = 0.0). This asymmetry may explain why PepMV-EU isolates are maintained in the population predominantly in mixed infections. Fig. shows the growth dynamics for mock-inoculated plants, plants infected with either PepMV-PS or PepMV-Sp1 isolates, and plants co-inoculated with both isolates. Single infections significantly reduced the average fresh weight (Sp1, F, = 1.1, P < 0.001; PS, F, =., P < 0.001) but not the average plant height (Sp1, F,1 =., P = 0.0; PS, F,1 =., P = 0.) compared to mockinoculated plants. Moreover, there was a.% greater reduction in weight when plants were infected with PepMV-Sp1 compared to PepMV-PS (F, = 0.1, P < 0.001). These data also allowed the effect of infection on the rate (i.e. slope) of plant development to be tested. This second type of analysis produced congruent results for both morphological traits, with PepMV-Sp1 having a more significant impact (F 1,1 =.00, P < 0.001) on fresh weight than PepMV-PS (F 1,1 =., P = 0.0). Interestingly, these results showed that the EU isolate is more virulent despite accumulating to a lower extent than the CH isolate. In all four cases, differences in growth rate were not evident up to dpi but became so afterwards. Coinfected plants were as tall (F, = 1.0, P = 0.) and weighted as much (F,1 = 0., P = 0.) as the mock-inoculated ones. Furthermore, the rates of plant development for coinfected plants were undistinguishable from the mock-inoculated plants (height, F 1, = 0., P = 0.; fresh weight, F 1,1 = 1., P = 0.11), suggesting an alleviation of

15 PepMV-induced symptoms in tomato associated with mixed infections. Hence, mixedinfected plants in the fields may look, at least initially, like healthy plants. The potential correlation between virus load and the height and fresh weight of infected plants was also analyzed at dpi; no significant differences were found between virus accumulation levels and height or fresh weight in single (r = 0.01, d.f., P = 0.; r = 0.0, d.f., P = 0.0, respectively) or in mixed infections (r = 0., 1 d.f., P = 0.; r = 0., d.f., P = 0., respectively) DISCUSSION We have analyzed a PepMV population sampled between 00 and 00 in tomato crops from two nearby localities in Southeastern Spain. Our results showed that the population mainly comprised PepMV-CH isolates, which appeared to have spread in an epidemic fashion after recent introduction into a niche previously occupied by PepMV-EU isolates. Similar results have been recently observed for a Watermelon mosaic virus population sampled from zucchini squash, showing that emergent isolates have replaced the pre-existing isolates, and that emergent isolates have reached dominance in all locations were both groups occurred (1). The PepMV-CH presence in tomato crops has been reported in other European countries (,, ) and from North America (, ). It is currently unclear how PepMV-CH was introduced in Europe, although its genetic homogeneity (,, ) and its presence in a commercial tomato seed lot imported to the USA from Chile () suggest a common demographic origin. Perhaps, the movements of infected planting material together with the ease of plant-to-plant PepMV transmission may have resulted in PepMV-CH infections within areas where PepMV-EU was already endemic or across new areas.

16 A remarkable observation was the significant frequency of PepMV mixed infections, and the fact that PepMV isolates of the EU type appeared in mixed but not in single infections; a coincident observation has been published recently (). This led us to hypothesize that mixed infections could have a role in the maintenance of diversity in the virus population. In this regard, an interesting question was whether PepMV-EU and PepMV-CH co-circulating in the same host might influence each other s evolution. To try and answer this question, we studied the genetic variability and evolution of the PepMV population over a four year period, and examined the in planta influence of one isolate on another in mixed infections. Phylogenetic analysis revealed no differentiation within isolates from different seasons or locations, and supported the co-circulation of both strains. On the other hand, most nucleotide positions within the analyzed segment of the PepMV genome were invariant, with very few nonsynonymous substitutions occurring within this region, reflecting strong purifying selection. Thus, most mutations had an impact on evolutionary rate, but not on the functional properties of the virus proteins. A number of plant virus populations have been shown to be genetically stable, reflecting the need to maintain functional integrity within small viral genomes (0,, 1). The invariance of most codons and the presence of strong purifying selection operating on polymorphic codons is consistent with recent reports showing that the genome of RNA viruses is very fragile and that most mutations are either lethal or strongly deleterious (, ) as a consequence of the lack of functional redundancy and the existence of overlapping coding regions. Therefore, the observed polymorphisms may simply reflect deleterious or slightly deleterious mutations segregating in the population. We found few codons under significant purifying selection and most of them were in the TGBp1 and CP genes. The TGP1 codons under purifying selection in the PepMV-EU sub-population 1

17 (R, T10 and S1) appear to be located in the NTPase/helicase domain, which contains a conserved motif necessary for CP TGBp1 interaction in PVX (, ). Most of the sites in TGBp and TGBp were selectively neutral and likely being transiently present in the populations. TGBp and TGBp are predicted to reside in the endoplasmic reticulum (ER) and contain conserved hydrophobic sequences (, ). Possibly, the only codons under purifying selection, H in TGBp (EU type) and G1 in TGBp (CH type), are essential for ER membrane localization and virus movement (, ). Moreover, positions under purifying selection in the PepMV-EU CP (Q0, S1, E1, K1) are localized between amino acids 1 and 1, corresponding to a domain involved in the interaction between CP and genomic RNA in Papaya mosaic virus (genus Potexvirus), and can play an important role in assembly and packaging of the viral genome (). Different amino acid positions appeared to be under purifying selection in the two sub-populations of each PepMV type. This can simply be a spurious consequence of the small sample size but, more interestingly, it can also reflect different functional constraints for the two PepMV types, opening the possibility for future functional analysis of PepMV proteins. The presence of different viral types in populations can alter the population structure and influence its evolution. For instance, the coexistence of different viral types within a population is a prerequisite for recombination, which is a very important source of variation for certain plant viruses. Notably, a significant case is the tomato yellow leaf curl disease (TYLCD) complex, which share agroecological niche with the PepMV population studied herein (1,, 1, ). The co-circulation of PepMV-EU and PepMV-CH types could favor recombination, and other authors have identified recombinant PepMV isolates that have exchanged portions of the TGB and CP genes (1), and portions of the RdRp gene (). However, we found no evidences of 1

18 recombination among the PepMV types studied. Genetic exchange may still have occurred, but may have involved sequences such as RdRp which is upstream of the fragment we studied, or new recombinant strains may have been less fit than the parental strains, thus being eliminated from the population by strong purifying selection (e.g., 1, ). Because recombinant isolates may have quite different biological properties compared to their parental strains (1,, ), genetic studies of the PepMV populations during future seasons should be undertaken to anticipate efficient control strategies. To understand the dynamics of PepMV populations in Southeastern Spain, we have studied the host range and fitness in its principal host using two infectious fulllength cdna clones derived from isolates Sp1 (EU type) and PS (CH type). The PepMV host range appears to be limited to certain solanaceous hosts, but mixed inoculations extended the host range beyond that available to any single isolates. The plant species here studied included potential alternative hosts that grow in the same geographical area than infected tomatoes. PepMV did not infect pepper plants after dpi, but eggplants were infected and displayed severe symptoms, showing more severe stunting when inoculated with PepMV-Sp1 than PepMV-PS (Table ). Therefore, eggplants could serve as an alternative host and/or reservoir in the fields, particularly since the eggplant cropping season in Southeastern Spain is long enough to bridge between tomato cropping seasons (M. Juarez and A. Lacasa, personal communication). An epidemiological study of the more frequent weed species around tomato fields in Murcia and Almería with PepMV-infected tomato plants revealed 1 weed hosts that tested positive for PepMV (), revealing potential sources of PepMV-EU isolates. Unfortunately, data of this kind are not available for PepMV-CH isolates. 1

Detection of PepMV and ringtest results

Detection of PepMV and ringtest results Detection of PepMV and ringtest results HJ (Joe) Vetten (on behalf of the PEPEIRA consortium) JKI, Institute for Epidemiology and Pathogen Diagnostics, Braunschweig, Germany www.jki.bund.de Outline Ringtest

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

ab185915 Protein Sumoylation Assay Ultra Kit

ab185915 Protein Sumoylation Assay Ultra Kit ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic

More information

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF

Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Common Course Topics Biology 1414: Introduction to Biotechnology I

Common Course Topics Biology 1414: Introduction to Biotechnology I Common Course Topics Biology 1414: Introduction to Biotechnology I Assumptions Students may be enrolled in this course for several reasons; they are enrolled in the Biotechnology Program, they need a science

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

bitter is de pil Linos Vandekerckhove, MD, PhD

bitter is de pil Linos Vandekerckhove, MD, PhD 4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

RNA Viruses. A Practical Approac h. Alan J. Cann

RNA Viruses. A Practical Approac h. Alan J. Cann RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the

More information

Virus diseases affect tomato production to some

Virus diseases affect tomato production to some A L A B A M A A & M A N D A U B U R N U N I V E R S I T I E S Virus Diseases Of Tomato ANR-0836 Virus diseases affect tomato production to some degree every year in Alabama. The amount of damage they cause

More information

Supplemental Material. Methods

Supplemental Material. Methods Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.

More information

SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION

SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION Senthilkumar Padmanaban, Haiyan Li, David P. Puthoff and Ann C. Smigocki USDA-ARS Molecular Plant Pathology Laboratory,

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram. Project ID: 1 April 2000 to 31 August 2004. Project Duration:

Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram. Project ID: 1 April 2000 to 31 August 2004. Project Duration: Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram ID: Duration: Coordinator in Switzerland: PS1 1 April 2000 to 31 August 2004 Prof. Thomas Hohn University of Basel Botanisches Institut

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES

PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Tomato Bushy Stunt Virus Recombination Guided by Introduced MicroRNA Target Sequences

Tomato Bushy Stunt Virus Recombination Guided by Introduced MicroRNA Target Sequences JOURNAL OF VIROLOGY, Oct. 2009, p. 10472 10479 Vol. 83, No. 20 0022-538X/09/$08.00 0 doi:10.1128/jvi.00665-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Tomato Bushy Stunt

More information

Biopharmaceutical Process Evaluated for Viral Clearance

Biopharmaceutical Process Evaluated for Viral Clearance Authored by S. Steve Zhou, Ph.D. Microbac Laboratories, Inc., Microbiotest Division The purpose of Viral Clearance evaluation is to assess the capability of a manufacturing production process to inactivate

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

MULTIPLEX RT-PCR REACTION FOR SIMULTANEOUS DETECTION OF TOMATO TORRADO VIRUS AND PEPINO MOSAIC VIRUS CO-INFECTING SOLANUM LYCOPERSICUM

MULTIPLEX RT-PCR REACTION FOR SIMULTANEOUS DETECTION OF TOMATO TORRADO VIRUS AND PEPINO MOSAIC VIRUS CO-INFECTING SOLANUM LYCOPERSICUM JOURNAL OF PLANT PROTECTION RESEARCH Vol. 53, No. 3 (2013) MULTIPLEX RT-PCR REACTION FOR SIMULTANEOUS DETECTION OF TOMATO TORRADO VIRUS AND PEPINO MOSAIC VIRUS CO-INFECTING SOLANUM LYCOPERSICUM Przemysław

More information

Hierarchical Bayesian Modeling of the HIV Response to Therapy

Hierarchical Bayesian Modeling of the HIV Response to Therapy Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

Host-free period for Tomato yellow leaf curl virus control. Robert L. Gilbertson Department of Plant Pathology University of California-Davis

Host-free period for Tomato yellow leaf curl virus control. Robert L. Gilbertson Department of Plant Pathology University of California-Davis Host-free period for Tomato yellow leaf curl virus control Robert L. Gilbertson Department of Plant Pathology University of California-Davis Integrated Pest Management (IPM) of Insect-Transmitted Plant

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

2011.008a-cB. Code assigned:

2011.008a-cB. Code assigned: This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the

More information

Path-ID Multiplex One-Step RT-PCR Kit

Path-ID Multiplex One-Step RT-PCR Kit USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

CURRICULUM VITAE. Personal data. Surname: Aranda Name: Miguel A. Gender: male National Identity Number: 50812843-R Date of birth: 23/02/1965

CURRICULUM VITAE. Personal data. Surname: Aranda Name: Miguel A. Gender: male National Identity Number: 50812843-R Date of birth: 23/02/1965 CURRICULUM VITAE Personal data Surname: Aranda Name: Miguel A. Gender: male National Identity Number: 50812843-R Date of birth: 23/02/1965 Professional address Organization: Consejo Superior de Investigaciones

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA 1 2 Restriction enzymes were first discovered with the observation that a. DNA is restricted to the nucleus. b. phage DNA is destroyed in a host cell. c. foreign DNA is kept out of a cell. d. foreign DNA

More information

Graph theoretic approach to analyze amino acid network

Graph theoretic approach to analyze amino acid network Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Bacterial Transformation and Plasmid Purification. Chapter 5: Background Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Production of antigens and antibodies in plants: alternative technology?

Production of antigens and antibodies in plants: alternative technology? Production of antigens and antibodies in plants: alternative technology? George Lomonossoff John Innes Centre Norwich, UK ECOPA, Alicante 29 th Sept. 2006 Why use Plants as Biofactories? Produce large

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Highly specific and sensitive quantitation

Highly specific and sensitive quantitation PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information