The molecular epidemiology of HIV-1 has become increasingly

Size: px
Start display at page:

Download "The molecular epidemiology of HIV-1 has become increasingly"


1 EPIDEMIOLOGY AND SOCIAL SCIENCE Intersubtype BF Recombinants of HIV-1 in a Population of Injecting Drug Users in Argentina Alex Espinosa, MS,* Moira Vignoles, MS, Manuel Gómez Carrillo, PhD, Haynes Sheppard, PhD,* Richard Donovan, PhD,* Liliana Martínez Peralta, PhD, Diana Rossi, Graciela Radulich, Horacio Salomón, PhD, and Mercedes Weissenbacher, PhD Summary: The presence of recombinant intersubtypes of HIV-1 in Argentina has been reported since the mid-1990s. In this study, sequences of a region of the gag, pol, and vpu genes of HIV-1 were analyzed in samples of 21 injection drug users (IDUs) residing in the suburbs of the city of Buenos Aires. Genomic characterization and identification of recombination sites were made comparing the 3 regions with reference isolation sequences of subtypes B, F, C, A, and B/F recombinants: CRF12_BF and non-crf12_bf sequences. Subtype assignment of the analyzed segments was phylogenetically confirmed. All the samples turned out to be BF recombinants in at least 1 of the 3 studied genes. Twelve samples (57%) had the same pattern as the Argentinean CRF12_BF, whereas in the rest, the pattern differed in at least 1 of the 3 genes. The relation of these fragments to the CRF12_BF was phylogenetically verified. These results indicate the predominance of BF recombinants and the presence of a high percentage of sequences closely related to the CRF12_BF in the IDU population in Argentina and suggest a possible association between viral variants and the transmission route. Key Words: Argentinean injecting drug user, intersubtype recombinant, circulating recombinant form (J Acquir Immune Defic Syndr 2004;36: ) Received for publication July 10, 2003; accepted September 22, From the *Viral and Rickettsial Disease Laboratory, California Department of Health Services, Richmond, CA; Centro Nacional de Referencia para el SIDA, Departamento de Microbiología, Facultad de Medicina, Universidad de Buenos Aires, Buenos Aires, Argentina ; Intercambios Asociación Civil, Buenos Aires, Argentina; and Asociación El Retoño, Buenos Aires, Argentina. Alex Espinosa was supported by an appointment to the Emerging Infectious Diseases Fellowship Program administered by the Association of Public Health Laboratories and funded by the Centers for Disease Control and Prevention. This work was supported in part by National Institutes of Health cooperative agreement U01-AI46725 and with funds granted by UNAIDS, Pan American Health Organization/World Health Organization, and the Spanish Agency for International Cooperation. Reprints: Manuel Gómez Carrillo, Centro Nacional de Referencia para el SIDA, Facultad de Medicina, Universidad de Buenos Aires. Paraguay 2155 Piso 11 (C1121ABG), Capital Federal, Buenos Aires, Argentina ( Copyright 2004 by Lippincott Williams & Wilkins The molecular epidemiology of HIV-1 has become increasingly important as viral subtypes are becoming more dispersed worldwide. There are currently at least 9 circulating genetic subtypes of HIV-1 (A K) within group M, 1 with subtype B being predominant in Europe, the Americas, and Australia. 2 Although the dominant subtype in South America is B, there is evidence of other subtypes circulating through different regions of the continent, making the epidemic much more complex. 3 6 Recombinants between the B and F subtypes of HIV-1 were described in Brazil 7 and Argentina. 8,9 More recently, Carr et al 10 showed that BF recombinants were temporally and geographically widespread in South America and established a new circulating recombinant form (CRF12_BF) and other recombinants in a heterosexual population from Argentina, Uruguay, and Bolivia. The HIV-1 subtype distribution pattern related to sexual behavior in Argentina was described by partial viral characterization in men who have sex with men (MSM) and heterosexual populations. 5,11 A high percentage of subtype B sequences was found in MSM in contrast to a high percentage of subtype F found in the heterosexual population. These results suggest a close relation between different risk factors and subtype distribution in the Argentinean epidemic during the same period of time. Spreading of HIV-1 recombinant forms in injection drug user (IDU) populations was described in other regions of the world. In some of these epidemics, an explosive dissemination of these genetic variants among the IDU population was seen. In Vietnam and China, genetic diversity of AE recombinants among IDUs was lower than that of persons infected by the sexual route, providing evidence of the recent introduction of these variants in the IDU population In our study, we examined the subtypes and recombination patterns of 3 genomic regions of HIV-1 in a group of IDUs from Argentina and determined their relation to the CRF12_BF previously described in a heterosexual population. METHODS Study Design Study subjects were 75 HIV-1 positive IDUs (61 male and 14 female) from the Buenos Aires city surroundings. The samples were collected from June 2000 to March 2001; however, we used only those plasma specimens for which we were 630 J Acquir Immune Defic Syndr Volume 36, Number 1, May

2 J Acquir Immune Defic Syndr Volume 36, Number 1, May Intersubtype BF Recombinants of HIV-1 able to obtain polymerase chain reaction (PCR) products for all 3 regions of interest (ie, gag, pol, vpu). This resulted in only 21 of the 75 specimens being used in the phylogenetic analysis. Written informed consent was obtained from all the study participants. Along with each specimen, a questionnaire was filled out by the patients regarding sociodemographic parameters, including (among others) gender, age, drug injection frequency, and needle sharing. These parameters were associated with the viral characterization done in this study. Viral Load Plasma HIV-1 viral load was determined by RNA quantification by means of the reverse transcriptase (RT) PCR assay using the Roche Amplicor HIV-1 Monitor test, version 1.5 (Roche Molecular Systems, Branchburg, NJ) with a limit of detection of 400 copies/ml. Detection of Early HIV-1 Infection To determine early HIV-1 infection in the IDU plasma samples, a sensitive/less sensitive enzyme immunoassay (EIA) testing strategy (detuned assay) was used as described by Janssen et al 15 with the Vironostika HIV-1 MicroElisa System (Organon Teknika, Durham, NC). This assay aimed to correlate the time of infection with the subtype characterization so as to estimate the subtypes currently being transmitted in this population. RNA Extraction and Reverse Transcription HIV RNA isolation from plasma was done using the QIAamp Viral RNA Miniprep Kit (Qiagen, Valencia, CA). The reverse transcription of gag and vpu was done using the ThermoScript RT-PCR System (Life Technologies, Rockville, MD) with primer MKenvN (5 CTGCCAATCAGGGAAG- TAGCCTTGTGT 3 ) for vpu and primer G01 (5 AGGGGTC- GTTGCCAAAGA 3 ) for gag. The cycling conditions were as follows: 60 C for 60 minutes and 85 C for 5 minutes. RNA isolation from plasma and reverse transcription of pol were done using the ViroSeq system (Applied Biosystems, Foster City, CA) according to the directions of the manufacturer. Polymerase Chain Reaction The RT-PCR of gag and vpu was followed by a nested PCR. A first-round PCR was run using primer sets MKenvN and MKenvA (5 GGCTTAGGCATCTCCTATGGCAG- GAAGAA 3 ) for vpu or G00 (5 GACTAGCGGAGGCTA- GAAG 3 ) and G01 for gag amplification. The lengths of the first-round PCR products of vpu and gag were 3190 base pairs (bp) and 1467 bp, respectively. A second-round PCR was performed using primer sets ACC7 (5 CTATGGCAGGAA- GAAGCGGAGA 3 ) and ZM140E (5 GGGGTCAACTTTA- CACATGGCTTT3 ) for vpu or G05 (5 TGTTGGCTCTG- GTCTGCTCT 3 ) and G20 (5 GTATGGGCAAGCAGG- GAGCTAGAA 3 ) for gag amplification. The lengths of the second-round PCR products of vpu and gag were 602 bp and 1214 bp, respectively. The cycling conditions for the first- and second-round PCRs for gag were as follows: 94 C for 10 minutes, followed by 35 cycles of 94 C for 1 minute, and 55 C for 1 minute and 72 C for 6 minutes, followed by a final extension at 72 C for 15 minutes. The cycling conditions for the firstand second-round PCRs for vpu were as follows: 94 C for 10 minutes, followed by 35 cycles of 94 C for 1 minute, and 55 C for 1 minute and 72 C for 1 minute, followed by a final extension at 72 C for 15 minutes. DNA Sequencing Subtype characterization of the studied population was performed by sequencing a region of the gag, pol, and vpu genes. The PCR products were purified with a Centricon-1 column (Amicon, Danvers, MA) and then used as a template for direct sequencing on an automated ABI Prism 377 DNA sequencer using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). In addition to the primers used in the second-round PCR amplification, 7 others ZIF (5 TGGGTCACAGTCTATTATGGG- GTACCT 3 ), ES32 (5 CTGCTTTGGTATAGGATCTTG- 3 ), ES34 (5 GCCTGAGCATCTGATGCAC 3 ), JL99 (5 TTTAGCATCTGATGCACAAAATAG 3 ), JL100 (5 GGGGTCTGTGGGTACACAGGCATGTGT 3 ), ZER (5 GGGCTGGGATCTGTGGGCACACAGGCA 3 ), and E18 (5 TTGTGGGTCACAGTCTATTATGG 3 ) were used to determine the vpu sequence, and 3 others G25 (5 ATTGCTTCAGCCAAAACTCTTGC 3 ), G55 (5 ATTT- CTCCCACTGGGATAGGTGG 3 ), and G60 (5 CAGC- CAAAATTACCCTATAGTGCAG 3 ) were used for gag sequencing. The cycling conditions for vpu and gag sequencing were as follows: 25 cycles of 96 C for 10 seconds, 50 C for 5 seconds, and 60 C for 4 minutes. Sequencing products were purified with the DyeEx Spin Kit (Qiagen) before loading the gel. Pol sequences were obtained using the ViroSeq system (Applied Biosystems). Phylogenetic Analysis Nucleotide sequences* obtained from all primers of gag, pol,or vpu were aligned with the reference strain HXB2; subsequently, consensus sequences were constructed for each pa- *The nucleotide sequences reported in this study have been submitted to the GenBank sequence database under the following accession numbers: AY140107, AY140108, AY140109, AY140110, AY140111, AY140112, AY140113, AY140114, AY140115, AY140116, AY140117, AY140118, AY140119, AY140120, AY140121, AY140122, AY140123, AY140124, AY140125, AY140126, AY140127, AY140128, AY140129, AY140130, AY140131, AY140132, AY140133, AY140134, AY140135, AY140136, AY140137, AY140138, AY140139, AY140140, AY140141, AY140142, AY140143, AY140144, AY140145, AY140146, AY140147, AY140148, AY140149, AY140150, AY140151, AY140152, AY140153, AY140154, AY140155, AY140156, AY140157, AY140158, AY140159, AY140160, AY140161, AY140162, AY140163, AY140164, AY140165, AY140166, AY140167, AY140168, and AY Lippincott Williams & Wilkins 631

3 Espinosa et al J Acquir Immune Defic Syndr Volume 36, Number 1, May FIGURE 1. Phylogenetic analysis of 21 injection drug user samples from Argentina. a, Neighbor-joining tree with bootstrapping of gag, pol, and vpu assembled sequences. Branches of a cluster containing samples related to the CRF12_BF are drawn in bold. Significant bootstrap values are placed next to the nodes. The genetic distance corresponding to the length of the branches is shown in the bottom line. b, Genetic map of HIV-1. Shaded areas indicate each assembled segment used in the phylogenetic analysis (, CRF12_BF;, BF recombinant non-crfs) Lippincott Williams & Wilkins

4 J Acquir Immune Defic Syndr Volume 36, Number 1, May Intersubtype BF Recombinants of HIV-1 FIGURE 2. Subtype structure of non-crf12_bf sequences in three HIV-1 genome regions: gag (a), pol (b) and vpu (c). Subtype F (white) and subtype B (gray).subtype structure was determined by visual inspection of aligments and confirmed by phylogenetic analysis. Bootstrap value to confirm the subtype assignment of each segment is based on phylogenetic trees (not shown) and placed in the diagram. Subtype structure of the CRF12_BF prototype (ARMA159) is placed at the top of each gene diagram and the relative position of segments to HXB2 reference strain are established by a ruler. tient sample using the Sequencher version (Gene Codes Corporation, Ann Arbor, MI). Each consensus sequence was then screened by the BLAST 2.0 HIV-1 subtyping program (National Center for Biotechnology Information, Bethesda, MD) to search for sequence similarities to previously reported reference strains in the database and characterized by subtyping each of the patient samples. Boot scanning analysis by means of SimPlot version 2.5 (Stuart Ray, and visual inspection of alignments were used to identify breakpoints. After identification of the breakpoints, subregions of the alignment were analyzed by neighbor-joining with bootstrapping to confirm the subtype assignment. Nucleotide sequences from vpu, gag, and pol regions were assembled and aligned with reference sequences belonging to subtype A (SE7253 and SE7535), subtype B (MN, WR27, and RL42), subtype C (BW15B03 and BW1626), subtype F (VI850, BR020, and FIN9363) as well as with 4 CRF12_BF (ARMA159, ARMA185, URTR23, and URTR35) and 2 B/F recombinant non-crf12_bf (ARMA070 and 2004 Lippincott Williams & Wilkins 633

5 Espinosa et al J Acquir Immune Defic Syndr Volume 36, Number 1, May ARMA062) using ClustalX (Thompson, JD et al, 1997) and visually corrected with BioEdit, version (T. A. Hall, 1999). Phylogenetic trees were constructed by neighborjoining using the Kimura 2-parameter model with the MEGA version 2.1 program (Kumar, S et al, 2001). Bootstrap analysis was done to assess the stability of the nodes. RESULTS The median plasma HIV RNA load in the study population was 167,000 copies/ml. Serologic analysis using the detuned assay demonstrated that none of the patients in this study had evidence of recent seroconversion. The neighbor-joining tree of all 21 gag, pol, and vpu assembled sequences with reference strains showed that all the samples were BF recombinants with a dissimilar distribution (Fig. 1). In spite of the low bootstrapping values, different clusters could be seen in the B/F group. One cluster that included 12 samples more related to the CRF12_BF was identified. The analysis of the detailed subtype structure of the samples was performed by visual inspection of the alignments, and the subtype assignment was confirmed by phylogenetic trees. With this analysis, we were able to observe that those sequences that grouped with the CRF12_BF showed a different mosaic pattern compared with those that grouped with the non-crf12_bf sequences (data not shown). Structure analysis of non-crf12 related samples is shown in Figure 2. Each subtype segment had a bootstrap value ranging between 70% and 100%. Most of the different mosaic patterns were found in the gag gene, in which 7 samples (AR13, AR38, AR50, AR57, AR59, AR60, and AR65) had a diverse BF mosaic pattern in comparison with the CRF12_BF prototype, which is subtype F in this analyzed region (see Fig. 2a). The subtype structure in the pol region revealed that 4 samples (AR27, AR38, AR40, and AR57) had a different mosaic pattern compared with the CRF12_BF prototype (see Fig. 2b), whereas only 2 samples (AR65 and AR60) had differences in the vpu gene structure (see Fig. 2c). Based on these results, we further analyzed the sequences in each gene region. For this, a phylogenetic analysis was done as described previously. Only segments with the same subtype structure as the CRF12_BF were included in each tree. The phylogenetic analysis of each sequenced region revealed the presence of sequences related to the CRF12_BF in gag, pol, and vpu genes (Fig. 3). Bootstrap values for each CRF cluster were 95% in gag (see Fig. 3a), 70% in pol (see Fig. 3b), and 77% in vpu (see Fig. 3c). A total of 12 samples (AR01, AR03, AR19, AR26, AR28, AR36, AR45, AR48, AR53, AR66, AR74, and AR75), representing 57% of the analyzed samples had similar and related sequences to the CRF12_BF in the 3 sequenced genes. In the IDU population, the HIV-1 seroprevalence was 46%. 16 The average age was 31.4 years. The subjects, 17 men and 4 women, reported that 99% had used injected cocaine, 80.0% had 1 or more injections per week, 80.0% had shared needles, 35% had group sex, and 20% had exchanged sex for drugs. Of the 21 IDUs in the study population, 11 answered the question related to therapy. Of these 11 IDUs, 3 were undergoing antiretroviral therapy (27.3%). No significant differences were found when analyzing the association between HIV viral characterization (being or not being closely related to the CRF12_BF) and these sociodemographic parameters (data not shown). DISCUSSION In Argentina, a total of 25,811 AIDS cases were reported as of 2001, 17 with 40% of them related to injecting drug use in both genders (14% for women and 26% for men). The common use of injected cocaine in the Southern Cone of South America was described by others. 18,19 Since 1990, the main HIV transmission route in Argentina has been the use of illegal drug injection, reaching a peak of almost 50% of the new cases reported in This tendency was reversed during 2001 by the increasing rate of heterosexual transmission, which reached 33%. Previous molecular epidemiologic studies with samples from Argentina showed that HIV-1 diversity in this country is complex. Considering the multiple HIV-1 recombinant forms described in the literature and the evidence of the different distribution of HIV-1 among vulnerable populations, early dissemination of these genetic forms in the Argentinean epidemic is apparent. A previous study in the pediatric population revealed that transmission of BF recombinants in Argentina has predominated since the 1980s 20 and provided evidence that similar BF recombinants (but not identical to the CRF12_ BF) have been spread for at least 15 years in the heterosexual population in this country. In our study, a total of 21 plasma samples belonging to HIV-1 positive IDUs were included with the aim of isolating viral RNA and characterizing genomic segments of gag, pol, and vpu genes by automated sequencing. We found that 100% of the 21 studied subjects carried BF intersubtype recombinant virus. On the basis of this finding, BF recombinants appear to predominate in this population. Sequencing results from the vpu, pol, and gag regions, however, showed that these recombinants were not all identical but that 12 samples (57%) had the same recombination pattern as the CRF12_BF. Our results correlate with the findings of Carr et al 10 and Thomson et al, 9,21 which showed high frequencies of BF recombinants in South America. In the heterosexually infected population studied by Carr et al, 10 the CRF12_BF did not represent the predominant genetic form. Our findings show a high prevalence of the CRF12_BF-related sequences in the IDU population, but full-length genome analysis must be performed to be conclusive. Together with the previous studies, our results support the possibility of a common recombinant ancestor, with subsequent recombination giving rise to the suite of BF recombinants now seen in the Lippincott Williams & Wilkins

6 J Acquir Immune Defic Syndr Volume 36, Number 1, May Intersubtype BF Recombinants of HIV-1 FIGURE 3. Phylogenetic analysis of three regions of the HIV-1 genomes from Argentina. Neighbor-joining phylogenetic trees were built for each region: gag (a), pol (b) and vpu (c), and significant bootstrap values are placed next to the nodes. The genetic distance corresponding to the length of the branches is shown in the bottom line. Bold lines indicate the clusters defining the CRF12_BF. CRF12_BF BF Recombinants non CRFs population. In this complex scenario, the IDU population could be associated as a spreading source of BF recombinants among the heterosexual population in the region, but the origin of the CRF12_BF is not yet clear. This study suggests the possible association between viral variants and the transmission route. HIV diversity might have an influence on the efficiency of laboratory techniques used for the monitoring of patients as well as on vaccine development. This study analyzes the molecular pattern of HIV-1 in an IDU population from Argentina and places additional emphasis on the importance of knowledge of subtypes in the epidemiologic evaluation of the spread of HIV-1 in this country. REFERENCES 1. Robertson DL, Anderson JP, Bradac JA, et al. HIV-1 nomenclature proposal. Science. 2000;288: Kuiken C, Thakallapalli R, Esklid A, et al. Genetic analysis reveals epidemiologic patterns in the spread of human immunodeficiency virus. Am J Epidemiol. 2000;152: Russell KL, Carcamo C, Watts DM, et al. Emerging genetic diversity of HIV-1 in South America. AIDS. 2000;14: Marquina S, Leitner T, Rabinovich RD, et al. Coexistence of subtypes B, F, and as B/F env recombinant of HIV type 1 in Buenos Aires Argentina. AIDS Res Hum Retroviruses. 1996;12: Masciotra S, Livellara B, Belloso W, et al. Evidence of a high frequency of HIV-1 subtype F infections in a heterosexual population in Buenos Aires, Argentina. AIDS Res Hum Retroviruses. 2000;16: Velarde-Dunois KG, Guimaraes ML, La Fuente C, et al. Molecular characterization of human immunodeficiency virus type 1-infected individuals from Bolivia reveals the presence of two distinct genetic subtypes B and F. AIDS Res Hum Retroviruses. 2000;16: Ramos A, Tanuri A, Schechter M, et al. Dual and recombinant infections: an integral part of the HIV-1 epidemic in Brazil. Emerg Infect Dis. 1999; 5: Fernandez-Medina D, Jansson M, Rabinovich RD, et al. Identification of human immunodeficiency virus type 1 subtypes B and F B/F recombinant and dual infection with these subtypes in Argentina. Scand J Infect Dis. 1999;31: Thomson MM, Villahermosa ML, Vazquez-de-Parga E, et al. Widespread circulation of a B/F intersubtype recombinant form among HIV-1- infected individuals in Buenos Aires, Argentina. AIDS. 2000;14: Carr JK, Avila M, Gomez Carrillo M. et al. Diverse BF recombinants have spread widely since the introduction of HIV-1 into South America. AIDS. 2001;15(Suppl):F41 F Lippincott Williams & Wilkins 635

7 Espinosa et al J Acquir Immune Defic Syndr Volume 36, Number 1, May Avila MM, Pando MA, Carrion G, et al. Two HIV-1 epidemics in Argentina: different genetic subtypes associated with different risk groups. J Acquir Immune Defic Syndr. 2002;29: Liitsola K, Tashkinova I, Laukkanen T, et al. HIV-1 genetic subtype A/B recombinant strain causing an explosive epidemic in injecting drug users in Kaliningrad. AIDS. 1998;12: Piyasirisilp S, McCutchan FE, Carr JK, et al. A recent outbreak of human immunodeficiency virus type 1 infection in southern China was initiated by two highly homogeneous, geographically separated strains, circulating recombinant form AE and a novel BC recombinant. J Virol. 2000;74: Kato K, Kusagawa S, Motomura K, et al. Closely related HIV-1 CRF01_AE variant among injecting drug users in northern Vietnam: evidence of HIV spread across the Vietnam-China border. AIDS Res Hum Retroviruses. 2001;17: Janssen RS, Satten GA, Stramer SL, et al. New testing strategy to detect early HIV-1 infection for use in incidence estimates and for clinical and prevention purposes. JAMA. 1998;280: Weissenbacher M, Martínez Peralta L, Rossi D, et al. Coinfections with HIV, HBV, HCV, HTLV-I, HTLV-II in injection drug users from Buenos Aires, Argentina [session 45, poster 362]. Presented at the First IAS Conference on HIV Pathogenesis and Treatment, Buenos Aires, July National Ministry of Health, Buenos Aires, Argentina. Boletín sobre el SIDA en la Argentina. Buenos Aires: National Ministry of Health; Libonatti O, Lima E, Peruga A, et al. Role of drug injection in the spread of HIV in Argentina and Brazil. Int J STD AIDS. 1993;4: The status and trends of the HIV/AIDS epidemics in the world. Barcelona Map Symposium Report. Presented at the XIV International AIDS Conference, Barcelona, July Gomez Carrillo M, Avila M, Hierholzer J, et al. Mother-to-child HIV type 1 transmission in Argentina: BF recombinants have predominated in infected children since the mid-1980s. AIDS Res Hum Retroviruses. 2002; 18: Thomson MM, Delgado E, Herrero I, et al. Diversity of mosaic structures and common ancestry of human immunodeficiency virus type 1 BF intersubtype recombinant viruses from Argentina revealed by analysis of near full-length genome sequences. J Gen Virol. 2002;83: Kijak GH, Rubio AE, Quarleri JF, et al. HIV type 1 genetic diversity is a major obstacle for antiretroviral drug resistance hybridization-based assays. AIDS Res Hum Retroviruses. 2001;17: Kijak GH, Carobene MG, Salomon H. A highly prevalent polymorphism at codon 72 of HIV-1 reverse transcriptase in Argentina prevents hybridization reaction at codon 74 in the LiPA genotyping test. J Virol Methods. 2001;94: Mercado JM, Di Dio R, Pradal M. Genetic diversity of HIV-1 subtype F from Brazil: failure of HIV-1 viral load testing based on molecular biology amplification methods. AIDS. 1999;13: Lippincott Williams & Wilkins

Viral load testing. medical monitoring: viral load testing: 1

Viral load testing. medical monitoring: viral load testing: 1 medical monitoring: viral load testing: 1 medical monitoring: viral load testing Viral load testing medical monitoring: viral load testing: 2 Slide 1 Viral load The viral load test measures HIV in the

More information

Likely Female-to-Female Sexual Transmission of HIV Texas, 2012

Likely Female-to-Female Sexual Transmission of HIV Texas, 2012 Morbidity and Mortality Weekly Report (MMWR) Likely Female-to-Female Sexual Transmission of HIV Texas, 2012 Weekly March 14, 2014 / 63(10);209 212 Shirley K. Chan, MPH1, Lupita R. Thornton1, Karen J. Chronister,

More information

Rapid HCP5 single-nucleotide polymorphism genotyping: a simple allele-specific PCR method for prediction of hypersensitivity reaction to Abacavir.

Rapid HCP5 single-nucleotide polymorphism genotyping: a simple allele-specific PCR method for prediction of hypersensitivity reaction to Abacavir. A simple allele-specific polymerase chain reaction method to detect the Gly143Glu polymorphism in the human carboxylesterase 1 gene: importance of genotyping for pharmacogenetic treatment. Walter Soria

More information

Molecular Diagnosis of Hepatitis B and Hepatitis D infections

Molecular Diagnosis of Hepatitis B and Hepatitis D infections Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication

More information

Using HIV Surveillance Data to Calculate Measures for the Continuum of HIV Care

Using HIV Surveillance Data to Calculate Measures for the Continuum of HIV Care Using HIV Surveillance Data to Calculate Measures for the Continuum of HIV Care Anna Satcher Johnson, MPH Symposium on Measuring the HIV Care Continuum Center for AIDS Research University of Washington

More information

HEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis

HEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis HEPATITIS WEB STUDY Acute C Virus Infection: Epidemiology, Clinical Features, and Diagnosis H. Nina Kim, MD Assistant Professor of Medicine Division of Infectious Diseases University of Washington School

More information

Case Finding for Hepatitis B and Hepatitis C

Case Finding for Hepatitis B and Hepatitis C Case Finding for Hepatitis B and Hepatitis C John W. Ward, M.D. Division of Viral Hepatitis Centers for Disease Control and Prevention Atlanta, Georgia, USA Division of Viral Hepatitis National Center

More information

The number of people living with HIV/AIDS continues to grow, estimated to be 39.5 million as

The number of people living with HIV/AIDS continues to grow, estimated to be 39.5 million as Focused Issue of This Month Epidemiology of HIV/AIDS - Current Status, Trend and Prospect - Kang Won Choe, MD Department of Internal Medicine, Seoul National University College of Medicine Email :

More information

Increase of sexually transmitted hepatitis C virus in HIV+ men who have sex with men in Barcelona, Spain. A problem linked to HIV infection?

Increase of sexually transmitted hepatitis C virus in HIV+ men who have sex with men in Barcelona, Spain. A problem linked to HIV infection? Increase of sexually transmitted hepatitis C virus in HIV+ men who have sex with men in Barcelona, Spain. A problem linked to HIV infection? S. Manzanares-Laya 1, P. García de Olalla 1,2, C. Garriga 1,3,

More information

Poor access to HCV treatment is undermining Universal Access A briefing note to the UNITAID Board

Poor access to HCV treatment is undermining Universal Access A briefing note to the UNITAID Board Poor access to HCV treatment is undermining Universal Access A briefing note to the UNITAID Board The growing crisis of HIV/HCV coinfection It is estimated that 4-5 million people living with HIV (PLHIV)

More information

Housing Status and HIV Risk Behaviors Among Homeless and Housed Persons With HIV

Housing Status and HIV Risk Behaviors Among Homeless and Housed Persons With HIV BRIEF REPORT: EPIDEMIOLOGY AND SOCIAL SCIENCE Housing Status and HIV Risk Behaviors Among Homeless and Housed Persons With HIV Daniel P. Kidder, PhD, Richard J. Wolitski, PhD, Sherri L. Pals, PhD, and

More information

1 2 3 4 5 6 Figure 4.1: Gel picture showing Generation of HIV-1subtype C codon optimized env expressing recombinant plasmid pvax-1:

1 2 3 4 5 6 Figure 4.1: Gel picture showing Generation of HIV-1subtype C codon optimized env expressing recombinant plasmid pvax-1: Full-fledged work is in progress towards construction and cloning of codon optimized envelope with subsequent aims towards immunization of mice to study immune responses. 1 2 4 5 6 Figure 4.1: Gel picture

More information

HIV Drug Resistance in the Asia- Pacific

HIV Drug Resistance in the Asia- Pacific HIV Drug Resistance in the Asia- Pacific David A Cooper National Centre in HIV Epidemiology and Clinical Research The University of New South Wales Sydney, Australia HIVDR in Asia Pacific Transmitted resistance

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Coinfection and Superinfection in Patients with Long-Term, Nonprogressive HIV-1 Disease

Coinfection and Superinfection in Patients with Long-Term, Nonprogressive HIV-1 Disease BRIEF REPORT Coinfection and Superinfection in Patients with Long-Term, Nonprogressive HIV-1 Disease Concepción Casado, 1 Maria Pernas, 1 Tamara Alvaro, Virginia Sandonis, 1 Soledad García, 2 Carmen Rodríguez,

More information

Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics

Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics Taj Azarian, MPH Doctoral Student Department of Epidemiology College of Medicine and College

More information

Lessons from the Stanford HIV Drug Resistance Database

Lessons from the Stanford HIV Drug Resistance Database 1 Lessons from the Stanford HIV Drug Resistance Database Bob Shafer, MD Department of Medicine and by Courtesy Pathology (Infectious Diseases) Stanford University Outline 2 Goals and rationale for HIVDB

More information

The use of alcohol and drugs and HIV treatment compliance in Brazil

The use of alcohol and drugs and HIV treatment compliance in Brazil The use of alcohol and drugs and HIV treatment compliance in Brazil André Malbergier, MD, PhD Hospital das Clínicas Medical School University of São Paulo Brasil The Casa da AIDS offers specialized integral

More information

The Basics of Drug Resistance:

The Basics of Drug Resistance: CONTACT: Lisa Rossi +1-412-641-8940 +1-412- 916-3315 (mobile) The Basics of Drug Resistance: QUESTIONS AND ANSWERS HIV Drug Resistance and ARV-Based Prevention 1. What is drug resistance?

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

CONTENTS. Brief introduction. Epidemiology. Diagnosis LOGO. D. Batchuluun, B. Batsuren, Ts. Badamsuren, Ts. Erdene-Ochir, J.

CONTENTS. Brief introduction. Epidemiology. Diagnosis LOGO. D. Batchuluun, B. Batsuren, Ts. Badamsuren, Ts. Erdene-Ochir, J. УЛСЫН МАЛ ЭМНЭЛЭГ АРИУН ЦЭВРИЙН ТӨВ ЛАБОРАТОРИ STATE CENTRAL VETERINARY LABORATORY SCVL 26 September 2008 D. Batchuluun, B. Batsuren, Ts. Badamsuren, Ts. Erdene-Ochir, J. Bekh-Ochir CONTENTS 1 2 3 Brief

More information


WISCONSIN AIDS/HIV PROGRAM NOTES Wisconsin 2014 HIV Care Continuum: Statewide and Select Population Groups Casey Schumann, MS, AIDS/HIV Program Epidemiologist, AIDS/HIV Program, Wisconsin Division of Public Health Background The HIV care

More information


Report to UNAIDS HIV/AIDS TRENDS IN JAPAN April 2016 Report to UNAIDS HIV/AIDS TRENDS IN JAPAN April 2016 I. Status at a glance The AIDS Surveillance Committee holds quarterly meeting to compile the annual report on the trends of new reported cases of HIV

More information

Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI. Ombretta Turriziani Dipartimento di Medicina Molecolare

Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI. Ombretta Turriziani Dipartimento di Medicina Molecolare Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI Ombretta Turriziani Dipartimento di Medicina Molecolare Dosaggi Sierologici e Molecolari nelle Epatiti B e C Molecular Methods Key

More information

Guidelines for Viral Hepatitis CTR Services

Guidelines for Viral Hepatitis CTR Services Guidelines for Viral Hepatitis CTR Services During the 2007 North Dakota Legislative Assembly, legislation that called for the creation of a viral hepatitis program was introduced and approved. The North

More information

Estimates of New HIV Infections in the United States

Estimates of New HIV Infections in the United States Estimates of New HIV Infections in the United States Accurately tracking the HIV epidemic is essential to the nation s HIV prevention efforts. Yet monitoring trends in new HIV infections has historically

More information

Tuberculosis and HIV/AIDS Co-Infection: Epidemiology and Public Health Challenges

Tuberculosis and HIV/AIDS Co-Infection: Epidemiology and Public Health Challenges Tuberculosis and HIV/AIDS Co-Infection: Epidemiology and Public Health Challenges John B. Kaneene, DVM, MPH, PhD University Distinguished Professor of Epidemiology Director, Center for Comparative Epidemiology

More information

Branched DNA Technology in Molecular Diagnostics

Branched DNA Technology in Molecular Diagnostics Microbiology and Infectious Disease / BRANCHED DNA DIAGNOSTICS Branched DNA Technology in Molecular Diagnostics Gregory J. Tsongalis, PhD Key Words: Microbiology; Virology; Molecular diagnostics DOI: 10.1309/90BU6KDXANFLN4RJ

More information

João Silva de Mendonça, MD, PhD Infectious Diseases Service Hospital do Servidor Público Estadual São Paulo - Brazil

João Silva de Mendonça, MD, PhD Infectious Diseases Service Hospital do Servidor Público Estadual São Paulo - Brazil Brazilian Ministry of Health, Brazilian Society of Hepatology PAHO, Viral Hepatitis Prevention Board PART III SESSION 9 Prevention and control of Viral Hepatitis in Brazil HEPATITIS IN SPECIAL RISK GROUPS/

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

Trends in Human Immunodeficiency Virus Infection among Drug Users in a Detoxification Unit

Trends in Human Immunodeficiency Virus Infection among Drug Users in a Detoxification Unit SUPPLEMENT ARTICLE Trends in Human Immunodeficiency Virus Infection among Drug Users in a Detoxification Unit Roberto Muga, Arantza Sanvisens, José Manuel Egea, Jordi Tor, and Celestino Rey-Joly Department

More information


PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS

More information

Estimates of New HIV Infections in the United States

Estimates of New HIV Infections in the United States Estimates of New HIV Infections in the United States CDC HIV/AIDS Fa c t s A u g u s t 28 Accurately tracking the HIV epidemic is essential to the nation s HIV prevention efforts. Yet monitoring trends

More information

Viral Hepatitis. 2009 APHL survey report

Viral Hepatitis. 2009 APHL survey report Issues in Brief: viral hepatitis testing Association of Public Health Laboratories May Viral Hepatitis Testing 9 APHL survey report In order to characterize the role that the nation s public health laboratories

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Epidemiology of Hepatitis C Infection. Pablo Barreiro Service of Infectious Diseases Hospital Carlos III, Madrid

Epidemiology of Hepatitis C Infection. Pablo Barreiro Service of Infectious Diseases Hospital Carlos III, Madrid Epidemiology of Hepatitis C Infection Pablo Barreiro Service of Infectious Diseases Hospital Carlos III, Madrid Worldwide Prevalence of Hepatitis C 10% No data available WHO.

More information

HIV Surveillance Update

HIV Surveillance Update HIV Surveillance Update Presentation to: CAPUS Metro Atlanta Testing and Linking Consortium (MATLC) Presented by: Deepali Rane, MPH and Jane Kelly, MD Georgia Department of Public Health Epidemiology Date:

More information



More information


EPIDEMIOLOGY OF HEPATITIS B IN IRELAND EPIDEMIOLOGY OF HEPATITIS B IN IRELAND Table of Contents Acknowledgements 3 Summary 4 Introduction 5 Case Definitions 6 Materials and Methods 7 Results 8 Discussion 11 References 12 Epidemiology of Hepatitis

More information

Quantitative HBV DNA measurements and the management of infected health care workers

Quantitative HBV DNA measurements and the management of infected health care workers Quantitative HBV DNA measurements and the management of infected health care workers A.A. van der Eijk Department of Virology, Erasmus MC, Rotterdam, the Netherlands Introduction Worldwide since 1970s,

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

Realtime PCR Master Mix

Realtime PCR Master Mix Instruction manual Realtime PCR Master Mix 0810 F0923K Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol 1. TaqMan assay

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

About Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR

About Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR About Our Products Purified Infectious/Inactivated Agents ABI produces a variety of specialized reagents, allowing researchers to choose the best preparations for their studies. Available reagents include

More information

Richard H. Needle, PhD, MPH Lin Zhao, PhD candidate (UCSF School of Nursing) CSIS Africa Program Roundtable June 10, 2010

Richard H. Needle, PhD, MPH Lin Zhao, PhD candidate (UCSF School of Nursing) CSIS Africa Program Roundtable June 10, 2010 Richard H. Needle, PhD, MPH Lin Zhao, PhD candidate (UCSF School of Nursing) CSIS Africa Program Roundtable June 10, 2010 Reference Group to the United Nations on HIV and Injecting Drug Use 2010 Mathers:

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

D Candotti. Institut National de la Transfusion Sanguine Dept. Agents Transmissibles par le Sang Paris, France

D Candotti. Institut National de la Transfusion Sanguine Dept. Agents Transmissibles par le Sang Paris, France Molecular characterization of hepatitis B virus strains infecting blood donors with high HBsAg and undetectable HBV DNA levels: implications for blood safety and screening policy D Candotti Institut National

More information

Testing for HIV Drug Resistance

Testing for HIV Drug Resistance State of the Art Testing for HIV Drug Resistance Victor S.B. Jorden, MD, MPH Sindy M. Paul, MD, MPH Today, many patients with HIV infection are able to live longer and better lives, owing to the use of

More information

State of Alabama HIV Surveillance 2012 Annual Report Finalized

State of Alabama HIV Surveillance 2012 Annual Report Finalized State of Alabama HIV Surveillance 212 Annual Report Finalized Prepared by: Division of HIV/AIDS Prevention and Control HIV Surveillance Branch Contact Person: Allison R. Smith, MPH

More information

HIV surveillance in Northern Ireland 2014

HIV surveillance in Northern Ireland 2014 HIV surveillance in Northern Ireland 2014 Contents Page 1 Surveillance arrangements 3 2 Introduction and key points 4 3 Trend information 5 - New diagnoses Route of transmission Age and gender CD4 surveillance

More information

Human T cell lymphotropic virus type 2 (HTLV-2) was

Human T cell lymphotropic virus type 2 (HTLV-2) was AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 30, Number 1, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/aid.2013.0181 SEQUENCE NOTES Molecular Characterization of the Human T Cell Lymphotropic Virus Type

More information

HIV drug resistance acquired through superinfection

HIV drug resistance acquired through superinfection HIV drug resistance acquired through superinfection Davey M. Smith a, Joseph K. Wong a,b,d, George K. Hightower a, Caroline C. Ignacio a, Kersten K. Koelsch a, Christos J. Petropoulos c, Douglas D. Richman

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Prospects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS

Prospects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS Prospects for Vaccines against Hepatitis C Viruses T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS HCV Vaccine Prevention strategies Protective immunity Barriers and solutions Vaccine candidates

More information

Liver Disease and Therapy of Hepatitis B Virus Infections

Liver Disease and Therapy of Hepatitis B Virus Infections Liver Disease and Therapy of Hepatitis B Virus Infections University of Adelaide Catherine Scougall Arend Grosse Huey-Chi Low Allison Jilbert Fox Chase Cancer Center Chunxiao Xu Carol Aldrich Sam Litwin

More information

Epidemiology of HIV in NSW residents newly diagnosed with HIV infection up to 31 December 2013

Epidemiology of HIV in NSW residents newly diagnosed with HIV infection up to 31 December 2013 Epidemiology of HIV in NSW residents newly diagnosed with HIV infection up to December 0 Sections Page Summary Time trend in the HIV epidemic in NSW 4 Demographics of NSW residents newly diagnosed with

More information

HIV Drug resistanceimplications

HIV Drug resistanceimplications HIV Drug resistanceimplications for therapy Deenan Pillay Africa Centre for Health and Population Studies, UKZN University College London Potential implications of HAART without virological monitoring:

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer From the Dolan DNA Learning Center Cold

More information

Targeted HIV Testing & Enhanced Testing Technologies. HIV Prevention Section Bureau of HIV/AIDS

Targeted HIV Testing & Enhanced Testing Technologies. HIV Prevention Section Bureau of HIV/AIDS Targeted HIV Testing & Enhanced Testing Technologies HIV Prevention Section Bureau of HIV/AIDS May 2012 1 Typing a Question in the Chat Box Type question in here 2 Completing the Webinar Evaluation (opened

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Placing Nation on the Path Toward the Elimination of Hepatitis C

Placing Nation on the Path Toward the Elimination of Hepatitis C Placing Nation on the Path Toward the Elimination of Hepatitis C John W. Ward, M.D. Division of Viral Hepatitis Centers for Disease Control and Prevention Division of Viral Hepatitis National Center for

More information

Illinois Influenza Surveillance Report

Illinois Influenza Surveillance Report ILLINOIS DEPARTMENT OF PUBLIC HEALTH Illinois Influenza Surveillance Report Week 8: Week Ending Saturday, February 25, 2012 Division of Infectious Diseases Immunizations Section 3/5/2012 1 Please note

More information

When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII)

When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII) XI. OCCUPATIONAL EXPOSURES TO HEPATITIS B AND C RECOMMENDATION: When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII) The risk of transmission

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to

excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to FUTURE DIRECTIONS Historically, attempts to control deadly viruses, such as SARS and

More information


INJECTION DRUG USE AND ITS INTERVENTIONS IN AFRICA: THE FORGOTTEN CONTINENT Some Examples From Tanzania INJECTION DRUG USE AND ITS INTERVENTIONS IN AFRICA: THE FORGOTTEN CONTINENT Some Examples From Tanzania Jessie Kazeni MBWAMBO, Senior Researcher and Psychiatrist (Muhimbili University Teaching Hospital)

More information

Dublin Declaration. on Partnership to fight HIV/AIDS in Europe and Central Asia

Dublin Declaration. on Partnership to fight HIV/AIDS in Europe and Central Asia Dublin Declaration on Partnership to fight HIV/AIDS in Europe and Central Asia Against the background of the global emergency of the HIV/AIDS epidemic with 40 million people worldwide living with HIV/AIDS,

More information

Implementation of a near real-time phylogenetic monitoring program for HIV transmission outbreaks

Implementation of a near real-time phylogenetic monitoring program for HIV transmission outbreaks Implementation of a near real-time phylogenetic monitoring program for HIV transmission outbreaks Art FY Poon 1,2, Conan K Woods 1, Susan Shurgold 1, Guillaume Colley 1, Robert S Hogg 1,3, Mel Krajden

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information


COMMUNICABLE DISEASE Public Health Activities & Services Inventory Technical Notes COMMUNICABLE DISEASE CLINICAL SERVICES, SURVEILLANCE AND CONTROL In 2014, decision was made to adopt number of national public health activities

More information

HBV DNA < monitoring interferon Rx

HBV DNA < monitoring interferon Rx Hepatitis B Virus Suspected acute hepatitis >>Order: Acute Unknown hepatitis screen Suspected chronic hepatitis >>Order: Chronic unknown hepatitis screen Acute HBV or Delayed Anti HBs response after acute

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Global epidemiology of sexually transmitted HIV infection and communitylevel prevention strategies

Global epidemiology of sexually transmitted HIV infection and communitylevel prevention strategies Global epidemiology of sexually transmitted HIV infection and communitylevel prevention strategies Patrick Sullivan, DVM, PhD Emory University, Atlanta Georgia 1 Main messages Most HIV infections globally

More information

biomérieux HIV-1 Viral Load Solution Novel approach to HIV viral load measurement in plasma and DBS

biomérieux HIV-1 Viral Load Solution Novel approach to HIV viral load measurement in plasma and DBS biomérieux HIV-1 Viral Load Solution Novel approach to HIV viral load measurement in plasma and DBS Véronique Baron-Wunderle HIV & AIDS: A Global disease 5 new HIV infections every minute 4 AIDS-related

More information

HIV-Associated Risk Behaviour Among Drug Users at Drug Rehabilitation Centres

HIV-Associated Risk Behaviour Among Drug Users at Drug Rehabilitation Centres , ORIGINAL ARTICLE HIV-Associated Risk Behaviour Among Drug Users at Drug Rehabilitation Centres M N Fauziah, MD, S Anita, MD, B N Sha'ari, MD, B I RosH, MD Introduction HIV infection and AlDS is a major

More information

in hiv diagnostics the role of phls

in hiv diagnostics the role of phls Issues in Brief: HIV Diagnostics UPDATE Association of Public Health Laboratories August 2011 Conference calls Focus on New trends in hiv diagnostics the role of phls In February 2011, the Association

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Commonly Asked Questions About Chronic Hepatitis C

Commonly Asked Questions About Chronic Hepatitis C Commonly Asked Questions About Chronic Hepatitis C From the American College of Gastroenterology 1. How common is the hepatitis C virus? The hepatitis C virus is the most common cause of chronic viral

More information


NON-OCCUPATIONAL POST EXPOSURE PROPHYLAXIS (npep) NON-OCCUPATIONAL POST EXPOSURE PROPHYLAXIS (npep) Guidance from the Michigan Department of Health and Human Services Division of Health, Wellness & Disease Control Revised June 2015 The Michigan Department

More information

Beginner's guide to Hepatitis C testing and immunisation against hepatitis A+B in general practice

Beginner's guide to Hepatitis C testing and immunisation against hepatitis A+B in general practice Beginner's guide to Hepatitis C testing and immunisation against hepatitis A+B in general practice Dr Chris Ford GP & SMMGP Clinical Lead Kate Halliday Telford & Wrekin Shared Care Coordinator Aims Discuss:

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

2015 Outpatient Chronic Hepatitis B Management

2015 Outpatient Chronic Hepatitis B Management 2015 Outpatient Chronic Hepatitis B Management Hepatitis B Hepatitis B Info 70% of acute infections are subclinical More severe symptoms when in addition to other liver disease Fulminant Hepatitis

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Null Alleles in Genetic Genealogy. Thomas Krahn

Null Alleles in Genetic Genealogy. Thomas Krahn Null Alleles in Genetic Genealogy 0 Thomas Krahn FTDNA Conference 200 Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

More information

Annual Surveillance Report 2014 Supplement

Annual Surveillance Report 2014 Supplement HIV in Australia Annual Surveillance Report 2014 Supplement Main findings A total of 1 236 cases of HIV infection were newly diagnosed in Australia in 2013, similar to levels in 2012 when the number of

More information

Syphilis on the rise again in Germany results from surveillance data for 2011

Syphilis on the rise again in Germany results from surveillance data for 2011 Rapid communications Syphilis on the rise again in Germany results from surveillance data for 2 V Bremer (, U Marcus, O Hamouda. Division for HIV/AIDS, STI and Blood-borne Infections, Department

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

HIV/AIDS in the Binghamton Tri-County Region Revised June 2007

HIV/AIDS in the Binghamton Tri-County Region Revised June 2007 HIV/AIDS in the Binghamton Tri-County Revised June 2007 HIV is the virus that causes AIDS. You can be infected with HIV but not diagnosed with AIDS. The Centers for Disease Control (CDC) estimated that

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information