real-time and early diagnostic of diseases

Size: px
Start display at page:

Download "real-time and early diagnostic of diseases"

Transcription

1 2º eminario en Nanociencia 15 Nov La Habana, Cuba Lab-on-a-chip nanobiosensor platforms for real-time and early diagnostic of diseases U8 microchannel ilicon xide (wg cladding layer) ilicon Nitride (wg core layer) Prof. Laura M. Lechuga Nanobiosensors and Molecular Nanobiophysics Group Reseach Center on Nanoscience and Nanotechnology (CIN2: CIC-ICN) CIBER on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN) Barcelona (pain) 1

2 Research Centre on Nanoscience and Nanotechnology CIN2 (CIC-ICN) ICN) (Campus UAB, Barcelona, pain) MULTIDICIPLINARY REEARCH Nanoionics, nanooptics, nanomagnetism ynthesis of nanoparticles urface nanostructuring Nanoestructured hybrid materials Transport in nanoentities (CNT) Nanobiosensors, Nanobiophysics Nanotechnology for energy Toxicity of Nanotechnology Common research with ALBA synchrotron Building will be ready in summer Fully running at the end Research Groups running, more than 150 people. Centre for 250 persons m 2. Acess to the largest Clean Room in pain (CNM-CIC) with nanotech area. TECHNLGICAL TRANFER ENIA, L ENDR, L More information in 2

3 utline Introduction: Nanomedicine, Nanodiagnostics, Biosensors Nanobiosensors for diagnostics Plasmonic sensors Integrated Nanophotonic sensors Nanomechanical sensors Lab-on-a-chip microsystems Applications: Early detection of cancer Future perspectives 3

4 MATERIAL CNTs, NPs Nanowires Nanoparticles Graphene Nanocomposites Qdots MEDICINE Dockers PRPECT IN NANTECHNLGY ELECTRNIC Fuel cells olar cells Bateries Ultracapacitors ENERGY Boeing, 2008 Molecular electronics Nanochips Wereable electronics MP3, GP 4

5 What is Nanomedicine? Application of materials, devices and process from Nanotechnology to develop nano-sized tools for the diagnosis, prevention and treatment of diseases, mainly at the initial stage. Nanodiagnostics: Nanosensors, imaging Nanomedicine Targeted Drug Delivery Regenerative Medicine: Gene Therapy Cell Therapy Tissue Engineering To improve the prevention, diagnosis and therapy in Human Health Find, fight and follow The ultimate goal is to improve the quality of life 5

6 BIENR DEVICE ample Bioreceptor layer Aptámero ELECTRCHEMICALAmplification and data 3ensibles Transducer - amperométricos 3 representation Miniaturización y multiplexado - potenciométricos ² Mediadores para amplificar la - conductométricos with high sensitivity señal based on specific Devices ADN that detect substances Polímero de biomolecular recognition, in real-time and fast (sc to min.) 3 Altamente sensible PTICAL Transductor huella 3 Técnica robusta y reproducible - absorption organic contaminants, DNA, pathogens, molecular ubstances to be detected: proteins,- fluorescence 3 Alta capacidad de multiplexado y Transductor virus, bacteria, biowarfare agents... Transductor Analito= ustrato Productos - evanescent wave miniaturización NANBIENR MECHANICAL 3 ensibles 3 Miniaturización y multiplexado - piezoelectric Principio de funcionamiento poco - nanomechanical the reduced weight² and size, establecido + Drastic reduction of Reacción and of the sensor area: reduce amount of reagents enzimáticaanticuerpo and samples. Transductor Enzima New transducers of higher sensitivity Transductor 6

7 --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH NANBIENR The key is the bioengineering of the sensor interface Nanobiostructures 1.5 nm NPs Antibody Binding ite 16 nm Transducer surface riented, stable, optimal surface densidad superficial óptima, no adsorciones inespecíficas Nanoarrays nanosensor CNTs 7

8 Lab-on-a-chip nanobiosensor microsystem Lab-on-a-chip Nanobiosensores Microfluidica Electrónica y procesado datos fuentes y detectores ome applications Drug development Cancer research Microbiology Food industry Aim Targeted and rapid design of new active ingredients Identification of cancer genes and individual Classification of microorganisms Analysis of various disease pathogens in food PCT point-of care testing precision sensitivity selectivity label-free fast stability no pre-treatment Instant Diagnostic In any place at any time Can operate inside the human body 8

9 PLAMNIC NANBIENR 9

10 urface Plasmon Resonance Biosensor (PR) PR working principle External Medium ε d Analyte Receptor P k x Au 45 nm ε m Metallic layer θ k P = k 0 ε m ε d ε + ε d m k = xp 2 π λ ε sin θ P Determination of refractive index changes as a variation of the Resonance angle Reflectivity R pp urface plasmon excitation Au - nd1 Au - nd Angle of incidence (º) Displacement = change in refractive index TM-polarised, 670 nm Reflectance 0,55 0,50 0,45 0,40 0,35 0,30 n 1 0,25 0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 Time (min) n 2 n min ~ 10-5 Real-time detection of refractive index variations due to molecular interactions at a fixed angle 10

11 Plasmonic Biosensor (PR) Portable device, two channels FLW CELL V=300 νl flow rate = µl/min θ GLD FILM d = 45 nm PRIM θ BEAMPLITTER i-phtdetectr 5 mm LAER λ = 670 nm ensor module (old version, new one will be release at the end 08) electronics H N H N H N H N H N H N H N H N H N H N H N H N Au Immobilization and regeneration oftware Wireless transmission module Flow delivery ystem 11

12 PR Biosensor: applications PR IGNAL Environmental toxic pollutants in real samples (water safety) Detection limit: µg/l (ppt level, EU legislation, 0.1 µg/l) INHIBITIN IMMUNAAY DDT Chlorpyrifos Carbaryl PR IGNAL 120 MiliQ Water Drinking Water River Water 100 Groundwater E-6 1E-5 1E-4 1E-3 0,01 0, Analyte concentration (µg L -1 ) 0 1E-4 1E-3 0,01 0, Chlorpyrifos (µg L -1 ) Direct detection in real water samples More than 200 regenerable Monoclonal antibodies Validated results Anal. Bioanal. Chem. 387, 1449 (2007) Biosens.& Bioelec. 22, 1410 (2007) Anal. Bioanal. Chem. 388, 207 (2007) ens.actu. B 118, 399 (2006) Talanta 69 (2), 359 (2006) Anal. Chim. Acta 561, 40 (2006) Biosens.& Bioelec.21, 2129 (2006) No pre-treatment, fast Cycle of analysis 20 min up to 6 analytes same analysis!! 12

13 PR Biosensor: Clinical diagnosis in human samples (urine, serum) Human Growth hormone Luteinizing hormone (hlh), Folicle stimulating hormone (FH) PR IGNAL Detection limit: 6 ng/ml Human serum Urine PBT -10 1E-6 1E-5 1E-4 1E-3 0,01 0, hgh ng/ml PEN THE WAY T DIRECT DETECTIN F CANCER hghµg/ml BIMARKER IN HUMAN FLUID Growth hormone concentration in human samples (serum) ample PR ELIA ELIA PR Direct detection in real human samples No pre-treatment Detection at physiological levels More than 100 regenerable Validated results Fast Low sample volume 13

14 PR Biosensor: Early cancer diagnostics EARLY DETECTIN F INHERITED BREAT CANCER Detection of point mutations at BRCA-1 Normal equence Breast cancer cells displaying mutations at BRCA genes equence with a mismatch BRCA-1 sequence (5,711kb) 5 3 BRCA-1 Gene PR ensor DNA probe (28 mer):5 -H-(CH 2 ) 6 -(15T)-GTT CTG TCA AAC T-3 185delAG 916delTT R1443X 5382insC Covalent attachment of thiol-derivatized DNA probes DNA self-assembled monolayers (ptimisation of buffer concentration, stringency conditions, 185delAG = two bases (AG) deletion 916delTT = two bases (TT) deletion R1443X = C to T transition 5382insC = one base insertion DNA target (58 mer): 5 TGC CAC ATG GCT CCA CAT GCA AGT TTG ACA GAA CTA CCC TGA TTT TCT H H GCA C 3 DNA (mutations):5 - TGC CAC ATG GCT CCA CAT GCA AGT TTG AAA CA GAACTAC CCT GAT ACT TTT aditives, lateral and vertical spacers, Tª,) CTG GAT GCC -3 H H H H Au H H H 14

15 PR Biosensor: Early cancer diagnostics Hybridisation detection Detection of mutations Change on refractive index 49,0 48,5 48,0 47,5 47,0 46,5 46,0 Complementary 5µM Control 5µM Indice de refraccion (u.a) 1,4 1,2 1,0 0,8 0,6 0,4 0,2 0,0 Complementario Mismatch externo Mismatch interno ecuencia control V= 1,16 V= 0,96 V= 0,89 Refractive index (a.u) Time (s) Non stringent conditions LD = 10 nm 0,01 0,1 1 Concentration (µm) Refractive index (au) 1,4 1,3 1,2 1,1 1,0 0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0,0-0, Tiempo (s) High stringent conditions MeanComp meanme meanmi Boltzmann fit of CalibC1x_MeanComp Boltzmann fit of CalibC1x_meanME Boltzmann fit of CalibC1x_meanMI 0,1 1 High stringent conditions C 1X Concentration (µm) 15

16 Hybridization with PCR oligos-like: Tetra-analyte detection format 185delAG = two bases (AG) deletion 916delTT = two bases (TT) deletion R1443X = C to T transition 5382insC = one base (C) insertion 1,6 2:1:1:2 configuration 916delTT-MR 125nM C5X-F5% 916delTT-WT 125nM C5X-F5% 2:1:1:2 configuration 185delAG-MR 125nM C5X-F20% 185delAG-WT 125nM C5X-F20% PR signal (a. u.) 1,4 1,2 1,0 0,8 0,6 Gene BRCA-1 PR signal (a. u.) 0,6 0,4 0,2 0,4 0,2 0, ,0 0 2:1:1:2 configuration R1443X-MR 125nM C5X-F5% R1443X-WT 125nM C5X-F5% Time (s) 1,4 1,2 2:1:1:2 configuration Time (s) 5382insC-MR 125nM C5X-F5% 5382insC-WT 125nM C5X-F5% PR signal (a. u.) 1,2 1,0 0,8 0,6 0,4 0,2 0, Time (s) DNA Extraction Patient PCR ensor chip Time scale: less than 1 hour BRCA-1 sequence (5,711kb) pb 1013 pb 3 63/61 pb 185delAG 58/60 pb 916delTT GCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAA AATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAA CCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTG CATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG TGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACA AGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGA AAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTAT GCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCC TGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGG GCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACC CGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAA CTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATT GGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTT ATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCC TCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAA AAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATAC TGAACATCATCAACCCAGTAATAATGATTTGAACACCACTG AGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGG GTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCAC AAATACTCATGCCA 66 pb R1443X 66/67 pb 5382insC PR signal (a. u.) 1,0 0,8 0,6 0,4 0,2 0,0 TTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTG A/C G AAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTT CACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGA AGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGT TCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCAT CCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATG CACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCAT CTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCA ACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACA TCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACC TGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCT GATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTG GCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAA TTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTC ATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGT GTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAA GGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGAC CCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAA CACCACATCACTTTAACTAATCTAATTACTGAAGAGACTAC TCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAAC GGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATG GGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAAGAAA GAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGA TGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCA AGAGAATCC CAGGACAGAAAGATCTTCAGGGGGCTAGA AATCTGTT Time (s) To the sensor for analysis 16

17 BUT with PR biosensors... No sensitivity for small analytes and very low concentrations (pm-femtom, single-molecule detection) Although portable device, size and weight are not optimal Multianalyte capabilities for high throughput Higher sensitivity is required Microsystems platforms High throughput/multiplexing capabilities 1) Integrated photonic Mach-Zehnder nanointerferometers 2) Nanomechanical biosensors (standard and optical microcantilevers) 3) Localised urface Plasmon Resonance in nanoparticles (LPR) and magnetoplasmonic biosensors 17

18 Localised plasmon in Nanoparticles Au nanospheres EM strongly localized Au nanorods Au decahedra Au/i 2 Van Duyne, Nature 2008 Prof. Luis Liz- Marzán, Univ. Vigo 18

19 Far field radiation - scattering LPR: Dark-field Microscopy J. Feldmann, Munich Nano Lett. 2003, 3, 935 For low density of NPs The light scattered by single noble metal nanoparticles can be measured in a darkfield microscope. Depending on the material, size, shape and dielectric nanosurrounding, the nanoparticles scatter light of different colour. PEN THE PIBILITY F HIGHLY DENE NANBIENING ARRAY FR THUAND F ANALYTE 19

20 PHTNIC NANBIENR 20

21 Photonic Nanosensor: Mach-Zehnder Interferometer Evanescent wave detection ensing arm Y-junctions: 50% splitting and recombining Reference arm Intensity I I φ φ Phase shift, Φ 2 I = Io δ 1+ V cos 2π Φ = N L λ quadrature point [ ( Φ) ] Design of the system ingle mode behaviour High surface sensitivity 21

22 Photonic chip ptical waveguides rib of 4 nm i 3 N 4 75 nm Width 4 µm i 2 2 µm cladding i ustrate tandard fabrication at Clean Room facilities. Robust and reproducible technology. 4 nm Advances in ptical Technologies ID ,

23 MZI Performance 30 ensitivity evaluation TE exp TE theorical y= x n o,min = 1.1x10-7 N eff, min = 2.0x10-8 Phase change Φ The detection limit value corresponds to an average growth layer of nm ( mol.cm 2 ) and a urface ensitivity around nm -1. Direct detection in the picomolar range (10-12 M) is possible (60 fg/ mm 2 ) Refractive index variation n 0 eñal (U.A.) n = 2, TE TM

24 MZI ensor: Clinical diagnosis EARLY DETECTIN F INHERITED BREAT CANCER Detection of point mutations at BRCA-1 Normal equence BRCA-1 sequence (5,711kb) 5 3 Breast cancer cells displaying mutations at BRCA genes equence with a mismatch 185delAG 916delTT R1443X 5382insC 185delAG = two bases (AG) deletion 916delTT = two bases (TT) deletion R1443X = C to T transition 5382insC = one base insertion BRCA-1 Gene Fully complementary target MZI sensor Not fully complementary target DNA probe (28 mer):5 -H-(CH 2 ) 6 -(15T)-GTT CTG TCA AAC T-3 DNA target (58 mer): 5 TGC CAC ATG GCT CCA CAT GCA AGT TTG ACA GAA CTA CCC TGA TTT TCT GCA C 3 DNA (mutations):5 - TGC CAC ATG GCT CCA CAT GCA AGT TTG AAA CA GAACTAC CCT GAT ACT TTT CTG GAT GCC -3 MPTM Complementary sequence to ILANIZACIÓN the mutated one: for patients with the disease, total 10 % T=25ºC hybridisation. t=24 h i - (CH 2 ) 3 -H i - (CH 2 ) 3 -H Complementary sequence to the non-mutated one: for healthy patients, partial hybridisation. H-ADN i - (CH 2 ) 3 (CH 2 ) 3 T 15 i - (CH 2 ) 3 (CH 2 ) 3 T 15 LIGNUCLEÓTID -DNA -DNA LIGNUCLEÓTID 24

25 Nanophotonic chip: Results φ (2π) φ(2 π) ignal (A. U.) 3,5 3,0 1,0 2,5 2,8 0,8 2,0 2,1 0,6 1,5 1,4 0,7 1,0 0,4 0,5 0,2 0,0 0,0 0,0 Complementary Control Data: Data13_B Model: LangmuirEXT1 Equation: Mutated y = (a*b*x^(1-c))/(1 + b*x^(1-c)) Weighting: y By PR only 100 nm is possible!!! Complementary Control No weighting Chi^2/DoF = ingle-base mutations R^2 = a LD ± = 25 nm b ± c LD ± = 10 pm control 10 pm 25 nm 1E-12 1E-11 1E-10 1E-9 1E-8 1E-7 1E-6 1E-5 1E-4 1E-13 1E-12 1E-11 1E-10 1E-9 [ADN] 1E-9 (M) 58 MER 1E-7 1E-8 1E-71E-51E-6 1E-3 By PR only DNA 10 nm (M) is possible!!! [DNA] (M) 25

26 From chip on a lab to lab on a chip Results using a macro-flow cell: only one sensor, high volume of reagents and samples. Integration of micro/nanobiosensors in platforms with microfluidics, biological reagents, excitation and signal acquisition and processing. 26

27 Lab-on-a-chip Biosensor microsystem: ur approach Integrated Microfluidic Macro/micro connection grating couplers electronics Photodiodes MZI Modulation system Fully integration of optical functions within microfluidic chips is in its infancy on-chip approach 27

28 Nanosensor/microfluidics integration MZI MZI sensor Microchannels separated 50 µm 114 µm height Channels of µm height and µm width U8 microchannel walls Inlet port ilicon xide (wg cladding layer) ilicon Nitride (wg core layer) Embedded Microchanne l 3D-microfluidic network PIE Photonics West, 2007, 647 J. of Micromechanics and Microengineering, 16, 1006, 2006 Microfluidic inlet and the embedded microchannel on top the MZI devices 28

29 Nanosensor/microfluidics integration Connection macro/micro Modular technology using microfabricated PMMA housing external module Easy replacement of the external connections and packaging 4,0 hgh hormone 3,8 N H I (au) 3,6 3,4 3,2 teady-state flow rates: µl/min Up to 10 Bar without any liquid leakage i Au Reduction of 100 times the chemical reagents consumption!!! 3,0 2,8 2,6 Time (s) U-8 microfluidics is resistant to acid and organic solvents (cleaning and regeneration) 29

30 Development of an implantable biosensor for continuous care and monitoring of diabetic patients (P. CEZANNE) The biosensor will be implanted in the human body during 6 months-1 year, working in a continuous way and with a wireless transmitting data capabilities. CLALIT HEALTH PRTECH AF LTD LABMAN AUTMATIN MICRTECH.R.L. AFCN IND. LTD FIMI.R.L. IVEC RMANIA A RBERT BCH GMBH CNM-CIC FRAUNHFER E.V. IRAEL UK UK ITALY IRAEL ITALY RMANIA GE PAIN GE 30

31 NANMECHANICAL BIENR 31

32 What is a microcantilever sensor? i microcantilever A new class of highly sensitive, label-free and direct biosensor which transduces the molecular recognition of biomolecules into a nanomechanical motion (NPs-DNA and femtomolar-proteins) 1) Microcantilever functionalization 2) Biomolecular Recognition produces a bending of the cantilever due to change of surface stress PTICAL READ-UT: High sensitivity Cantilever bending nm 1 ν 2 z 4 L( σ ) 2 t σ b Et Array of cantilevers Trends in Anal. Chem (TRAC), 25(3), 196, 2006 Appl. Phys. Lett. 89 (2006) Cantilever Biosensors In ptical Biosensors: Today and Tomorrow Editorial (si libro): Ed. F. Liegler and C. Taitt. Elsevier, Amsterdam (NL)

33 Nanomechanical Biosensors i cantilevers, 2560 cantilevers, Array of 20-cantilevers, mm thick, k= N/m ix time more sensitive for biosensing than commercial ones minimum detectable deflection 0.1 nm sensitivity expressed in fm/hz-1/2 : 100 PRTEIN EVALUATIN (nm range) Antibody 5µg/ml LiB-DDT 0 HCl 0.1M -50 HCl 0.1M -200 ADN-H 2µM 0 Deflexión (nm) Deflexión (nm) Antibody 5µg/ml LiB-DDT DDT 10nM + Antibody 5µg/ml LiB-DDT DNA EVALUATIN Deflexión (nm) complementario 1µM Tiempo (min) Tiempo (min) Langmuir, 20, 9663, 2004 Biosensors & Bioelectronics, 18, 649, Tiempo (min) 33

34 Integration in Microsystems Array of sensors For measuring arrays of microcantilevers... Array of lasers Array of PDs and CM Advantages High sensitivity ub-angstrom resolution Disadvantages Complex integration (difficult alignment): Difficult read-out of arrays equential switching of the laser due to overlapping of the reflection beams Complex detection by the PD chip Microlens array onto laser chip Immobilisation in each cantilever using the 20-flow cell ptics:20-vcel+drivers Photodetector array. CM circuitry Microarrays of 20 microcantilevers Microfluidics:flow cell with 20 channels Flow cell-20-channels ensors and Actuators B, 118, 2,

35 Novel optical waveguide microcantilever sensor PD array No alignment (except for light coupling) More integrated approach laser beam cantilever 1 cantilever 1 No further adjustment Conventional photodetectors cantilever N laser beam cantilever 1 cantilever 1 Conventional PhotoDetector Conventional PhotoDetector laser beam cantilever N 35

36 WC: Design and fabrication light in gap cantilever input waveguide (IWG) ilicon xide (0.5 um) light out PD output waveguide (receptor) ilicon nitride 0.1 um Tested materials: LPCVD i 3 N 4, PECVD i 3 N 4, PECVD i 2, Thermal i 2 ilicon oxide cantilever, 600 nm ilicon nitride receptor, 120 nm Wavelength nm Gap: 3 µm 2 propagation modes Z input waveguide buffer cantilever substrate Coupling efficiency at the junction: up to 70 % Trends in Anal. Chem (TRAC), 25(3), 196,

37 WC: Devices The chips on wafer A separated chip The output waveguides 2500 cantilevers per wafer 20 cantilevers per chip Cantilevers are 200 x 40 x 0.6 µm direct incoupling pring constant 0.05 N/m The input waveguides The cavity and cantilevers Applied ptics, 45(2), 1, 2006 Applied Physics Letters, 92,

38 WC: Performance cantilever WC chips tested in air Light in Light out operated in dynamic mode amplitude, V W Readut, V ,052 0,050 0,048 0,046 0,044 0,042 air flow Light intensity distribution Cantilever Displacement, µm in resonance out of resonance cantilever 200 um air gap 3 um Cantilever end displacement, nm displacement voltage change Piezoactuator voltage, V Applying an excitation V of variable frequency and amplitude The cantilever displacement can be detected with resolution of 0.04 nm HIGH ENITIVITY, GD PERFRMANCE FR BIENING Modulation amplitude, mv 0,0000 0,0001 0,0002 Time, s J. Lightwave Tech., 24(5),

39 Future opportunities Actual DNA/Protein Biochips Need of high amounts of sample: (time consuming, expensive) Non-specific interactions Indirect read-out: fluorescent labeling. Labels Bride DNA Groom DNA restric assay types Low sensitivity for single mismatch detection Inconsistent activity of immobilised proteins Lab-on-a-chip Nanobiosensors as an advanced platform Array of microcantilevers Drastic reduction of sample amount Direct read-out: real time analysis High sensitivity Micro/nanotechnology: mass production with low cost 39

40 In the future... Nanobiosensores en urgencias Tecnologías Nanofotónica Nanotubos, nanopartículas Nanomecánica, NEM Beneficios Datos en tiempo real e in-situ Imagen a nivel celular Herramientas quirúrgicas de precisión guiadas por sensores Nanobiosensores en la consulta Tecnologías Biochips Nanoarrays de alta densidad Beneficios Análisis completo en minutos Diagnósticos rápidos y precisos Tratamientos específicos y personalizados Nanobiosensores en casa Tecnologías Wireless Dispositivos portátiles con batería Displays de alta resolución Beneficios Auto-Pruebas diagnósticas simples Transmisión automática de datos a historial clínico 40

41 Acknowledgements Nanobiosensors Group (CIN2-CIC) CIC) Team profile: physicist, chemist, electronics engineers, molecular biologist, biotechnologist, biophysics, experts in optoelectronics technology, Finantial funding from: European Union (V and VI FP) panish Ministry of cience panish Ministry of Health (CIBER) panish National Research Council M. Botín Foundation Barcelona, pain 41

42 Nanobiosensors Group: our activity PR, Magneto-PR and LPR Integrated optics Nanophotonic biosensor (MZI) µ-fluidics integration Nanomechanical biosensors (standard and optical) Carbon Nanotubes Biosensors Biofuncionalization Lab-on-a-chip technological platforms (in-vitro and in-vivo) Applications: environmental control, clinical diagnostics ingle-molecule biophysics using Magnetic tweezers and AFM MRE INF IN U8 microchannel ilicon xide (wg cladding layer) ilicon Nitride (wg core layer) 42

43 ensia biosensingolutions ensia is a company of Group with the participation of MNDRAGN CRPERATIN (MCC) NEW PR VERIN AVAILABLE N JUNE

5. Scanning Near-Field Optical Microscopy 5.1. Resolution of conventional optical microscopy

5. Scanning Near-Field Optical Microscopy 5.1. Resolution of conventional optical microscopy 5. Scanning Near-Field Optical Microscopy 5.1. Resolution of conventional optical microscopy Resolution of optical microscope is limited by diffraction. Light going through an aperture makes diffraction

More information

IFAC CNR. Francesco Baldini Ambra Giannetti Andrea Mencaglia Cosimo Trono Giacomo Ghini Folco Senesi

IFAC CNR. Francesco Baldini Ambra Giannetti Andrea Mencaglia Cosimo Trono Giacomo Ghini Folco Senesi Chemical and biochemical optical sensor group IFAC CNR Francesco Baldini Ambra Giannetti Andrea Mencaglia Cosimo Trono Giacomo Ghini Folco Senesi Optical chemical and biochemical sensors SPECIFIC SENSORS

More information

Fabrication Challenges for Point-ofcare Diagnostics and Organ-on-chip

Fabrication Challenges for Point-ofcare Diagnostics and Organ-on-chip Fabrication Challenges for Point-ofcare Diagnostics and Organ-on-chip Zulfiqur Ali (z.ali@tees.ac.uk) Project DIGINOVA: Biomedical Applications for Digital Fabrication, 6 th November 2013, CPI s National

More information

Ultrahigh-efficiency solar cells based on nanophotonic design

Ultrahigh-efficiency solar cells based on nanophotonic design Ultrahigh-efficiency solar cells based on nanophotonic design Albert Polman Piero Spinelli Jorik van de Groep Claire van Lare Bonna Newman Erik Garnett Marc Verschuuren Ruud Schropp Wim Sinke Center for

More information

Keysight Technologies How to Choose your MAC Lever. Technical Overview

Keysight Technologies How to Choose your MAC Lever. Technical Overview Keysight Technologies How to Choose your MAC Lever Technical Overview Introduction Atomic force microscopy (AFM) is a sub-nanometer scale imaging and measurement tool that can be used to determine a sample

More information

Outline. Self-assembled monolayer (SAM) formation and growth. Metal nanoparticles (NP) anchoring on SAM

Outline. Self-assembled monolayer (SAM) formation and growth. Metal nanoparticles (NP) anchoring on SAM From functional nanostructured surfaces to innovative optical biosensors Giacomo Dacarro Dipartimento di Fisica A.Volta Dipartimento di Chimica Generale Università degli Studi di Pavia Dalla scienza dei

More information

Scanning Near-Field Optical Microscopy for Measuring Materials Properties at the Nanoscale

Scanning Near-Field Optical Microscopy for Measuring Materials Properties at the Nanoscale Scanning Near-Field Optical Microscopy for Measuring Materials Properties at the Nanoscale Outline Background Research Design Detection of Near-Field Signal Submonolayer Chemical Sensitivity Conclusions

More information

STUDENT BACKGROUND READING FOR EXPERIMENT C: COLORIMETRIC GOLD NANOSENSOR

STUDENT BACKGROUND READING FOR EXPERIMENT C: COLORIMETRIC GOLD NANOSENSOR STUDENT BACKGROUND READING FOR EXPERIMENT C: In this experiment you will synthesize and test a plasmonic colorimetric nanosensor made of nanoparticles of gold. Here we provide you with some background

More information

E F G. Overview of the activities. SAPIE ZA Università di Roma - Laboratorio di Fotonica Molecolare

E F G. Overview of the activities. SAPIE ZA Università di Roma - Laboratorio di Fotonica Molecolare SAPIE ZA Università di Roma Dipartimento di Energetica Laboratorio di Fotonica Molecolare Francesco Michelotti E-Mail: francesco.michelotti@uniroma1.it Tel: +39 06-49.91.65.62 Workshop Future Trends in

More information

Basic principles and mechanisms of NSOM; Different scanning modes and systems of NSOM; General applications and advantages of NSOM.

Basic principles and mechanisms of NSOM; Different scanning modes and systems of NSOM; General applications and advantages of NSOM. Lecture 16: Near-field Scanning Optical Microscopy (NSOM) Background of NSOM; Basic principles and mechanisms of NSOM; Basic components of a NSOM; Different scanning modes and systems of NSOM; General

More information

Aplicaciones de la nanolitografía de oxidación por AFM

Aplicaciones de la nanolitografía de oxidación por AFM ForceTool Aplicaciones de la nanolitografía de oxidación por AFM (AFM oxidation nanolithography or Local oxidation nanolithography) Templates for the growth of molecular arquitectures Transistors Sensors

More information

Electronic Biosensors Henrique Leonel Gomes hgomes@ualg.pt Office: 2.82 Phone: +351 289 800 900 ext. 7763 Fax: +351 289 8000 066

Electronic Biosensors Henrique Leonel Gomes hgomes@ualg.pt Office: 2.82 Phone: +351 289 800 900 ext. 7763 Fax: +351 289 8000 066 Electronic Biosensors Henrique Leonel Gomes hgomes@ualg.pt Office: 2.82 Phone: +351 289 800 900 ext. 7763 Fax: +351 289 8000 066 Welcome Welcome to electronic biosensors course. This is a useful course

More information

Introduction to Biosensors. Professor Brian Birch LIRANS University of Luton UK

Introduction to Biosensors. Professor Brian Birch LIRANS University of Luton UK Introduction to Biosensors Professor Brian Birch LIRANS University of Luton UK What is a Biosensor? As many definitions as workers in the field! I favour: a device that utilises biological components e.g.

More information

CREOL, College of Optics & Photonics, University of Central Florida

CREOL, College of Optics & Photonics, University of Central Florida OSE6650 - Optical Properties of Nanostructured Materials Optical Properties of Nanostructured Materials Fall 2013 Class 3 slide 1 Challenge: excite and detect the near field Thus far: Nanostructured materials

More information

Recent developments in high bandwidth optical interconnects. Brian Corbett. www.tyndall.ie

Recent developments in high bandwidth optical interconnects. Brian Corbett. www.tyndall.ie Recent developments in high bandwidth optical interconnects Brian Corbett Outline Introduction to photonics for interconnections Polymeric waveguides and the Firefly project Silicon on insulator (SOI)

More information

Nano Optics: Overview of Research Activities. Sergey I. Bozhevolnyi SENSE, University of Southern Denmark, Odense, DENMARK

Nano Optics: Overview of Research Activities. Sergey I. Bozhevolnyi SENSE, University of Southern Denmark, Odense, DENMARK Nano Optics: Overview of Research Activities SENSE, University of Southern Denmark, Odense, DENMARK Optical characterization techniques: Leakage Radiation Microscopy Scanning Near-Field Optical Microscopy

More information

Scanning Near Field Optical Microscopy: Principle, Instrumentation and Applications

Scanning Near Field Optical Microscopy: Principle, Instrumentation and Applications Scanning Near Field Optical Microscopy: Principle, Instrumentation and Applications Saulius Marcinkevičius Optics, ICT, KTH 1 Outline Optical near field. Principle of scanning near field optical microscope

More information

Photonic crystal based immunosensor for clinical diagnosis

Photonic crystal based immunosensor for clinical diagnosis 1,4 ID:31132 2 nd year of the PhD in Electronic Devices Official Tutors: Prof. M. De Vittorio 1,2,3, Ing. Tiziana Stomeo 1, Prof. Fabrizio Pirri 4, Prof. Carlo Ricciardi 4 Collaborators: A. Qualtieri 1,

More information

Fluorescence Microscopy for an NMR- Biosensor Project

Fluorescence Microscopy for an NMR- Biosensor Project Fluorescence Microscopy for an NMR- Biosensor Project Ole Hirsch Physikalisch-Technische Bundesanstalt Medical Optics Abbestr. -1, 10587 Berlin, Germany Overview NMR Sensor Project Dimensions in biological

More information

CHEMICAL SENSORS 1. DEFINITION

CHEMICAL SENSORS 1. DEFINITION CHEMICAL SENSORS 1. DEFINITION A chemical sensor is a device that transforms chemical information (composition, presence of a particular element or ion, concentration, chemical activity, partial pressure

More information

FIBER OPTIC EVANESCENT WAVE BIOSENSOR

FIBER OPTIC EVANESCENT WAVE BIOSENSOR FIBER OPTIC EVANESCENT WAVE BIOSENSOR Project report submitted in partial fulfillment of the requirement of the award of degree MASTER OF TECHNOLOGY IN OPTOELECTRONICS AND LASER TECHNOLOGY Submitted by

More information

Single Protein Nanobiosensor. Grid Array (SPOT-NOSED)

Single Protein Nanobiosensor. Grid Array (SPOT-NOSED) Single Protein Nanobiosensor Grid Array (SPOT-NOSED) Single Protein Nanobiosensor! Abstract Recent advances in bio- and nano-technology have opened the possibility to develop bio-electronic sensors based

More information

Finite Difference Time Domain and BPM: Flexible Algorithm Selection Technology

Finite Difference Time Domain and BPM: Flexible Algorithm Selection Technology Finite Difference Time Domain and BPM: Flexible Algorithm Selection Technology 1. Introduction This application note shows the use of the Finite Difference Time Domain (FDTD) module in the calculation

More information

Coupling Engineering Sciences and Life Sciences: An overview of LAAS Activities with a special focus on Nano-Oncology Projects

Coupling Engineering Sciences and Life Sciences: An overview of LAAS Activities with a special focus on Nano-Oncology Projects Christophe Vieu Toulouse University Chargé de Mission du LAAS Axe Interaction avec le vivant Coupling Engineering Sciences and Life Sciences: An overview of LAAS Activities with a special focus on Nano-Oncology

More information

NEAR FIELD OPTICAL MICROSCOPY AND SPECTROSCOPY WITH STM AND AFM PROBES

NEAR FIELD OPTICAL MICROSCOPY AND SPECTROSCOPY WITH STM AND AFM PROBES Vol. 93 (1997) A CTA PHYSICA POLONICA A No. 2 Proceedings of the 1st International Symposium on Scanning Probe Spectroscopy and Related Methods, Poznań 1997 NEAR FIELD OPTICAL MICROSCOPY AND SPECTROSCOPY

More information

Technology Developments Towars Silicon Photonics Integration

Technology Developments Towars Silicon Photonics Integration Technology Developments Towars Silicon Photonics Integration Marco Romagnoli Advanced Technologies for Integrated Photonics, CNIT Venezia - November 23 th, 2012 Medium short reach interconnection Example:

More information

Towards a miniaturized micromechanical electronic nose SYWERT H. BRONGERSMA SR. PRINCIPAL RESEARCHER

Towards a miniaturized micromechanical electronic nose SYWERT H. BRONGERSMA SR. PRINCIPAL RESEARCHER Towards a miniaturized micromechanical electronic nose SYWERT H. BRONGERSMA SR. PRINCIPAL RESEARCHER e-nose: advanced sensing in complex environments Human olfactory system e-nose: array of non-specific,

More information

Nano-Spectroscopy. Solutions AFM-Raman, TERS, NSOM Chemical imaging at the nanoscale

Nano-Spectroscopy. Solutions AFM-Raman, TERS, NSOM Chemical imaging at the nanoscale Nano-Spectroscopy Solutions AFM-Raman, TERS, NSOM Chemical imaging at the nanoscale Since its introduction in the early 80 s, Scanning Probe Microscopy (SPM) has quickly made nanoscale imaging an affordable

More information

Usage of Carbon Nanotubes in Scanning Probe Microscopes as Probe. Keywords: Carbon Nanotube, Scanning Probe Microscope

Usage of Carbon Nanotubes in Scanning Probe Microscopes as Probe. Keywords: Carbon Nanotube, Scanning Probe Microscope International Journal of Arts and Sciences 3(1): 18-26 (2009) CD-ROM. ISSN: 1944-6934 InternationalJournal.org Usage of Carbon Nanotubes in Scanning Probe Microscopes as Probe Bedri Onur Kucukyildirim,

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Laser Based Micro and Nanoscale Manufacturing and Materials Processing

Laser Based Micro and Nanoscale Manufacturing and Materials Processing Laser Based Micro and Nanoscale Manufacturing and Materials Processing Faculty: Prof. Xianfan Xu Email: xxu@ecn.purdue.edu Phone: (765) 494-5639 http://widget.ecn.purdue.edu/~xxu Research Areas: Development

More information

Biomedical Engineering Graduate Program in METU / ANKARA

Biomedical Engineering Graduate Program in METU / ANKARA Biomedical Engineering Graduate Program in METU / ANKARA Faculty of Engineering Institute of Applied Mathematics Informatics Institute Faculty of Arts and Sciences Electrical and Electronics and Engineering

More information

Laboratorio Regionale LiCryL CNR-INFM

Laboratorio Regionale LiCryL CNR-INFM Laboratorio Regionale LiCryL CNR-INFM c/o Physics Department - University of Calabria, Ponte P. Bucci, Cubo 33B, 87036 Rende (CS) Italy UNIVERSITÀ DELLA CALABRIA Dipartimento di FISICA Researchers Dr.

More information

Laboratory #3 Guide: Optical and Electrical Properties of Transparent Conductors -- September 23, 2014

Laboratory #3 Guide: Optical and Electrical Properties of Transparent Conductors -- September 23, 2014 Laboratory #3 Guide: Optical and Electrical Properties of Transparent Conductors -- September 23, 2014 Introduction Following our previous lab exercises, you now have the skills and understanding to control

More information

STM and AFM Tutorial. Katie Mitchell January 20, 2010

STM and AFM Tutorial. Katie Mitchell January 20, 2010 STM and AFM Tutorial Katie Mitchell January 20, 2010 Overview Scanning Probe Microscopes Scanning Tunneling Microscopy (STM) Atomic Force Microscopy (AFM) Contact AFM Non-contact AFM RHK UHV350 AFM/STM

More information

Nanostructured transducers as sensing platforms for biomedical applications

Nanostructured transducers as sensing platforms for biomedical applications Nanostructured transducers as sensing platforms for biomedical applications Jane Politi, Alessandro Caliò, Monica Terracciano, Mario Iodice, Ilaria Rea, Principia Dardano, Mariano Gioffrè and Luca De Stefano

More information

Short overview of TEUFEL-project

Short overview of TEUFEL-project Short overview of TEUFEL-project ELAN-meeting may 2004 Frascati (I) Contents Overview of TEUFEL project at Twente Photo cathode research Recent experience Outlook Overview FEL Drive laser Photo cathode

More information

Why Being Small? Savings in time & cost. Disposable Parallel processing Integration/Automation. Gain from the unique microscopic features

Why Being Small? Savings in time & cost. Disposable Parallel processing Integration/Automation. Gain from the unique microscopic features Miniaturization in Electronic Technology ENIAC: the "Electronic Numerical Integrator and Calculator, 1943 ENIAC filled a 20 by 40 feet room, weighed 30 tons, and used more than 18,000 vacuum tubes. iphone

More information

Photonic components for signal routing in optical networks on chip

Photonic components for signal routing in optical networks on chip 15 th International Conference on Transparent Optical Networks Cartagena, Spain, June 23-27, 213 Photonic components for signal routing in optical networks on chip Vincenzo Petruzzelli, Giovanna Calò Dipartimento

More information

A. Ricci, E. Giuri. Materials and Microsystems Laboratory

A. Ricci, E. Giuri. Materials and Microsystems Laboratory Presented at the COMSOL Conference 2009 Milan FSI Analysis of Microcantilevers Vibrating in Fluid Environment Materials and Microsystems Laboratory Politecnico di Torino Outline Brief Presentation of Materials

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Robert G. Hunsperger. Integrated Optics. Theory and Technology. Fourth Edition. With 195 Figures and 17 Tables. Springer

Robert G. Hunsperger. Integrated Optics. Theory and Technology. Fourth Edition. With 195 Figures and 17 Tables. Springer Robert G. Hunsperger Integrated Optics Theory and Technology Fourth Edition With 195 Figures and 17 Tables Springer Contents 1. Introduction 1 1.1 Advantages of Integrated Optics 2 1.1.1 Comparison of

More information

DIRECTIONAL FIBER OPTIC POWER MONITORS (TAPS/PHOTODIODES)

DIRECTIONAL FIBER OPTIC POWER MONITORS (TAPS/PHOTODIODES) Features: DIRECTIONAL FIBER OPTIC POWER MONITORS (TAPS/PHOTODIODES) PATENT NUMBERS: CANADA 2,494,133, USA 7095931, 7295731 AND CHINA 1672073 Telcordia GR-468 qualified Available in versions for any wavelength

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Chapter 1 Optical Technology until the Year 2000: An Historical Overview

Chapter 1 Optical Technology until the Year 2000: An Historical Overview Ramaier Narayanaswamy Otto S. Wolfbeis Optical Sensors Industrial Environmental and Diagnostic Applications With 197 Figures and 26 Tables Springer Contents Chapter 1 Optical Technology until the Year

More information

Experiment 5. Lasers and laser mode structure

Experiment 5. Lasers and laser mode structure Northeastern University, PHYS5318 Spring 2014, 1 1. Introduction Experiment 5. Lasers and laser mode structure The laser is a very important optical tool that has found widespread use in science and industry,

More information

Strategy for Functional Material Development in FUJIFILM

Strategy for Functional Material Development in FUJIFILM 証券コード 4901 Strategy for Functional Material Development in FUJIFILM - Global competency strategy for business innovation in Functional Material Industry - Sep. 24, 2013 FUJIFILM Corporation Development

More information

Non-Contact Vibration Measurement of Micro-Structures

Non-Contact Vibration Measurement of Micro-Structures Non-Contact Vibration Measurement of Micro-Structures Using Laser Doppler Vibrometry (LDV) and Planar Motion Analysis (PMA) to examine and assess the vibration characteristics of micro- and macro-structures.

More information

Volumes. Goal: Drive optical to high volumes and low costs

Volumes. Goal: Drive optical to high volumes and low costs First Electrically Pumped Hybrid Silicon Laser Sept 18 th 2006 The information in this presentation is under embargo until 9/18/06 10:00 AM PST 1 Agenda Dr. Mario Paniccia Director, Photonics Technology

More information

Simple and scalable fabrication approaches of Nanophotonic structures for PV

Simple and scalable fabrication approaches of Nanophotonic structures for PV Simple and scalable fabrication approaches of Nanophotonic structures for PV Fabien Sorin Surface du Verre et Interfaces (SVI), UMR 125 CNRS/Saint-Gobain, 39, Quai Lucien Lefranc, 93303 Aubervilliers,

More information

Nanotechnology for Food Processing and Packaging

Nanotechnology for Food Processing and Packaging Nanotechnology for Food Processing and Packaging John D. Floros Professor & Head Department of Food Science Pennsylvania State University www.foodscience.psu.edu Information Sources Pennsylvania State

More information

Practical Cell Analysis

Practical Cell Analysis Practical Cell Analysis Dimitri Pappas Dept of Chemistry & Biochemistry, Texas Tech University, USA WILEY A John Wiley and Sons, Ltd, Publication Contents Preface Acknowledgments xiii xix 1 Getting Started

More information

Measuring of optical output and attenuation

Measuring of optical output and attenuation Measuring of optical output and attenuation THEORY Measuring of optical output is the fundamental part of measuring in optoelectronics. The importance of an optical power meter can be compared to an ammeter

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Fluids Confined in Carbon Nanotubes

Fluids Confined in Carbon Nanotubes Fluids Confined in Carbon Nanotubes Constantine M. Megaridis Micro/Nanoscale Fluid Transport Laboratory Mechanical and Industrial Engineering University of Illinois at Chicago 1 Background and Societal

More information

Nanoscience Course Descriptions

Nanoscience Course Descriptions Nanoscience Course Descriptions NANO*1000 Introduction to Nanoscience This course introduces students to the emerging field of nanoscience. Its representation in popular culture and journalism will be

More information

h e l p s y o u C O N T R O L

h e l p s y o u C O N T R O L contamination analysis for compound semiconductors ANALYTICAL SERVICES B u r i e d d e f e c t s, E v a n s A n a l y t i c a l g r o u p h e l p s y o u C O N T R O L C O N T A M I N A T I O N Contamination

More information

UNIVERSITY OF KERALA

UNIVERSITY OF KERALA - 1 - Appendix XIII UNIVERSITY OF KERALA Updated list of standard journals approved by Board of Studies in Optoelectronics kup 1012(5)/2014-15 160 - 2 - Updated list of standard journals approved by Board

More information

Fluorescent Array Imaging Reader

Fluorescent Array Imaging Reader Fluorescent Array Imaging Reader Multiplex Enabled For 2-Color Fluorescent Microarrays Extended Dynamic Range Automated Spot Analysis Compact and Affordable Microarray Analysis With FLAIR FLAIR Sensovation

More information

Physical Properties and Functionalization of Low-Dimensional Materials

Physical Properties and Functionalization of Low-Dimensional Materials Physical Properties and Functionalization of Low-Dimensional Materials Physics Department, University of Trieste Graduate School of Physics, XXVI cycle Supervisor: Co-supervisor: Prof. Alessandro BARALDI

More information

Near-field optics and plasmonics

Near-field optics and plasmonics Near-field optics and plasmonics Manuel Rodrigues Gonçalves AFM topography 10 Pol. y / (µm) 8 6 4 2 0 0 2 4 6 x / (µm) 8 10 nm 60 80 100 120 140 Physik M. Sc. Master Advanced Materials Winter semester

More information

L innovazione tecnologica dell industria italiana verso la visione europea del prossimo futuro

L innovazione tecnologica dell industria italiana verso la visione europea del prossimo futuro L innovazione tecnologica dell industria italiana verso la visione europea del prossimo futuro Mercoledì 2 Aprile 2014 Antonio D Errico, Francesco Testa, Roberto Sabella, Ericsson Silicon Photonics Opportunities

More information

Microfluidic Device for Multiple Disease Diagnostic and Monitoring

Microfluidic Device for Multiple Disease Diagnostic and Monitoring Microfluidic Device for Multiple Disease Diagnostic and Monitoring Romen Rodriguez-Trujillo, Heidi Puk Hermann, Dorota Kwasny and Winnie E. Svendsen NanoBioIntegrated Systems Group, DTU-Nanotech, Denmark

More information

Excimer Laser Technology

Excimer Laser Technology D. Basting G. Marowsky (Eds.) Excimer Laser Technology With 257 Figures ^y Springer Contents 1 Introduction 1 1.1 Introductory Remarks 1 1.1.1 The Unique Microstructuring Capabilities of Excimer Lasers

More information

Microscopy. MICROSCOPY Light Electron Tunnelling Atomic Force RESOLVE: => INCREASE CONTRAST BIODIVERSITY I BIOL1051 MAJOR FUNCTIONS OF MICROSCOPES

Microscopy. MICROSCOPY Light Electron Tunnelling Atomic Force RESOLVE: => INCREASE CONTRAST BIODIVERSITY I BIOL1051 MAJOR FUNCTIONS OF MICROSCOPES BIODIVERSITY I BIOL1051 Microscopy Professor Marc C. Lavoie marc.lavoie@cavehill.uwi.edu MAJOR FUNCTIONS OF MICROSCOPES MAGNIFY RESOLVE: => INCREASE CONTRAST Microscopy 1. Eyepieces 2. Diopter adjustment

More information

FIBER LASER STRAIN SENSOR DEVICE

FIBER LASER STRAIN SENSOR DEVICE FIBER LASER STRAIN SENSOR DEVICE E. Maccioni (1,2), N. Beverini (1,2), M. Morganti (1,2) F. Stefani (2,3), R. Falciai (4), C. Trono (4) (1) Dipartimento di Fisica E. Fermi Pisa (2) INFN Sez. Pisa (3) Dipartimento

More information

Lecture 4 Scanning Probe Microscopy (SPM)

Lecture 4 Scanning Probe Microscopy (SPM) Lecture 4 Scanning Probe Microscopy (SPM) General components of SPM; Tip --- the probe; Cantilever --- the indicator of the tip; Tip-sample interaction --- the feedback system; Scanner --- piezoelectric

More information

Biotechnology. Srivatsan Kidambi, Ph.D.

Biotechnology. Srivatsan Kidambi, Ph.D. Stem Stem Cell Cell Engineering-What, Biology and it Application Why, How?? to Biotechnology Srivatsan Kidambi, Ph.D. Assistant Professor Department of Chemical & Biomolecular Engineering University of

More information

Surface plasmon nanophotonics: optics below the diffraction limit

Surface plasmon nanophotonics: optics below the diffraction limit Surface plasmon nanophotonics: optics below the diffraction limit Albert Polman Center for nanophotonics FOM-Institute AMOLF, Amsterdam Jeroen Kalkman Hans Mertens Joan Penninkhof Rene de Waele Teun van

More information

Focused Ion beam nanopatterning: potential application in photovoltaics

Focused Ion beam nanopatterning: potential application in photovoltaics Focused Ion beam nanopatterning: potential application in photovoltaics Research Infrastructure: Location: FIB-Focused Ion Beam ENEA Portici (Italy) Date March, 26 2013 Speakers: Vera La Ferrara, ENEA

More information

PUMPED Nd:YAG LASER. Last Revision: August 21, 2007

PUMPED Nd:YAG LASER. Last Revision: August 21, 2007 PUMPED Nd:YAG LASER Last Revision: August 21, 2007 QUESTION TO BE INVESTIGATED: How can an efficient atomic transition laser be constructed and characterized? INTRODUCTION: This lab exercise will allow

More information

Measurement of the vibration state of an array of micro cantilevers by diffractional methods

Measurement of the vibration state of an array of micro cantilevers by diffractional methods ÓPTICA PURA Y APLICADA. www.sedoptica.es Sección Especial: Optoel 11 / Special Section: Optoel 11 Measurement of the vibration state of an array of micro cantilevers by diffractional methods Medida del

More information

David B. Wallace MicroFab Technologies, Inc. Plano, Texas dwallace@microfab.com www.microfab.com

David B. Wallace MicroFab Technologies, Inc. Plano, Texas dwallace@microfab.com www.microfab.com Ink-Jet Applications, Physics, and Modeling - an Industrial / Applied Research View David B. Wallace Plano, Texas dwallace@microfab.com www.microfab.com Ink-Jet Microdispensing Advantages Direct-write

More information

Fiber Optic Tweezers and Optical Stretcher: biophotonic tools for single cell studies

Fiber Optic Tweezers and Optical Stretcher: biophotonic tools for single cell studies Fiber Optic Tweezers and Optical Stretcher: biophotonic tools for single cell studies F. Bragheri, L. Ferrara, P. Minzioni, I. Cristiani Electronics Department, University of Pavia, Italy francesca.bragheri@unipv.it

More information

Katharina Lückerath (AG Dr. Martin Zörnig) adapted from Dr. Jörg Hildmann BD Biosciences,Customer Service

Katharina Lückerath (AG Dr. Martin Zörnig) adapted from Dr. Jörg Hildmann BD Biosciences,Customer Service Introduction into Flow Cytometry Katharina Lückerath (AG Dr. Martin Zörnig) adapted from Dr. Jörg Hildmann BD Biosciences,Customer Service How does a FACS look like? FACSCalibur FACScan What is Flow Cytometry?

More information

Protease Peptide Microarrays Ready-to-use microarrays for protease profiling

Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Protocol Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Contact us: InfoLine: +49-30-97893-117 Order per fax: +49-30-97893-299 Or e-mail: peptide@jpt.com www: www.jpt.com

More information

Acoustic GHz-Microscopy: Potential, Challenges and Applications

Acoustic GHz-Microscopy: Potential, Challenges and Applications Acoustic GHz-Microscopy: Potential, Challenges and Applications A Joint Development of PVA TePLa Analytical Systems GmbH and Fraunhofer IWM-Halle Dr. Sebastian Brand (Ph.D.) Fraunhofer CAM Fraunhofer Institute

More information

1 Introduction. 1.1 Historical Perspective

1 Introduction. 1.1 Historical Perspective j1 1 Introduction 1.1 Historical Perspective The invention of scanning probe microscopy is considered one of the major advances in materials science since 1950 [1, 2]. Scanning probe microscopy includes

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

11. Current and potential commercial nanotechnology 4applications

11. Current and potential commercial nanotechnology 4applications 11. Current and potential commercial nanotechnology 4applications The market for nanotechnology products is already huge and is predicted to grow rapidly in the coming years. This topic guide examines

More information

Longwave IR focal-plane binary optics

Longwave IR focal-plane binary optics Longwave IR focal-plane binary optics Z. Sikorski, H. Polakowski Institute of Optoelectronics, Military University of Technology, 2 Kaliskiego Str., -98 Warsaw, e-mail: zsikorsk@wat.waw.pl Abstract In

More information

Synthetic Sensing: Proximity / Distance Sensors

Synthetic Sensing: Proximity / Distance Sensors Synthetic Sensing: Proximity / Distance Sensors MediaRobotics Lab, February 2010 Proximity detection is dependent on the object of interest. One size does not fit all For non-contact distance measurement,

More information

A Simple Fiber Optic displacement Sensor for Measurement of Light Intensity with the Displacement

A Simple Fiber Optic displacement Sensor for Measurement of Light Intensity with the Displacement A Simple Fiber Optic displacement Sensor for Measurement of Light Intensity with the Displacement Trilochan patra Assistant professor, Department of Electronics and Communication Engineering, Techno India

More information

Computational Nanoscience of Soft Matter

Computational Nanoscience of Soft Matter ChE/MSE 557 Computational Nanoscience of Soft Matter Fall 2006 Instructor: Professor Sharon C. Glotzer Class meets: Tues 3:00-6:00 Location: Room 3336 BD, Duderstadt Center Room 3336 AC, Duderstadt Center

More information

Graduate Student Presentations

Graduate Student Presentations Graduate Student Presentations Dang, Huong Chip packaging March 27 Call, Nathan Thin film transistors/ liquid crystal displays April 4 Feldman, Ari Optical computing April 11 Guerassio, Ian Self-assembly

More information

Keywords: Planar waveguides, sol-gel technology, transmission electron microscopy

Keywords: Planar waveguides, sol-gel technology, transmission electron microscopy Structural and optical characterisation of planar waveguides obtained via Sol-Gel F. Rey-García, C. Gómez-Reino, M.T. Flores-Arias, G.F. De La Fuente, W. Assenmacher, W. Mader ABSTRACT Planar waveguides

More information

Suppression of Four Wave Mixing in 8 Channel DWDM System Using Hybrid Modulation Technique

Suppression of Four Wave Mixing in 8 Channel DWDM System Using Hybrid Modulation Technique International Journal of Electronic and Electrical Engineering. ISSN 0974-2174, Volume 7, Number 2 (2014), pp. 97-108 International Research Publication House http://www.irphouse.com Suppression of Four

More information

Scientific Exchange Program

Scientific Exchange Program Scientific Exchange Program Electrical characterization of photon detectors based on acoustic charge transport Dr. Paulo Santos, Paul Drude Institute, Berlin,Germany Dr. Pablo Diniz Batista, Brazilian

More information

Emerging new non conventional tools

Emerging new non conventional tools Emerging new non conventional tools Near field lithography Near field lithography Near field lithography through local electrochemistry example of gold a) Surface water condensation b) Monolayer of oxidized

More information

CS257 Introduction to Nanocomputing

CS257 Introduction to Nanocomputing CS257 Introduction to Nanocomputing Overview of Crossbar-Based Computing John E Savage Overview Intro to NW growth methods Chemical vapor deposition and fluidic assembly Nano imprinting Nano stamping Four

More information

Data Storage and HAMR

Data Storage and HAMR Data Storage and HAMR Seagate Technology Mark Gubbins April 2013 Overview Storage Business and Hard Drives Magnetic Recording Head Technology HAMR - The Future of Magnetic Recording 2 The Move Toward Mobility

More information

Managing Joint Venture Arrangements Between Two Biotech Companies: A Case Report. Dr. Jan Mous Midatech / PharMida May 21 st 2014

Managing Joint Venture Arrangements Between Two Biotech Companies: A Case Report. Dr. Jan Mous Midatech / PharMida May 21 st 2014 Managing Joint Venture Arrangements Between Two Biotech Companies: A Case Report Dr. Jan Mous Midatech / PharMida May 21 st 2014 1 Midatech Ltd. Corporate verview Founded 2000 in xford, England Drug development

More information

Atomic Force Microscopy. Long Phan Nanotechnology Summer Series May 15, 2013

Atomic Force Microscopy. Long Phan Nanotechnology Summer Series May 15, 2013 Atomic Force Microscopy Long Phan Nanotechnology Summer Series May 15, 2013 1 World s Smallest Movie 2 Outline What is AFM? How does AFM Work? 3 Modes: Contact mode Non contact mode Tapping mode Imaging

More information

It has long been a goal to achieve higher spatial resolution in optical imaging and

It has long been a goal to achieve higher spatial resolution in optical imaging and Nano-optical Imaging using Scattering Scanning Near-field Optical Microscopy Fehmi Yasin, Advisor: Dr. Markus Raschke, Post-doc: Dr. Gregory Andreev, Graduate Student: Benjamin Pollard Department of Physics,

More information

CIRICULUM VITAE 1. PERSONAL. Date of Birth-Place : March 2 nd 1984- Balikesir, Turkey

CIRICULUM VITAE 1. PERSONAL. Date of Birth-Place : March 2 nd 1984- Balikesir, Turkey CIRICULUM VITAE 1. PERSONAL Name, Title : Derya ATAÇ, M.Sc. Date of Birth-Place : March 2 nd 1984- Balikesir, Turkey Address Phone E-mail : NanoElectronics Group (NE), MESA+ Institute for Nanotechnology,

More information

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex. METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE

More information

IBS - Ion Beam Services

IBS - Ion Beam Services IBS - Ion Beam Services Profile Technologies Devices & sensor fabricat ion Participation to R&D programs Researched partnership Présentation activité composant 1 Profile : Products and services Product

More information

Abigail Pillitteri University of Florida REU participant, summer 2007 Under supervision of Dr. Ivan Kravchenko

Abigail Pillitteri University of Florida REU participant, summer 2007 Under supervision of Dr. Ivan Kravchenko Optical properties of Si x N y, SiO x, and SiO x N y thin films deposited by PECVD and measured by scanning electron microscopy, ellipsometry, and spectroscopy Abigail Pillitteri University of Florida

More information