real-time and early diagnostic of diseases

Size: px
Start display at page:

Download "real-time and early diagnostic of diseases"

Transcription

1 2º eminario en Nanociencia 15 Nov La Habana, Cuba Lab-on-a-chip nanobiosensor platforms for real-time and early diagnostic of diseases U8 microchannel ilicon xide (wg cladding layer) ilicon Nitride (wg core layer) Prof. Laura M. Lechuga Nanobiosensors and Molecular Nanobiophysics Group Reseach Center on Nanoscience and Nanotechnology (CIN2: CIC-ICN) CIBER on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN) Barcelona (pain) 1

2 Research Centre on Nanoscience and Nanotechnology CIN2 (CIC-ICN) ICN) (Campus UAB, Barcelona, pain) MULTIDICIPLINARY REEARCH Nanoionics, nanooptics, nanomagnetism ynthesis of nanoparticles urface nanostructuring Nanoestructured hybrid materials Transport in nanoentities (CNT) Nanobiosensors, Nanobiophysics Nanotechnology for energy Toxicity of Nanotechnology Common research with ALBA synchrotron Building will be ready in summer Fully running at the end Research Groups running, more than 150 people. Centre for 250 persons m 2. Acess to the largest Clean Room in pain (CNM-CIC) with nanotech area. TECHNLGICAL TRANFER ENIA, L ENDR, L More information in 2

3 utline Introduction: Nanomedicine, Nanodiagnostics, Biosensors Nanobiosensors for diagnostics Plasmonic sensors Integrated Nanophotonic sensors Nanomechanical sensors Lab-on-a-chip microsystems Applications: Early detection of cancer Future perspectives 3

4 MATERIAL CNTs, NPs Nanowires Nanoparticles Graphene Nanocomposites Qdots MEDICINE Dockers PRPECT IN NANTECHNLGY ELECTRNIC Fuel cells olar cells Bateries Ultracapacitors ENERGY Boeing, 2008 Molecular electronics Nanochips Wereable electronics MP3, GP 4

5 What is Nanomedicine? Application of materials, devices and process from Nanotechnology to develop nano-sized tools for the diagnosis, prevention and treatment of diseases, mainly at the initial stage. Nanodiagnostics: Nanosensors, imaging Nanomedicine Targeted Drug Delivery Regenerative Medicine: Gene Therapy Cell Therapy Tissue Engineering To improve the prevention, diagnosis and therapy in Human Health Find, fight and follow The ultimate goal is to improve the quality of life 5

6 BIENR DEVICE ample Bioreceptor layer Aptámero ELECTRCHEMICALAmplification and data 3ensibles Transducer - amperométricos 3 representation Miniaturización y multiplexado - potenciométricos ² Mediadores para amplificar la - conductométricos with high sensitivity señal based on specific Devices ADN that detect substances Polímero de biomolecular recognition, in real-time and fast (sc to min.) 3 Altamente sensible PTICAL Transductor huella 3 Técnica robusta y reproducible - absorption organic contaminants, DNA, pathogens, molecular ubstances to be detected: proteins,- fluorescence 3 Alta capacidad de multiplexado y Transductor virus, bacteria, biowarfare agents... Transductor Analito= ustrato Productos - evanescent wave miniaturización NANBIENR MECHANICAL 3 ensibles 3 Miniaturización y multiplexado - piezoelectric Principio de funcionamiento poco - nanomechanical the reduced weight² and size, establecido + Drastic reduction of Reacción and of the sensor area: reduce amount of reagents enzimáticaanticuerpo and samples. Transductor Enzima New transducers of higher sensitivity Transductor 6

7 --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH --(CH2)6-N=CH-(CH2)3-CH NANBIENR The key is the bioengineering of the sensor interface Nanobiostructures 1.5 nm NPs Antibody Binding ite 16 nm Transducer surface riented, stable, optimal surface densidad superficial óptima, no adsorciones inespecíficas Nanoarrays nanosensor CNTs 7

8 Lab-on-a-chip nanobiosensor microsystem Lab-on-a-chip Nanobiosensores Microfluidica Electrónica y procesado datos fuentes y detectores ome applications Drug development Cancer research Microbiology Food industry Aim Targeted and rapid design of new active ingredients Identification of cancer genes and individual Classification of microorganisms Analysis of various disease pathogens in food PCT point-of care testing precision sensitivity selectivity label-free fast stability no pre-treatment Instant Diagnostic In any place at any time Can operate inside the human body 8

9 PLAMNIC NANBIENR 9

10 urface Plasmon Resonance Biosensor (PR) PR working principle External Medium ε d Analyte Receptor P k x Au 45 nm ε m Metallic layer θ k P = k 0 ε m ε d ε + ε d m k = xp 2 π λ ε sin θ P Determination of refractive index changes as a variation of the Resonance angle Reflectivity R pp urface plasmon excitation Au - nd1 Au - nd Angle of incidence (º) Displacement = change in refractive index TM-polarised, 670 nm Reflectance 0,55 0,50 0,45 0,40 0,35 0,30 n 1 0,25 0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 Time (min) n 2 n min ~ 10-5 Real-time detection of refractive index variations due to molecular interactions at a fixed angle 10

11 Plasmonic Biosensor (PR) Portable device, two channels FLW CELL V=300 νl flow rate = µl/min θ GLD FILM d = 45 nm PRIM θ BEAMPLITTER i-phtdetectr 5 mm LAER λ = 670 nm ensor module (old version, new one will be release at the end 08) electronics H N H N H N H N H N H N H N H N H N H N H N H N Au Immobilization and regeneration oftware Wireless transmission module Flow delivery ystem 11

12 PR Biosensor: applications PR IGNAL Environmental toxic pollutants in real samples (water safety) Detection limit: µg/l (ppt level, EU legislation, 0.1 µg/l) INHIBITIN IMMUNAAY DDT Chlorpyrifos Carbaryl PR IGNAL 120 MiliQ Water Drinking Water River Water 100 Groundwater E-6 1E-5 1E-4 1E-3 0,01 0, Analyte concentration (µg L -1 ) 0 1E-4 1E-3 0,01 0, Chlorpyrifos (µg L -1 ) Direct detection in real water samples More than 200 regenerable Monoclonal antibodies Validated results Anal. Bioanal. Chem. 387, 1449 (2007) Biosens.& Bioelec. 22, 1410 (2007) Anal. Bioanal. Chem. 388, 207 (2007) ens.actu. B 118, 399 (2006) Talanta 69 (2), 359 (2006) Anal. Chim. Acta 561, 40 (2006) Biosens.& Bioelec.21, 2129 (2006) No pre-treatment, fast Cycle of analysis 20 min up to 6 analytes same analysis!! 12

13 PR Biosensor: Clinical diagnosis in human samples (urine, serum) Human Growth hormone Luteinizing hormone (hlh), Folicle stimulating hormone (FH) PR IGNAL Detection limit: 6 ng/ml Human serum Urine PBT -10 1E-6 1E-5 1E-4 1E-3 0,01 0, hgh ng/ml PEN THE WAY T DIRECT DETECTIN F CANCER hghµg/ml BIMARKER IN HUMAN FLUID Growth hormone concentration in human samples (serum) ample PR ELIA ELIA PR Direct detection in real human samples No pre-treatment Detection at physiological levels More than 100 regenerable Validated results Fast Low sample volume 13

14 PR Biosensor: Early cancer diagnostics EARLY DETECTIN F INHERITED BREAT CANCER Detection of point mutations at BRCA-1 Normal equence Breast cancer cells displaying mutations at BRCA genes equence with a mismatch BRCA-1 sequence (5,711kb) 5 3 BRCA-1 Gene PR ensor DNA probe (28 mer):5 -H-(CH 2 ) 6 -(15T)-GTT CTG TCA AAC T-3 185delAG 916delTT R1443X 5382insC Covalent attachment of thiol-derivatized DNA probes DNA self-assembled monolayers (ptimisation of buffer concentration, stringency conditions, 185delAG = two bases (AG) deletion 916delTT = two bases (TT) deletion R1443X = C to T transition 5382insC = one base insertion DNA target (58 mer): 5 TGC CAC ATG GCT CCA CAT GCA AGT TTG ACA GAA CTA CCC TGA TTT TCT H H GCA C 3 DNA (mutations):5 - TGC CAC ATG GCT CCA CAT GCA AGT TTG AAA CA GAACTAC CCT GAT ACT TTT aditives, lateral and vertical spacers, Tª,) CTG GAT GCC -3 H H H H Au H H H 14

15 PR Biosensor: Early cancer diagnostics Hybridisation detection Detection of mutations Change on refractive index 49,0 48,5 48,0 47,5 47,0 46,5 46,0 Complementary 5µM Control 5µM Indice de refraccion (u.a) 1,4 1,2 1,0 0,8 0,6 0,4 0,2 0,0 Complementario Mismatch externo Mismatch interno ecuencia control V= 1,16 V= 0,96 V= 0,89 Refractive index (a.u) Time (s) Non stringent conditions LD = 10 nm 0,01 0,1 1 Concentration (µm) Refractive index (au) 1,4 1,3 1,2 1,1 1,0 0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0,0-0, Tiempo (s) High stringent conditions MeanComp meanme meanmi Boltzmann fit of CalibC1x_MeanComp Boltzmann fit of CalibC1x_meanME Boltzmann fit of CalibC1x_meanMI 0,1 1 High stringent conditions C 1X Concentration (µm) 15

16 Hybridization with PCR oligos-like: Tetra-analyte detection format 185delAG = two bases (AG) deletion 916delTT = two bases (TT) deletion R1443X = C to T transition 5382insC = one base (C) insertion 1,6 2:1:1:2 configuration 916delTT-MR 125nM C5X-F5% 916delTT-WT 125nM C5X-F5% 2:1:1:2 configuration 185delAG-MR 125nM C5X-F20% 185delAG-WT 125nM C5X-F20% PR signal (a. u.) 1,4 1,2 1,0 0,8 0,6 Gene BRCA-1 PR signal (a. u.) 0,6 0,4 0,2 0,4 0,2 0, ,0 0 2:1:1:2 configuration R1443X-MR 125nM C5X-F5% R1443X-WT 125nM C5X-F5% Time (s) 1,4 1,2 2:1:1:2 configuration Time (s) 5382insC-MR 125nM C5X-F5% 5382insC-WT 125nM C5X-F5% PR signal (a. u.) 1,2 1,0 0,8 0,6 0,4 0,2 0, Time (s) DNA Extraction Patient PCR ensor chip Time scale: less than 1 hour BRCA-1 sequence (5,711kb) pb 1013 pb 3 63/61 pb 185delAG 58/60 pb 916delTT GCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAA AATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAA CCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTG CATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG TGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACA AGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGA AAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTAT GCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCC TGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGG GCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACC CGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAA CTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATT GGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTT ATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCC TCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAA AAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATAC TGAACATCATCAACCCAGTAATAATGATTTGAACACCACTG AGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGG GTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCAC AAATACTCATGCCA 66 pb R1443X 66/67 pb 5382insC PR signal (a. u.) 1,0 0,8 0,6 0,4 0,2 0,0 TTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTG A/C G AAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTT CACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGA AGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGT TCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCAT CCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATG CACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCAT CTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCA ACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACA TCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACC TGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCT GATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTG GCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAA TTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTC ATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGT GTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAA GGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGAC CCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAA CACCACATCACTTTAACTAATCTAATTACTGAAGAGACTAC TCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAAC GGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATG GGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAAGAAA GAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGA TGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCA AGAGAATCC CAGGACAGAAAGATCTTCAGGGGGCTAGA AATCTGTT Time (s) To the sensor for analysis 16

17 BUT with PR biosensors... No sensitivity for small analytes and very low concentrations (pm-femtom, single-molecule detection) Although portable device, size and weight are not optimal Multianalyte capabilities for high throughput Higher sensitivity is required Microsystems platforms High throughput/multiplexing capabilities 1) Integrated photonic Mach-Zehnder nanointerferometers 2) Nanomechanical biosensors (standard and optical microcantilevers) 3) Localised urface Plasmon Resonance in nanoparticles (LPR) and magnetoplasmonic biosensors 17

18 Localised plasmon in Nanoparticles Au nanospheres EM strongly localized Au nanorods Au decahedra Au/i 2 Van Duyne, Nature 2008 Prof. Luis Liz- Marzán, Univ. Vigo 18

19 Far field radiation - scattering LPR: Dark-field Microscopy J. Feldmann, Munich Nano Lett. 2003, 3, 935 For low density of NPs The light scattered by single noble metal nanoparticles can be measured in a darkfield microscope. Depending on the material, size, shape and dielectric nanosurrounding, the nanoparticles scatter light of different colour. PEN THE PIBILITY F HIGHLY DENE NANBIENING ARRAY FR THUAND F ANALYTE 19

20 PHTNIC NANBIENR 20

21 Photonic Nanosensor: Mach-Zehnder Interferometer Evanescent wave detection ensing arm Y-junctions: 50% splitting and recombining Reference arm Intensity I I φ φ Phase shift, Φ 2 I = Io δ 1+ V cos 2π Φ = N L λ quadrature point [ ( Φ) ] Design of the system ingle mode behaviour High surface sensitivity 21

22 Photonic chip ptical waveguides rib of 4 nm i 3 N 4 75 nm Width 4 µm i 2 2 µm cladding i ustrate tandard fabrication at Clean Room facilities. Robust and reproducible technology. 4 nm Advances in ptical Technologies ID ,

23 MZI Performance 30 ensitivity evaluation TE exp TE theorical y= x n o,min = 1.1x10-7 N eff, min = 2.0x10-8 Phase change Φ The detection limit value corresponds to an average growth layer of nm ( mol.cm 2 ) and a urface ensitivity around nm -1. Direct detection in the picomolar range (10-12 M) is possible (60 fg/ mm 2 ) Refractive index variation n 0 eñal (U.A.) n = 2, TE TM

24 MZI ensor: Clinical diagnosis EARLY DETECTIN F INHERITED BREAT CANCER Detection of point mutations at BRCA-1 Normal equence BRCA-1 sequence (5,711kb) 5 3 Breast cancer cells displaying mutations at BRCA genes equence with a mismatch 185delAG 916delTT R1443X 5382insC 185delAG = two bases (AG) deletion 916delTT = two bases (TT) deletion R1443X = C to T transition 5382insC = one base insertion BRCA-1 Gene Fully complementary target MZI sensor Not fully complementary target DNA probe (28 mer):5 -H-(CH 2 ) 6 -(15T)-GTT CTG TCA AAC T-3 DNA target (58 mer): 5 TGC CAC ATG GCT CCA CAT GCA AGT TTG ACA GAA CTA CCC TGA TTT TCT GCA C 3 DNA (mutations):5 - TGC CAC ATG GCT CCA CAT GCA AGT TTG AAA CA GAACTAC CCT GAT ACT TTT CTG GAT GCC -3 MPTM Complementary sequence to ILANIZACIÓN the mutated one: for patients with the disease, total 10 % T=25ºC hybridisation. t=24 h i - (CH 2 ) 3 -H i - (CH 2 ) 3 -H Complementary sequence to the non-mutated one: for healthy patients, partial hybridisation. H-ADN i - (CH 2 ) 3 (CH 2 ) 3 T 15 i - (CH 2 ) 3 (CH 2 ) 3 T 15 LIGNUCLEÓTID -DNA -DNA LIGNUCLEÓTID 24

25 Nanophotonic chip: Results φ (2π) φ(2 π) ignal (A. U.) 3,5 3,0 1,0 2,5 2,8 0,8 2,0 2,1 0,6 1,5 1,4 0,7 1,0 0,4 0,5 0,2 0,0 0,0 0,0 Complementary Control Data: Data13_B Model: LangmuirEXT1 Equation: Mutated y = (a*b*x^(1-c))/(1 + b*x^(1-c)) Weighting: y By PR only 100 nm is possible!!! Complementary Control No weighting Chi^2/DoF = ingle-base mutations R^2 = a LD ± = 25 nm b ± c LD ± = 10 pm control 10 pm 25 nm 1E-12 1E-11 1E-10 1E-9 1E-8 1E-7 1E-6 1E-5 1E-4 1E-13 1E-12 1E-11 1E-10 1E-9 [ADN] 1E-9 (M) 58 MER 1E-7 1E-8 1E-71E-51E-6 1E-3 By PR only DNA 10 nm (M) is possible!!! [DNA] (M) 25

26 From chip on a lab to lab on a chip Results using a macro-flow cell: only one sensor, high volume of reagents and samples. Integration of micro/nanobiosensors in platforms with microfluidics, biological reagents, excitation and signal acquisition and processing. 26

27 Lab-on-a-chip Biosensor microsystem: ur approach Integrated Microfluidic Macro/micro connection grating couplers electronics Photodiodes MZI Modulation system Fully integration of optical functions within microfluidic chips is in its infancy on-chip approach 27

28 Nanosensor/microfluidics integration MZI MZI sensor Microchannels separated 50 µm 114 µm height Channels of µm height and µm width U8 microchannel walls Inlet port ilicon xide (wg cladding layer) ilicon Nitride (wg core layer) Embedded Microchanne l 3D-microfluidic network PIE Photonics West, 2007, 647 J. of Micromechanics and Microengineering, 16, 1006, 2006 Microfluidic inlet and the embedded microchannel on top the MZI devices 28

29 Nanosensor/microfluidics integration Connection macro/micro Modular technology using microfabricated PMMA housing external module Easy replacement of the external connections and packaging 4,0 hgh hormone 3,8 N H I (au) 3,6 3,4 3,2 teady-state flow rates: µl/min Up to 10 Bar without any liquid leakage i Au Reduction of 100 times the chemical reagents consumption!!! 3,0 2,8 2,6 Time (s) U-8 microfluidics is resistant to acid and organic solvents (cleaning and regeneration) 29

30 Development of an implantable biosensor for continuous care and monitoring of diabetic patients (P. CEZANNE) The biosensor will be implanted in the human body during 6 months-1 year, working in a continuous way and with a wireless transmitting data capabilities. CLALIT HEALTH PRTECH AF LTD LABMAN AUTMATIN MICRTECH.R.L. AFCN IND. LTD FIMI.R.L. IVEC RMANIA A RBERT BCH GMBH CNM-CIC FRAUNHFER E.V. IRAEL UK UK ITALY IRAEL ITALY RMANIA GE PAIN GE 30

31 NANMECHANICAL BIENR 31

32 What is a microcantilever sensor? i microcantilever A new class of highly sensitive, label-free and direct biosensor which transduces the molecular recognition of biomolecules into a nanomechanical motion (NPs-DNA and femtomolar-proteins) 1) Microcantilever functionalization 2) Biomolecular Recognition produces a bending of the cantilever due to change of surface stress PTICAL READ-UT: High sensitivity Cantilever bending nm 1 ν 2 z 4 L( σ ) 2 t σ b Et Array of cantilevers Trends in Anal. Chem (TRAC), 25(3), 196, 2006 Appl. Phys. Lett. 89 (2006) Cantilever Biosensors In ptical Biosensors: Today and Tomorrow Editorial (si libro): Ed. F. Liegler and C. Taitt. Elsevier, Amsterdam (NL)

33 Nanomechanical Biosensors i cantilevers, 2560 cantilevers, Array of 20-cantilevers, mm thick, k= N/m ix time more sensitive for biosensing than commercial ones minimum detectable deflection 0.1 nm sensitivity expressed in fm/hz-1/2 : 100 PRTEIN EVALUATIN (nm range) Antibody 5µg/ml LiB-DDT 0 HCl 0.1M -50 HCl 0.1M -200 ADN-H 2µM 0 Deflexión (nm) Deflexión (nm) Antibody 5µg/ml LiB-DDT DDT 10nM + Antibody 5µg/ml LiB-DDT DNA EVALUATIN Deflexión (nm) complementario 1µM Tiempo (min) Tiempo (min) Langmuir, 20, 9663, 2004 Biosensors & Bioelectronics, 18, 649, Tiempo (min) 33

34 Integration in Microsystems Array of sensors For measuring arrays of microcantilevers... Array of lasers Array of PDs and CM Advantages High sensitivity ub-angstrom resolution Disadvantages Complex integration (difficult alignment): Difficult read-out of arrays equential switching of the laser due to overlapping of the reflection beams Complex detection by the PD chip Microlens array onto laser chip Immobilisation in each cantilever using the 20-flow cell ptics:20-vcel+drivers Photodetector array. CM circuitry Microarrays of 20 microcantilevers Microfluidics:flow cell with 20 channels Flow cell-20-channels ensors and Actuators B, 118, 2,

35 Novel optical waveguide microcantilever sensor PD array No alignment (except for light coupling) More integrated approach laser beam cantilever 1 cantilever 1 No further adjustment Conventional photodetectors cantilever N laser beam cantilever 1 cantilever 1 Conventional PhotoDetector Conventional PhotoDetector laser beam cantilever N 35

36 WC: Design and fabrication light in gap cantilever input waveguide (IWG) ilicon xide (0.5 um) light out PD output waveguide (receptor) ilicon nitride 0.1 um Tested materials: LPCVD i 3 N 4, PECVD i 3 N 4, PECVD i 2, Thermal i 2 ilicon oxide cantilever, 600 nm ilicon nitride receptor, 120 nm Wavelength nm Gap: 3 µm 2 propagation modes Z input waveguide buffer cantilever substrate Coupling efficiency at the junction: up to 70 % Trends in Anal. Chem (TRAC), 25(3), 196,

37 WC: Devices The chips on wafer A separated chip The output waveguides 2500 cantilevers per wafer 20 cantilevers per chip Cantilevers are 200 x 40 x 0.6 µm direct incoupling pring constant 0.05 N/m The input waveguides The cavity and cantilevers Applied ptics, 45(2), 1, 2006 Applied Physics Letters, 92,

38 WC: Performance cantilever WC chips tested in air Light in Light out operated in dynamic mode amplitude, V W Readut, V ,052 0,050 0,048 0,046 0,044 0,042 air flow Light intensity distribution Cantilever Displacement, µm in resonance out of resonance cantilever 200 um air gap 3 um Cantilever end displacement, nm displacement voltage change Piezoactuator voltage, V Applying an excitation V of variable frequency and amplitude The cantilever displacement can be detected with resolution of 0.04 nm HIGH ENITIVITY, GD PERFRMANCE FR BIENING Modulation amplitude, mv 0,0000 0,0001 0,0002 Time, s J. Lightwave Tech., 24(5),

39 Future opportunities Actual DNA/Protein Biochips Need of high amounts of sample: (time consuming, expensive) Non-specific interactions Indirect read-out: fluorescent labeling. Labels Bride DNA Groom DNA restric assay types Low sensitivity for single mismatch detection Inconsistent activity of immobilised proteins Lab-on-a-chip Nanobiosensors as an advanced platform Array of microcantilevers Drastic reduction of sample amount Direct read-out: real time analysis High sensitivity Micro/nanotechnology: mass production with low cost 39

40 In the future... Nanobiosensores en urgencias Tecnologías Nanofotónica Nanotubos, nanopartículas Nanomecánica, NEM Beneficios Datos en tiempo real e in-situ Imagen a nivel celular Herramientas quirúrgicas de precisión guiadas por sensores Nanobiosensores en la consulta Tecnologías Biochips Nanoarrays de alta densidad Beneficios Análisis completo en minutos Diagnósticos rápidos y precisos Tratamientos específicos y personalizados Nanobiosensores en casa Tecnologías Wireless Dispositivos portátiles con batería Displays de alta resolución Beneficios Auto-Pruebas diagnósticas simples Transmisión automática de datos a historial clínico 40

41 Acknowledgements Nanobiosensors Group (CIN2-CIC) CIC) Team profile: physicist, chemist, electronics engineers, molecular biologist, biotechnologist, biophysics, experts in optoelectronics technology, Finantial funding from: European Union (V and VI FP) panish Ministry of cience panish Ministry of Health (CIBER) panish National Research Council M. Botín Foundation Barcelona, pain 41

42 Nanobiosensors Group: our activity PR, Magneto-PR and LPR Integrated optics Nanophotonic biosensor (MZI) µ-fluidics integration Nanomechanical biosensors (standard and optical) Carbon Nanotubes Biosensors Biofuncionalization Lab-on-a-chip technological platforms (in-vitro and in-vivo) Applications: environmental control, clinical diagnostics ingle-molecule biophysics using Magnetic tweezers and AFM MRE INF IN U8 microchannel ilicon xide (wg cladding layer) ilicon Nitride (wg core layer) 42

43 ensia biosensingolutions ensia is a company of Group with the participation of MNDRAGN CRPERATIN (MCC) NEW PR VERIN AVAILABLE N JUNE

Enhanced light-target interaction using a novel anti-resonant waveguide concept

Enhanced light-target interaction using a novel anti-resonant waveguide concept Enhanced light-target interaction using a novel anti-resonant waveguide concept Oliver Schmidt 1,2,*, Michael Bassler 1, Peter Kiesel 1, Oliver Wolst 1,, and Gottfried H. Döhler 2 1 Palo Alto Research

More information

Molecule specific sensing elements Synthesis of molecules with various functional groups and/or repellent properties N CH 3 O

Molecule specific sensing elements Synthesis of molecules with various functional groups and/or repellent properties N CH 3 O MLECULAR SENSRS We develop molecular sensors for various detection methods (i.e. both sensing surfaces and devices). The sensing surfaces are based on molecule specific layers composed of self-assembled

More information

VTT Diagnostics Platform Kristiina Takkinen Research Professor

VTT Diagnostics Platform Kristiina Takkinen Research Professor VTT Diagnostics Platform Kristiina Takkinen Research Professor Sensing Opportunities for Diagnostics in Healthcare and Wellbeing Micronova Event on Tuesday 20.11.2012 2 Diagnostic industry Key Drivers

More information

IFAC CNR. Francesco Baldini Ambra Giannetti Andrea Mencaglia Cosimo Trono Giacomo Ghini Folco Senesi

IFAC CNR. Francesco Baldini Ambra Giannetti Andrea Mencaglia Cosimo Trono Giacomo Ghini Folco Senesi Chemical and biochemical optical sensor group IFAC CNR Francesco Baldini Ambra Giannetti Andrea Mencaglia Cosimo Trono Giacomo Ghini Folco Senesi Optical chemical and biochemical sensors SPECIFIC SENSORS

More information

5. Scanning Near-Field Optical Microscopy 5.1. Resolution of conventional optical microscopy

5. Scanning Near-Field Optical Microscopy 5.1. Resolution of conventional optical microscopy 5. Scanning Near-Field Optical Microscopy 5.1. Resolution of conventional optical microscopy Resolution of optical microscope is limited by diffraction. Light going through an aperture makes diffraction

More information

Plasmons Surface Plasmon Resonance Plasmonic Effects and Applications

Plasmons Surface Plasmon Resonance Plasmonic Effects and Applications Plasmons Surface Plasmon Resonance Plasmonic Effects and Applications Introduction During the last two decades many researches devoted to develop optical sensors for the measurement of chemical and biological

More information

Scanning Probe Microscopy

Scanning Probe Microscopy Scanning Probe Microscopy SPM: Scanning Probe Microscopy STM: scanning tunneling microscope tunneling of electrons between probe and surface, Resolve individual atoms, measure electrical, properties, induce

More information

Fabrication Challenges for Point-ofcare Diagnostics and Organ-on-chip

Fabrication Challenges for Point-ofcare Diagnostics and Organ-on-chip Fabrication Challenges for Point-ofcare Diagnostics and Organ-on-chip Zulfiqur Ali (z.ali@tees.ac.uk) Project DIGINOVA: Biomedical Applications for Digital Fabrication, 6 th November 2013, CPI s National

More information

Scanning tunneling microscopy STM. and. atomic force microscopy AFM

Scanning tunneling microscopy STM. and. atomic force microscopy AFM Scanning tunneling microscopy STM and atomic force microscopy AFM Content The components of a scanning probe microscope SPM The scanner Measurement of the distance between surface and tip The cantilever

More information

Materialanalytik. Praktikum

Materialanalytik. Praktikum Materialanalytik Praktikum UV-VIS Absorption Spectroscopy B507 Stand: 06.10.2014 The objective of this experiment is to gain hands-on experience with (1) Calibration of the UV-VIS spectrometer (2) Optical

More information

Microfluidic refractive index sensor based on polymer grating couplers

Microfluidic refractive index sensor based on polymer grating couplers Microfluidic refractive index sensor based on polymer grating couplers C. Prokop 1,2, S. Schoenhardt 1,2, Christian Karnutsch 1, Arnan Mitchell 2 1 Institute for Optofluidics and Nanophotonics (IONAS),

More information

Detection of several cancer biomarkers by. semiconductor Si nanowires

Detection of several cancer biomarkers by. semiconductor Si nanowires VIETNAM NATIONAL UNIVERSITY HO CHI MINH CITY LABORATORY FOR NANOTECHNOLOGY Detection of several cancer biomarkers by semiconductor Si nanowires Laboratory for Nanotechnology Viet nam National University

More information

Graphene oxide as an efficient signal-to-background enhancer for DNA detection with a long range resonance energy transfer strategy

Graphene oxide as an efficient signal-to-background enhancer for DNA detection with a long range resonance energy transfer strategy This journal is The Royal Society of Chemistry 011 Supporting Information Graphene oxide as an efficient signal-to-background enhancer for DNA detection with a long range resonance energy transfer strategy

More information

ABC s of Electrochemistry: Atomic Force Microscopy (AFM) and Scanning Tunneling Microscopy (STM)

ABC s of Electrochemistry: Atomic Force Microscopy (AFM) and Scanning Tunneling Microscopy (STM) ABC s of Electrochemistry: Atomic Force Microscopy (AFM) and Scanning Tunneling Microscopy (STM) Brian Lloyd Hassler September 22, 2011 Department of Chemical and Biomolecular Engineering Presentation

More information

Outline. Self-assembled monolayer (SAM) formation and growth. Metal nanoparticles (NP) anchoring on SAM

Outline. Self-assembled monolayer (SAM) formation and growth. Metal nanoparticles (NP) anchoring on SAM From functional nanostructured surfaces to innovative optical biosensors Giacomo Dacarro Dipartimento di Fisica A.Volta Dipartimento di Chimica Generale Università degli Studi di Pavia Dalla scienza dei

More information

MEMS devices and applications. Dr Julien Arcamone Business development, Silicon Components division

MEMS devices and applications. Dr Julien Arcamone Business development, Silicon Components division MEMS devices and applications Dr Julien Arcamone Business development, Silicon Components division julien.arcamone@cea.fr Outline I. Introduction: LETI, a major player in MEMS R&D II. Activities on MEMS

More information

construction et l amplification de la Les nanoparticules d or pour la réponse des Biocapteurs Souhir Boujday, Anne-Laure Morel et Claire-Marie Pradier

construction et l amplification de la Les nanoparticules d or pour la réponse des Biocapteurs Souhir Boujday, Anne-Laure Morel et Claire-Marie Pradier Les nanoparticules d or pour la construction et l amplification de la réponse des Biocapteurs ouhir Boujday, Anne-Laure Morel et Claire-Marie Pradier Laboratoire de Réactivité de urface, UMR 7197, Université

More information

Keysight Technologies How to Choose your MAC Lever. Technical Overview

Keysight Technologies How to Choose your MAC Lever. Technical Overview Keysight Technologies How to Choose your MAC Lever Technical Overview Introduction Atomic force microscopy (AFM) is a sub-nanometer scale imaging and measurement tool that can be used to determine a sample

More information

STUDENT BACKGROUND READING FOR EXPERIMENT C: COLORIMETRIC GOLD NANOSENSOR

STUDENT BACKGROUND READING FOR EXPERIMENT C: COLORIMETRIC GOLD NANOSENSOR STUDENT BACKGROUND READING FOR EXPERIMENT C: In this experiment you will synthesize and test a plasmonic colorimetric nanosensor made of nanoparticles of gold. Here we provide you with some background

More information

Basic principles and mechanisms of NSOM; Different scanning modes and systems of NSOM; General applications and advantages of NSOM.

Basic principles and mechanisms of NSOM; Different scanning modes and systems of NSOM; General applications and advantages of NSOM. Lecture 16: Near-field Scanning Optical Microscopy (NSOM) Background of NSOM; Basic principles and mechanisms of NSOM; Basic components of a NSOM; Different scanning modes and systems of NSOM; General

More information

Ultrahigh-efficiency solar cells based on nanophotonic design

Ultrahigh-efficiency solar cells based on nanophotonic design Ultrahigh-efficiency solar cells based on nanophotonic design Albert Polman Piero Spinelli Jorik van de Groep Claire van Lare Bonna Newman Erik Garnett Marc Verschuuren Ruud Schropp Wim Sinke Center for

More information

Instrumental Technique: AFM probe. Azhar

Instrumental Technique: AFM probe. Azhar Instrumental Technique: AFM probe Azhar 29-03-14 Introduction: Atomic force microscopy (AFM) is one of the types of scanning probe microscopy used for imaging, measuring, and manipulating matter at the

More information

Time resolved x-ray microscopy

Time resolved x-ray microscopy Time resolved x-ray microscopy D. Pelliccia 1,, A. Cedola 1, I. Bukreeva 1, F. Scarinci 1 and S. Lagomarsino 1 1) Istituto Fotonica e Nanotecnologie - CNR - Roma ) Dip. Fisica Univ. "La Sapienza" and INFN

More information

Surface plasmon resonance biosensors

Surface plasmon resonance biosensors Surface plasmon resonance biosensors Introduction Surface plasmon resonance (SPR) spectroscopy is a surface-sensitive technique that has been used to characterize the thickness and/or index of refraction

More information

Nano-photonics for efficient solar cells

Nano-photonics for efficient solar cells Nano-photonics for efficient solar cells F.-J. Haug Ecole Polytechnique Fédérale de Lausanne (EPFL), Institute of Microengineering (IMT), Photovoltaics and Thin Film Electronics Laboratory, 2000 Neuchâtel,

More information

Scanning Tunneling Microscope (STM)

Scanning Tunneling Microscope (STM) Scanning Tunneling Microscope (STM) yz-piezo-scanner z y high voltage amplifier probing tip I feedback regulator sample Negative feedback keeps the current constant (pa-na) by moving the tip up and down.

More information

Nanowire Sensing Biosensors and Bioelectronics. Zhen Zhu, D-BSSE, ETH Zurich

Nanowire Sensing Biosensors and Bioelectronics. Zhen Zhu, D-BSSE, ETH Zurich Nanowire Sensing Biosensors and Bioelectronics Zhen Zhu, D-BSSE, ETH Zurich 17-05-2010 Outline Why nanowire sensing? What is nanowire? How to synthesize and exploit nanowire? Where to apply nanowire sensors?

More information

Introduction to Photonic Integrated Circuits

Introduction to Photonic Integrated Circuits Introduction to Photonic Integrated Circuits Min-Hsiung Shih( 施閔雄 ) Research Center for Applied Sciences (RCAS) & Taiwan International Graduated Program (TIGP) Academia Sinica, Taiwan May 9, 2008 Outlines

More information

APLICATION OF BIOCHIP USING THE MOLECULAR BEACON PROBE IN BREAST CANCER GENE P53 DETECTION

APLICATION OF BIOCHIP USING THE MOLECULAR BEACON PROBE IN BREAST CANCER GENE P53 DETECTION APLICATION OF BIOCHIP USING THE MOLECULAR BEACON PROBE IN BREAST CANCER GENE P53 DETECTION Ferdiansyah 1, A. W. Ninggar 1*. 1 Department of Biochemistry, Bogor Agricultural University, Bogor, Indonesia

More information

MICROLASER DISPLACEMENTMETER. S. Sakano College of Engineering, Nihon University 1 Nakagawara-Tokusada Tamura-cho Koriyama , Japan

MICROLASER DISPLACEMENTMETER. S. Sakano College of Engineering, Nihon University 1 Nakagawara-Tokusada Tamura-cho Koriyama , Japan MICROLASER DISPLACEMENTMETER S. Sakano College of Engineering, Nihon University 1 Nakagawara-Tokusada Tamura-cho Koriyama 963-8642, Japan Abstract: An extremely small optical displacement sensor using

More information

Fiber optics sensors. J. Dubard. Laboratoire commun de métrologie LNE-CNAM

Fiber optics sensors. J. Dubard. Laboratoire commun de métrologie LNE-CNAM Fiber optics sensors J. Dubard Laboratoire commun de métrologie LNE-CNAM Outline Introduction Sensor metrology needs Biosensor Current sensor Temperature sensor Conclusion 2 Introduction Fiber optics sensors

More information

Aplicaciones de la nanolitografía de oxidación por AFM

Aplicaciones de la nanolitografía de oxidación por AFM ForceTool Aplicaciones de la nanolitografía de oxidación por AFM (AFM oxidation nanolithography or Local oxidation nanolithography) Templates for the growth of molecular arquitectures Transistors Sensors

More information

AFM History and Methods

AFM History and Methods Figure 2 Schematic of the major components of an atomic force microscope, showing the feedback loop for TappingMode operation. Applied forces during imaging typically range between 0.1 and 100 nn. Although

More information

E F G. Overview of the activities. SAPIE ZA Università di Roma - Laboratorio di Fotonica Molecolare

E F G. Overview of the activities. SAPIE ZA Università di Roma - Laboratorio di Fotonica Molecolare SAPIE ZA Università di Roma Dipartimento di Energetica Laboratorio di Fotonica Molecolare Francesco Michelotti E-Mail: francesco.michelotti@uniroma1.it Tel: +39 06-49.91.65.62 Workshop Future Trends in

More information

Electronic Biosensors Henrique Leonel Gomes hgomes@ualg.pt Office: 2.82 Phone: +351 289 800 900 ext. 7763 Fax: +351 289 8000 066

Electronic Biosensors Henrique Leonel Gomes hgomes@ualg.pt Office: 2.82 Phone: +351 289 800 900 ext. 7763 Fax: +351 289 8000 066 Electronic Biosensors Henrique Leonel Gomes hgomes@ualg.pt Office: 2.82 Phone: +351 289 800 900 ext. 7763 Fax: +351 289 8000 066 Welcome Welcome to electronic biosensors course. This is a useful course

More information

E-Jet (Electrohydrodynamic Jet) Printing

E-Jet (Electrohydrodynamic Jet) Printing E-Jet (Electrohydrodynamic Jet) Printing Lead Faculty Researcher: John Rogers Department: Materials Science & Engineering J.-U. Park et al. Nature Mater. 6. 782 (2007) 1. Description: This non-contact

More information

Scanning Near-Field Optical Microscopy for Measuring Materials Properties at the Nanoscale

Scanning Near-Field Optical Microscopy for Measuring Materials Properties at the Nanoscale Scanning Near-Field Optical Microscopy for Measuring Materials Properties at the Nanoscale Outline Background Research Design Detection of Near-Field Signal Submonolayer Chemical Sensitivity Conclusions

More information

Rayleigh Surface Acoustic Wave (SAW) devices

Rayleigh Surface Acoustic Wave (SAW) devices Rayleigh Surface Acoustic Wave (SAW) devices SAW mode of propagation Lord Rayleigh, 1881: On waves propagating along the plane of an elastic solid A Rayleigh wave is composed of a longitudinal and a vertical

More information

Integrating Technologies. Optical MEMS. Categories of Optical MEMS. Micro-Optics. Driven by communications industry

Integrating Technologies. Optical MEMS. Categories of Optical MEMS. Micro-Optics. Driven by communications industry Integrating Technologies Optical MEMS Fundamentals of Micromachining Dr. Bruce Gale With special thanks to Dr. Michael McShane Micro-Optics Driven by communications industry Couplers, demultiplexers, switches,

More information

Bio Interface Focus Area Vision

Bio Interface Focus Area Vision Bio Interface Focus Area Vision Application pull: Aging population, exploding healthcare cost Technology push: Nanosensors, wearables, wireless, cloud, big data Plasma Prevalent Medical Practices Molecular

More information

E-beam lithography on transparent substrates: challenges and results

E-beam lithography on transparent substrates: challenges and results E-beam lithography on transparent substrates: challenges and results Thomas Händel www.vistec-semi.com Outline Motivation Material properties Experimental samples, process and electron-beam lithography

More information

MFM: AFM with magnetical probe magnetic force microscope, Measure magnetic domains combine with topography

MFM: AFM with magnetical probe magnetic force microscope, Measure magnetic domains combine with topography STM: scanning tunneling microscope tunneling of electrons between probe and surface, Resolve individual atoms, measure electrical, properties, induce photo luminesence. Only conducting samples. AFM: atomic

More information

Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants.

Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants. Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants. Supplemental Figure 2. Role of SPLs in Anthocyanin Accumulation. (A) Inflorescences of spl mutants. Scale bar represents 0.5 cm. (B) Close-ups

More information

Atomic Force Microscopy (AFM)

Atomic Force Microscopy (AFM) AFM - Introduction Atomic Force Microscopy (AFM) Probe: FORCES between tip and sample van der Waals force: AFM - Introduction Formation of an AFM image Tip at free end of a flexible cantilever Deflection

More information

Quantum Hadamard Gate Implementation Using Planar Lightwave Circuit and Photonic Crystal Structures

Quantum Hadamard Gate Implementation Using Planar Lightwave Circuit and Photonic Crystal Structures American Journal of Applied Sciences 5 (9): 1144-1148, 2008 ISSN 1546-9239 2008 Science Publications Quantum Hadamard Gate Implementation Using Planar Lightwave Circuit and Photonic Crystal Structures

More information

Photonic crystal based immunosensor for clinical diagnosis

Photonic crystal based immunosensor for clinical diagnosis 1,4 ID:31132 2 nd year of the PhD in Electronic Devices Official Tutors: Prof. M. De Vittorio 1,2,3, Ing. Tiziana Stomeo 1, Prof. Fabrizio Pirri 4, Prof. Carlo Ricciardi 4 Collaborators: A. Qualtieri 1,

More information

Presentation ti By: Shahdeep Mohammed PID:

Presentation ti By: Shahdeep Mohammed PID: NANO EXPLOSIVE SENSOR Presentation ti By: Shahdeep Mohammed PID: 1318940 Table of Contents Introduction Properties of Explosives Ion Mobility Spectrometry (IMS) Mass spectrometry (MS) Gas Chromatography

More information

Cell, Volume 166. Supplemental Information. Enhancer Control of Transcriptional Bursting. Takashi Fukaya, Bomyi Lim, and Michael Levine

Cell, Volume 166. Supplemental Information. Enhancer Control of Transcriptional Bursting. Takashi Fukaya, Bomyi Lim, and Michael Levine Cell, Volume 166 Supplemental Information Enhancer Control of Transcriptional Bursting Takashi Fukaya, Bomyi Lim, and Michael Levine Supplemental experimental procedures Expression Plasmids pbphi-multi

More information

Overview of Microarray Types

Overview of Microarray Types Overview of Microarray Types DNA Microarrays DNA microarrays (also called Gene Chips) are devices not much larger than postage stamps. They are based printed on a glass substrate containing as many as

More information

Microfluidic Electrochemical Sensors

Microfluidic Electrochemical Sensors Microfluidics and electrochemical sensors are integrated in a single chip by thin-film technologies. Integrated thinlayer hybrid SU-8/Glass chips offer a suitable analytical solution for multiple applications.»

More information

AFM-IR for soft materials, including organics, polymers, composites and life sciences s-snom for hard materials including inorganics, semiconductors,

AFM-IR for soft materials, including organics, polymers, composites and life sciences s-snom for hard materials including inorganics, semiconductors, s TM AFM-IR for soft materials, including organics, polymers, composites and life sciences s-snom for hard materials including inorganics, semiconductors, nanoantennas, graphene and other 2D materials

More information

Design of an Arrayed Waveguide Grating for Photonic Integrated Circuits

Design of an Arrayed Waveguide Grating for Photonic Integrated Circuits Design of an Arrayed Waveguide Grating for Photonic Integrated Circuits Ryan Lang 6.191 December 7, 2001 Abstract Arrayed waveguide gratings are useful structures for the implementation of wavelength division

More information

Nano Optics: Overview of Research Activities. Sergey I. Bozhevolnyi SENSE, University of Southern Denmark, Odense, DENMARK

Nano Optics: Overview of Research Activities. Sergey I. Bozhevolnyi SENSE, University of Southern Denmark, Odense, DENMARK Nano Optics: Overview of Research Activities SENSE, University of Southern Denmark, Odense, DENMARK Optical characterization techniques: Leakage Radiation Microscopy Scanning Near-Field Optical Microscopy

More information

Phase Modulation Sensors

Phase Modulation Sensors Phase Modulation Sensors Wei-Chih Wang Department of Power Mechanical Engineering National Tsinghua University Why Phase modulation High Sensitivity (i.e. 0.1nm resolution) Relatively simple optical setup

More information

5/27/2016 NANO DISCLOSURES NANOTECHNOLOGY. Lisa Ferrara, Ph.D. Nanotechnology deals with sizes from 1-100nm range 10-9 m.

5/27/2016 NANO DISCLOSURES NANOTECHNOLOGY. Lisa Ferrara, Ph.D. Nanotechnology deals with sizes from 1-100nm range 10-9 m. NANOTECHNOLOGY Lisa Ferrara, Ph.D. OrthoKinetic Technologies, LLC & OrthoKinetic Testing Technologies, LLC lisa@orthokintech.com 910.253.9883 DISCLOSURES OKT Strategic Planning & Regulatory Consulting

More information

SIMULATION AND MODELLING OF WHITE LIGHT FIBRE INTERFEROMETER

SIMULATION AND MODELLING OF WHITE LIGHT FIBRE INTERFEROMETER SIMULATION AND MODELLING OF WHITE LIGHT FIBRE INTERFEROMETER 1 HOOD-HONG LEY, 2 ASIAH YAHAYA AND 3 YUSOF MUNAJAT 1,2,3 Department of Physics, Faculty of Science, UniversitiTeknologi Malaysia, 81310, UTM

More information

Biofunctionalization as Key Step in Microfluidic Based Applications

Biofunctionalization as Key Step in Microfluidic Based Applications MicroNano Conference, December 08-09 2015, Amsterdam Biofunctionalization as Key Step in Microfluidic Based Applications Dr. Guido Bared Dr. Wilfried Weigel Scienion AG, Berlin Scienion - Company Background

More information

Semiconductor laser fundamentals

Semiconductor laser fundamentals Semiconductor laser fundamentals Major disadvantages of LEDs: 1.2 1 Too broad output beam r/rmax 0.8 0.6 0.4 0.2 0 1.4 1.42 1.44 1.46 1.48 Energy, ev Too broad spectrum P opt time Too slow pulse response

More information

alpha300 R Confocal Raman Microscope

alpha300 R Confocal Raman Microscope alpha300 R Confocal Raman Microscope www.witec.de alpha300 R Confocal Raman Microscope with unrivaled resolution and sensitivity The alpha300 R represents a new generation of Raman imaging systems, 0 focusing

More information

CHAPTER 3: LASER SOURCE

CHAPTER 3: LASER SOURCE CHAPTER 3: LASER SOURCE Light Amplification by Stimulated Emission of Radiation, commonly referred to as "Laser" describes a wide range of devices. The lasers can function as oscillators (sources of light)

More information

Extending electron and ion beam lithography schemes to innovative nanofabrication processes

Extending electron and ion beam lithography schemes to innovative nanofabrication processes Extending electron and ion beam lithography schemes to innovative nanofabrication processes Frank Nouvertné Raith GmbH, Hauert 18, 44227 Dortmund, Germany Taken from Raith best picture award image gallery

More information

Department of Chemical and Biomolecular Engineering (BK 21+ program),

Department of Chemical and Biomolecular Engineering (BK 21+ program), Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supporting Information Metal ion triggers for reversible switching of DNA polymerase Ki Soo Park,

More information

Introduction to Biosensors. Professor Brian Birch LIRANS University of Luton UK

Introduction to Biosensors. Professor Brian Birch LIRANS University of Luton UK Introduction to Biosensors Professor Brian Birch LIRANS University of Luton UK What is a Biosensor? As many definitions as workers in the field! I favour: a device that utilises biological components e.g.

More information

Biomedical sensors in the pharmaceutical industry Olav Flaten

Biomedical sensors in the pharmaceutical industry Olav Flaten Biomedical sensors in the pharmaceutical industry Olav Flaten MD PhD FFPM Medical Director GlaxoSmithKline Health Care Industry Pharmaceutical Industry/Big Pharma: Fine pharmaceuticals: Innovative drugs;

More information

Interoperable 100G Interfaces over Single- Mode Fiber. Brian Welch

Interoperable 100G Interfaces over Single- Mode Fiber. Brian Welch Interoperable 100G Interfaces over Single- Mode Fiber Brian Welch www.luxtera.com Agenda Silicon Photonics Background Unique attributes Differences from conventional technologies Interoperability PSM4

More information

Spectrometer. Introduction. Sources of Radiation

Spectrometer. Introduction. Sources of Radiation Spectrometer Strictly speaking, a spectrometer is any instrument used to view and analyze a range (or aspectrum) of a given characteristic for a substance (for example, a range of mass-to-charge values

More information

CREOL, College of Optics & Photonics, University of Central Florida

CREOL, College of Optics & Photonics, University of Central Florida OSE6650 - Optical Properties of Nanostructured Materials Optical Properties of Nanostructured Materials Fall 2013 Class 3 slide 1 Challenge: excite and detect the near field Thus far: Nanostructured materials

More information

Supplementary Materials. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like

Supplementary Materials. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like Supplementary Materials Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like (NRPS-like) gene in Aspergillus nidulans is responsible for microperfuranone biosynthesis Applied

More information

Fluorescence Microscopy for an NMR- Biosensor Project

Fluorescence Microscopy for an NMR- Biosensor Project Fluorescence Microscopy for an NMR- Biosensor Project Ole Hirsch Physikalisch-Technische Bundesanstalt Medical Optics Abbestr. -1, 10587 Berlin, Germany Overview NMR Sensor Project Dimensions in biological

More information

MeV ion induced anisotropic plasmon resonances of Ag nanocrystals in glass

MeV ion induced anisotropic plasmon resonances of Ag nanocrystals in glass 5 MeV ion induced anisotropic plasmon resonances of Ag nanocrystals in glass Ion irradiation of silica glass containing Ag nanocrystals with 30 MeV Si 5+ ions results in an alignment of Ag nanocrystals

More information

Yb-doped glass microcavity laser operation in water

Yb-doped glass microcavity laser operation in water Chapter 4 Yb-doped glass microcavity laser operation in water 4.1 Introduction The previous chapter analyzed the performance of a Yb:SiO 2 microtoroid laser tested in normal air. The knowledge learned

More information

A Brief Introduction to Atomic Force Microscopy

A Brief Introduction to Atomic Force Microscopy A Brief Introduction to Atomic Force Microscopy Introduction In 1986, Gerd Binnig and Heinrich Rohrer won the Nobel Prize in Physics for the invention of the scanning tunnelling microscope (STM) and the

More information

Plasmoniset infrapunailmaisimet

Plasmoniset infrapunailmaisimet VTT TECHNICAL RESEARCH CENTRE OF FINLAND LTD Plasmoniset infrapunailmaisimet Toteuttaja: Teknologian tutkimuskeskus VTT Oy MATINE-rahoitus: 71820 MATINEn tutkimusseminaari 17.11.2016 Kirsi Tappura, Tekn.

More information

Designing with UVC LEDs:

Designing with UVC LEDs: WHITEPAPER: Designing with UVC LEDs: Accelerating Spectroscopic Applications in Life Sciences and Environmental Monitoring WWW.CISUVC.COM Designing with UVC LEDs: Accelerating Spectroscopic Applications

More information

FIBER OPTICS. Prof. R.K. Shevgaonkar. Department of Electrical Engineering. Indian Institute of Technology, Bombay. Lecture: 28.

FIBER OPTICS. Prof. R.K. Shevgaonkar. Department of Electrical Engineering. Indian Institute of Technology, Bombay. Lecture: 28. FIBER OPTICS Prof. R.K. Shevgaonkar Department of Electrical Engineering Indian Institute of Technology, Bombay Lecture: 28 Integrated Optics Fiber Optics, Prof. R.K. Shevgaonkar, Dept. of Electrical Engineering,

More information

Coupling Engineering Sciences and Life Sciences: An overview of LAAS Activities with a special focus on Nano-Oncology Projects

Coupling Engineering Sciences and Life Sciences: An overview of LAAS Activities with a special focus on Nano-Oncology Projects Christophe Vieu Toulouse University Chargé de Mission du LAAS Axe Interaction avec le vivant Coupling Engineering Sciences and Life Sciences: An overview of LAAS Activities with a special focus on Nano-Oncology

More information

Inspire. Integrated IR Nanocharacterization Powered by Exclusive PeakForce IR PS PMMA

Inspire. Integrated IR Nanocharacterization Powered by Exclusive PeakForce IR PS PMMA Inspire Integrated IR Nanocharacterization Powered by Exclusive PeakForce IR PS PMMA Si Inspire New Capabilities for New Discoveries A first of its kind nanoscale mapping system Nanochemical properties

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Micro- and nanotechnology for future ICT

Micro- and nanotechnology for future ICT Micro- and nanotechnology for future Ralph W. Bernstein SINTEF 1 Moores law Gordon Moores observation from 1965: The number of transistors per square inch on an IC doubles every year. In subsequent years,

More information

a) b) Fig 5.33: Final accelerometer aspect and first measurements with fiber optics.

a) b) Fig 5.33: Final accelerometer aspect and first measurements with fiber optics. Final aspect of the accelerometer is presented in fig. 5.33a. Picture in fig. 5.33b shows the device in the optical bench. In this case, the device is under 1g acceleration, since it suffers from the earth

More information

Surface and tip enhanced Raman spectroscopy of nanostructures

Surface and tip enhanced Raman spectroscopy of nanostructures 3 rd Empa - WUT - NIMS Workshop 09.09.2010 Materials Sci ence & Technolog y Surface and tip enhanced Raman spectroscopy of nanostructures Dr. Pierre BRODARD Laboratory for Mechanics of Materials and Nanostructures

More information

CHEMICAL SENSORS 1. DEFINITION

CHEMICAL SENSORS 1. DEFINITION CHEMICAL SENSORS 1. DEFINITION A chemical sensor is a device that transforms chemical information (composition, presence of a particular element or ion, concentration, chemical activity, partial pressure

More information

INVESTIGATION OF MECHANICAL RESONATORS WITH THE AID OF FIBER OPTIC INTERFEROMETER FABRY-PEROT

INVESTIGATION OF MECHANICAL RESONATORS WITH THE AID OF FIBER OPTIC INTERFEROMETER FABRY-PEROT INVESTIGATION OF MECHANICAL RESONATORS WITH THE AID OF FIBER OPTIC INTERFEROMETER FABRY-PEROT Siltec Ltd., Tel/Fax: (7-095) 408-6672, e-mail: avc.mipt@g23.relcom.ru Fiber optic interferometer Experimental

More information

Nanostructured Metal-Organic Composite Solar Cells

Nanostructured Metal-Organic Composite Solar Cells Nanostructured Metal-Organic Composite Solar Cells Investigators Mark L. Brongersma, Assistant Professor, Materials Science and Engineering; Shanhui Fan, Assistant Professor, Electrical Engineering; Peter

More information

Figure 1: Layout of an optical step-index fiber. The refractive index profile for a graded-index fiber is shown as a dashed line for comparison.

Figure 1: Layout of an optical step-index fiber. The refractive index profile for a graded-index fiber is shown as a dashed line for comparison. Fiber Optics 1 Background The intent of this laboratory is to make you familiar with the fundamentals of optical fibers. While we give a very brief introduction to fiber optics, you should read corresponding

More information

Towards a miniaturized micromechanical electronic nose SYWERT H. BRONGERSMA SR. PRINCIPAL RESEARCHER

Towards a miniaturized micromechanical electronic nose SYWERT H. BRONGERSMA SR. PRINCIPAL RESEARCHER Towards a miniaturized micromechanical electronic nose SYWERT H. BRONGERSMA SR. PRINCIPAL RESEARCHER e-nose: advanced sensing in complex environments Human olfactory system e-nose: array of non-specific,

More information

Lecture #5: Surface Plasmon Resonance (SPR) Biosensing Objectives

Lecture #5: Surface Plasmon Resonance (SPR) Biosensing Objectives Laboratory of Biosensors and Bioelectronics Lecture #5: Surface Plasmon Resonance (SPR) Biosensing Objectives Understand the basic concepts of surface plasmon polariton Discuss the principles of operation

More information

New directions in QCL applications: from optofluidic lasers to plasmonic laser antennas

New directions in QCL applications: from optofluidic lasers to plasmonic laser antennas New directions in QCL applications: from optofluidic lasers to plasmonic laser antennas MIKHAIL BELKIN Capasso group Division of Engineering and Applied Sciences Harvard University mbelkin@deas.harvard.edu

More information

Preparation of silver nanoparticles by laser ablation in water

Preparation of silver nanoparticles by laser ablation in water Preparation of silver nanoparticles by laser ablation in water Author: Raúl Bola Sampol Facultat de Física, Universitat de Barcelona, Diagonal 4, 828 Barcelona, Spain*. Abstract: Solutions of silver nanoparticles

More information

Recent developments in high bandwidth optical interconnects. Brian Corbett. www.tyndall.ie

Recent developments in high bandwidth optical interconnects. Brian Corbett. www.tyndall.ie Recent developments in high bandwidth optical interconnects Brian Corbett Outline Introduction to photonics for interconnections Polymeric waveguides and the Firefly project Silicon on insulator (SOI)

More information

Bioanalytical Applications of Nanotechnology Petr Skládal National Centre of Biomolecular Research and Department of Biochemistry Faculty of Science,

Bioanalytical Applications of Nanotechnology Petr Skládal National Centre of Biomolecular Research and Department of Biochemistry Faculty of Science, Bioanalytical Applications of Nanotechnology Petr Skládal Bioanalytical Applications of Nanotechnology Petr Skládal National Centre of Biomolecular Research and Department of Biochemistry Faculty of Science,

More information

Collimation & Termination

Collimation & Termination Collimation & Termination Wei-Chih Wang Southern Taiwan University of Technology Fiber Direct Focusing Bare fiber coupling fiber X-Y stage lens Pigtailed and connectorized fiber optic devices Mechanical

More information

2 μ. ori P ADH1. Amp r pgadt7-recab. 8.2 kb. Stuffer Fragment T ADH1. puc. ori LEU2. HA epitope tag. Matchmaker 5' AD LD-Insert Screening Amplimer

2 μ. ori P ADH1. Amp r pgadt7-recab. 8.2 kb. Stuffer Fragment T ADH1. puc. ori LEU2. HA epitope tag. Matchmaker 5' AD LD-Insert Screening Amplimer Amp r puc ori 2 μ ori 8.2 kb LEU2 HA epitope tag P ADH1 SV40 NLS GAL4 AD P T7 Stuffer Fragment T ADH1 MCS B (2245 2298) MCS A (1898 2034) PT3718-5 MCS A 1858 T7 Promoter CTA TTC GAT GAT GAA GAT ACC CCA

More information

Bright Future of Photonics

Bright Future of Photonics Bright Future of Photonics Seppo Honkanen Photonics Group Micro and Nanosciences Laboratory Helsinki University of Technology Outline Photonics (?) Activities at Micronova Photonics Group Conclusion 2

More information

Coupled-Mode Devices

Coupled-Mode Devices ECE 5322 21 st Century Electromagnetics Instructor: Office: Phone: E Mail: Dr. Raymond C. Rumpf A 337 (915) 747 6958 rcrumpf@utep.edu Lecture #6 Coupled-Mode Devices Lecture 6 1 Lecture Outline Review

More information

Nanotechnology for Smart Materials in Water Treatment

Nanotechnology for Smart Materials in Water Treatment Nanotechnology for Smart Materials in Water Treatment Ivan Maximov Lund Nano Lab, Division of Solid State Physics Nanometer Structure Consortium, Lund University e-mail: ivan.maximov@ftf.lth.se Talk outline

More information

(Unofficial Translation) Explanatory Notes on applying for investment promotion for Category 7.12 Biotechnology

(Unofficial Translation) Explanatory Notes on applying for investment promotion for Category 7.12 Biotechnology (Unofficial Translation) Explanatory Notes on applying for investment promotion for Category 7.12 Biotechnology For further clarification of investment promotion in biotechnology stated in the BOI Announcement

More information

Fabry-Perot Interferometer. Goals of the lab: Department of Physics. Slide 1. PHYSICS6770 Laboratory 2

Fabry-Perot Interferometer. Goals of the lab: Department of Physics. Slide 1. PHYSICS6770 Laboratory 2 Slide 1 Goals of the lab: Understand how to measure distances and displacements capacitively and with a Fabry-Perot interferometer Understand how a Fabry-Perot interferometer works Learn how to operate:

More information