Prostaglandin E2 Enhances Human Cord Blood Stem. Cell Xenotransplants and Shows Long-Term Safety. in Preclinical Nonhuman Primate Transplant Models

Size: px
Start display at page:

Download "Prostaglandin E2 Enhances Human Cord Blood Stem. Cell Xenotransplants and Shows Long-Term Safety. in Preclinical Nonhuman Primate Transplant Models"

Transcription

1 Cell Stem Cell, Volume 8 Supplemental Information Prostaglandin E2 Enhances Human Cord Blood Stem Cell Xenotransplants and Shows Long-Term Safety in Preclinical Nonhuman Primate Transplant Models Wolfram Goessling, Robyn S. Allen, Xiao Guan, Ping Jin, Naoya Uchida, Michael Dovey, James M. Harris, Mark E. Metzger, Aylin C. Bonifacino, David Stroncek, Joseph Stegner, Myriam Armant, Thorsten Schlaeger, John F. Tisdale, Leonard I. Zon, Robert E. Donahue, and Trista E. North Inventory of Supplemental Information Figure S1, related to Figure 1 Representative FACS plots showing gating for apoptosis (A) and proliferation (B) analysis depicted graphically in Figure 1E, F. Figure S2, related to Figure 2 Results of preliminary short-term hematopoietic transplantation experiments to determine incubation period (A) and media (B) to be utilized in hcb xenotransplantation assays shown in Figure 2C,D. Figure S3, related to Figure 2 Representative FACS plots showing gating for hcd45 content for chimerism analysis summarized graphically in Figure 2C,D. Figure S4, related to Figure 2 Representative FACS plots showing gating for multilineage contribution of control (A) and dmpge2 (B) BM samples with tabular summary of total average (+/- SD) lineage distribution (C) from mice depicted in Figure 2C,D with greater than 1% chimerism. Figure S5, related to Figure 2 Graphical summary of xenotransplantation experiments using CD34+ hcb following treatment with dmpge2, which correlates with the whole hcb transplants in Figure 2C,D. Figure S6, related to Figure 4 FACS plots illustrating the gating controls and the contribution of DMSO or dmpge2- treated GFP and YFP-transduced cells to total PB of each of the rhesus monkey undergoing autologous transplantation at the representative time point indicated, which correlates to the multilineage longitudinal distribution study shown in Figure 4A,B.

2 Figure S7, related to Figure 5 Heat map representation of microarray analysis of human and rhesus MPBSCs at fixed intervals post dmpge2 or control treatment related to gene list content depicted in Figure 5 and Supplemental Table 3. Table S1, related to Figure 2 Average and standard deviation of individual colony types following control or dmpge2 treatment at fixed intervals post exposure related to data shown graphically in Figure 2A,B. Table S2, related to Figure 4 EGFP and EYFP transduction efficiencies for each autologous MPBSC unit utilized in the rhesus dmpge2 transplantation protocol for which results are shown in Figure 4. Table S3, related to Figure 5 Commonly regulated gene lists corresponding to microarray data shown in the scatter plots and Venn diagram in Figure 5: Tab A- Human MPBSCs at 10 and 50uM PGE2 vs Monkey at 50uM dmpge2; Tab B- Human MPBSCs at 10 vs 50uM dmpge2; Tab C- Human MPBSCs at 10uM dmpge2 vs Monkey at 50uM dmpge2; Tab D- Human MPBSCs vs Monkey at 50uM dmpge2. Available online. Table S4, related to Figure 6 Genes indicative of commonly UP (Tab A) and DOWN (Tab B) regulated Ingenuity pathways found in Human MPBSCs at 10 and 50uM PGE2 vs Monkey at 50uM dmpge2 as depicted in the Venn diagram and highlighted in a tabular form in Figure 6. Available online. Table S5, related to Figure 6 Commonly UP (Tab A) and Down (Tab B) regulated Ingenuity pathways found in Human MPBSCs at 10 vs 50uM dmpge2 as depicted in the Venn diagram in Figure 6. Available online. Table S6, related to Figure 6 Commonly UP (Tab A) and Down (Tab B) regulated Ingenuity pathways found in Human MPBSCs at 10uM dmpge2 vs Monkey at 50uM dmpge2 as depicted in the Venn diagram in Figure 6. Available online. Table S7, related to Figure 6 Commonly UP (Tab A) and Down (Tab B) regulated Ingenuity pathways found in Human MPBSCs vs Monkey at 50uM dmpge2 as depicted in the Venn diagram in Figure 6. Available online. Supplemental Experimental Procedures 1, related to Quantitative PCR methods List of primers used in qpcr characterization of human and rhesus CD34+ HSCs.

3 Supplemental Experimental Procedures 2, related to Autologous Competitive Transplant Study methods Schematic representation of the non-human primate autologous transplant protocol.

4 Figure S1 (related to Figure 1) dmpge2 limits apoptosis and enhances proliferation of CD34+ hcb cells in vitro hcb cells are incubated with 1μM dmpge2 and analyzed at fixed intervals; representative examples are shown. A- AnnexinV, a marker of apoptosis, was diminished 6 hrs after dmpge2 incubation. B- EdU incorporation, marking cellular proliferation, was increased at 6 hrs following dmpge2 treatment.

5 Figure S2 (related to Figure 2) Alteration in dmpge2 exposure length and incubation media does not effect spleen colony formation A,B- ckit+sca1+lin- cells were isolated from murine bone marrow and transplanted into lethally irradiated C57Bl/6 mice. Results depicted as mean with standard deviation cells transplanted, n=10/group; t-test, * p<0.001 versus control. A- An incubation time of 1 vs. 2hrs had no measurably distinct effect on the enhancement of spleen colony formation by dmpge2. B- Alteration in the incubation media: PBS, dextran/albumin or Dulbecco s minimal essential medium (DMEM), had no effect on the ability of dmpge2 to enhance spleen colony formation.

6 Figure S3 (related to Figure 2) Chimerism for hcd45 in the peripheral blood and bone marrow of NOD/SCID mice A,B- Sublethally irradiated NOD/SCID mice were transplanted with either control- or dmpge2-treated hcb. Chimerism for hcd45+ cells was determined by FACS analysis in PB (A) and BM (B). Representative FACS plots are shown, indicating the increase in hcd45+ cells in the mice that received dmpge2-treated hcb.

7 Figure S4 (related to Figure 2) Multilineage analysis of BM chimerism reveals a positive effect of dmpge2 on human stem and progenitor, myeloid and T-cell repopulation CD34+ hcb was transplanted into sublethally irradiated NOD/SCID mice. BM from

8 transplant recipients with >1% hcb chimerism was analyzed at 3 months post transplantation for multilineage distribution of human cells. A,B- Representative FACS plots of BM multilineage analysis of (A) control-treated and (B) PGE2-treated hcb recipients. C- Summary and statistical analysis (t-test) of average (+/-SD) human contribution to individual blood lineages across recipients of control-treated (n=5) and dmpge2-treated (n=15) hcb.

9 Figure S5 (related to Figure 2) dmpge2 enhances CD34+ hcb proliferation engraftment in vivo A,B- CD34+ hcb was transplanted into sublethally irradiated NOD/SCID mice. PB was analyzed at 1 and 3 months post transplantation, recipient BM at 3 months. A- Individual chimerism of mice receiving control CD34+ hcb (red squares) or dmpge2-treated hcb (blue circles). The mean is indicated by a solid horizontal line; a dashed line indicates the cut-off of 1% for positive engraftment. PB- 1 month: control , dmpge ; t-test, p=0.0055; 3 months: control , dmpge ; t-test, p=0.0013; BM- control , dmpge ; t-test, p= B- Cumulative summary depicting the percentage of all animals with hcb engraftment: PB- 1 month: control 9/20, dmpge2 26/20; Fisher s exact test (one-tailed) p=0.0484; 3 months: control 8/18, dmpge2 15/18; Fisher s exact test (one-tailed) p=0.013; BMcontrol 7/17, dmpge2 14/17; Fisher s exact test (one-tailed) p=0.032.

10 Figure S6 (related to Figure 4) Representative PB EGEP/EYFP FACS analysis of individual rhesus macaques at the most recent analysis post-reinfustion. A- Control FACS plots showing fluorescence intensity of unstimulated/untransduced rhesus PB or transduced (EGFP OR EYFP) rhesus cell lines. B- FACS analysis for individuals 1 and 2 of the pre-treatment protocol, at day 391 (M1)

11 and day 355 (M2) post-reinfusion respectively; DMSO or dmpge2 treatment is indicated. C- FACS analysis for individuals 3, 4 and 5 of the post-treatment protocol, at day 328 (M3), day 279 (M4) and day 193 (M5) post-reinfusion respectively; DMSO or dmpge2 treatment is indicated.

12 Figure S7 (related to Figure 5) Heat map representation of the human vs. non-human primate MPBSC microarray analysis, showing all treatment groups.

13 Table S1: Limiting-dilution H4434 methylcellulose hcb differentiation assay Exposure Treatment Cell Density Ery Mac G GM GEMM [min] Avg SD Avg SD Avg SD Avg SD Avg SD 12 DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge DMSO dmpge

14 Table S2: Transduction efficiency of Monkey CD34+ MPBSC Animal ID Vector Treatment Efficiency [%] Std. Dev. [%] Pre-Transduction Treatment M1 chiv-egfp dmpge2 50μM chiv-eyfp XVIVO M2 chiv-egfp XVIVO chiv-eyfp dmpge2 50μM Post-Transduction Treatment M3 chiv-egfp dmpge2 50μM chiv-eyfp XVIVO M4 chiv-egfp XVIVO chiv-eyfp dmpge2 50μM M5 chiv-egfp XVIVO chiv-eyfp dmpge2 50μM

15 Supplemental Experimental Procedures 1: qpcr analysis for human and monkey genes was performed using the primer pairs listed. HUMAN Forward Primer Reverse Primer Actin GCACAGAGCCTCGCCTTT GGAATCCTTCTGACCCATGC EP1 GATGGTGGGCCAGCTTGTC GCCACCAACACCAGCATTG EP2 GTGCTGACAAGGCACTTCATGT TGTTCCTCCAAAGGCCAAGTAC EP3 AAGGCCACGGCATCTCAGT TGATCCCCATAAGCTGAATGG EP4 CTTGGAGGCAGGAATTTGCTT AAAGTCCTCAGTGAGGTGGTGTCT SCL ATGAGATGGAGATTACTGATG GCCCCGTTCACATTCTGCT Runx1A/B CGTGCACATACATTAGTAGCACTACCTTTG CTTCCACGAATCTTGCTTGCAGAGGTTAAG Runx1C GAAGTCTGAACCCAGCATAGTGGTCAGCAG GTGGACGTCTCTAGAAGGATTCATTCCAAG CCND1 GTGCTGCGAAGTGGAAACC ATCCAGGTGGCGACGATCT CCNE1 CCACACCTGACAAAGAAGATGATGAC GAGCCTCTGGATGGTGCAATAAT BCLXL AACTGGGTCTCCTGACTTGG AAGGACAGTGTTGGCAAAGG BAX GGCGGCAATCATCCTCTG TGCTTCAGGGTTTCATCCAG BCL2 GGTCATGTGTGTGGAGAGCG GGTGCCGGTTCAGGTACTCA CDNK1A GTCACTGTCTTGTACCCTTGTG CGGCGTTTGGAGTGGTAGAAA FAS AGCTTGGTCTAGAGTGAAAA GAGGCAGAATCATGAGATAT BAD CGAGTGAGCAGGAAGACTCCA AGGAGTCCACAAACTCGTCACT CDK1 CCATTTTGCCAGAAATTCGT TTTTCAGAGCTTTGGGCACT HDAC1 TAAATTCTTGCGCTCCATCC AACAGGCCATCGAATACTGG COX1 TGGCTGGGCGTGCTAGAGGTT CAGCCTGCGTGAGGTGTGTCACT COX2 GGAACACAACAGAGTATGCG AAGGGGATGCCAGTGATAGA PTGES GGTCTTGGGTTCCTGTATGGT GGGACTCAAACCTTGGGAGG CREM CTCTAGTGCAGTTACCTTCGGG ACCTGAACGGTGTGTATTTCTG CREB CCAGCAGAGTGGAGATGCAG GGGCTAATGTGGCAATCTGTG PDE4D CATGTCACCCAAGACCATGTC GAGAAGTTGCTACGGACGCT CXCR4 CCTATGCAAGGCAGTCCATGT GGTAGCGGTCCAGACTGATGA VEGF CCAATCGAGACCCTGGTG CACACAGGATGGCTTGAAGA IL8 ACCAGCAGTACGTGATCGG CTTCTCGCGGAAGCTGATGTT NCAD CCATCAAGCCTGTGGGAATC GCAGATCGGACCGGATACTG BMP4 TTCCTGGTAACCGAATGCTGA CCCTGAATCTCGGCGACTTTT CD41 GATGAGACCCGAAATGTAGGC TCAGTCTTTTCTAGGACGTTCCA EPHB2 GGACTGGTACTATACCCACAGAT TGTCTGCTTGGTCTTTATCAACC VAV1 CAGCAGTGGGAAGCACAAAG GTCACGGGCGCAGAAGTC GLUT1 GATTGGCTCCTTCTCTGTGG TCAAAGGACTTGCCCAGTTT FOS TGCCTCTCCTCAATGACCCTGA ATAGGTCCATGTCTGGCACGGA HIF1A GCTTCCTTCGATCAGTTGTC TCAGTGGTGGCAGTGGTAGT EVI1 TTGCCAAGTAACAGCTTTGCTG CCAAAGGGTCCGAATGTGACTT BMI1 CTGGTTGCCCATTGACAGC CAGAAAATGAATGCGAGCCA FLT3 TTTACCCCACTTTCCAATCACAT CGAGTCCGGGTGTATCTGAAC MMP9 GTGCTGGGCTGCTGCTTTGCTG GTCGCCCTCAAAGGTTTGGAAT IKAROS GACGCACTCCGTCATTAAAGA CGACGTTACTTGCTAGTCTGTC STAT5 AGATGCTGGCCGAGGTCAAC AGACTTGGCCTGCTGCTCAC FOXO1 AGTCTGAGGTGCTGGCGGAG GGTGGTGGCGTATCAGAGGTG MONKEY Forward Primer Reverse Primer Actin GCACAGAGCCTCGCCTTT GGAATCCTTCTGACCCATGC EP1 GATGGTGGGCCAGCTTGTC GCCACCAACACCAGCATTG EP2 GTGCTGACAAGGCACTTCATGT TGTTCCTCCAAAGGCCAAGTAC EP3 AAGGCCACGGCATCTCAGT TGATCCCCATAAGCTGAATGG EP4 CTTGGAGGCAGGAATTTGCTT AAAGTCCTCAGTGAGGTGGTGTCT

16 Supplemental Experimental Procedures 2: Schematic representation of rhesus macaque autologous transplantation protocol: alternations in DMSO or dmpge2 treatment either pre- (A) or post- (B) differential fluorophore transduction prior to reinfusion are indicated by the paired dashed and solid lines.

How To Expand Hematopoietic Stem Cells

How To Expand Hematopoietic Stem Cells Purification and Expansion of Hematopoietic Stem Cells Based on Proteins Expressed by a Novel Stromal Cell Population Our bodies are constantly killing old, nonfunctional, and unneeded cells and making

More information

Basic Science in Medicine

Basic Science in Medicine Medical Journal of th e Islamic Republic of Iran Volume 18 Number 3 Fall 1383 November 2004 Basic Science in Medicine ] EXPANSION OF HUMAN CORD BLOOD PRIMITIVE PROGENITORS IN SERUM-FREE MEDIA USING HUMAN

More information

Disclosure. Gene Therapy. Transfer of genes into cells Expression of transferred genes

Disclosure. Gene Therapy. Transfer of genes into cells Expression of transferred genes Disclosure Equity interest in Genetix Pharm. Inc. Exclusive license of retroviral cell lines from Columbia No direct participation in MDR clinical trials Columbia U. annual reporting FDA Gene Therapy Transfer

More information

Supplemental Information. McBrayer et al. Supplemental Data

Supplemental Information. McBrayer et al. Supplemental Data 1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were

More information

A. FSC and SSC gating of total BM cells. B. Gating strategy used to identify the Lin -

A. FSC and SSC gating of total BM cells. B. Gating strategy used to identify the Lin - Supplementary Figure legends Figure S1. Multiparametric analysis of HSC Populations. A. FSC and SSC gating of total BM cells. B. Gating strategy used to identify the Lin - cell population. BM cells were

More information

Proliferation/Potency Assays: Is there more to CD34 and CFU?

Proliferation/Potency Assays: Is there more to CD34 and CFU? Proliferation/Potency Assays: Is there more to CD34 and CFU? CBMTG 2012 Laboratory Committee Meeting April 11, 2012 Toronto, ON, Canada Leah Marquez-Curtis CBS-Edmonton OUTLINE I. Rationale and Definitions

More information

Economics of Cord Blood Banking. Michael Boo NMDP Be The Match September 11, 2015

Economics of Cord Blood Banking. Michael Boo NMDP Be The Match September 11, 2015 Economics of Cord Blood Banking Michael Boo NMDP Be The Match September 11, 2015 Historical Use UCB Use Data 2 NMDP Historical Transplants by Product 7,000 6,500 6,000 5,500 5,000 4,500 4,000 3,500 3,000

More information

Sensitizing Protective Microenvironments to Antibodymediated. 7.3.2014 Dr. Christian P. Pallasch

Sensitizing Protective Microenvironments to Antibodymediated. 7.3.2014 Dr. Christian P. Pallasch Sensitizing Protective Microenvironments to Antibodymediated Therapy 7.3.2014 Dr. Christian P. Pallasch The Microenvironment in Lymphoma and Leukemia Lymphomagenesis Therapy Progression Seite 2 Sensitizing

More information

Improved Ex Vivo Expansion of Functional CD34 + Cells Using Stemline II Hematopoietic Stem Cell Expansion Medium

Improved Ex Vivo Expansion of Functional CD34 + Cells Using Stemline II Hematopoietic Stem Cell Expansion Medium Improved Ex Vivo Expansion of Functional CD34 + Cells Using Stemline II Hematopoietic Stem Cell Expansion Medium Daniel W. Allison, 1 Stacy L. Leugers, 1 Barry J. Pronold, 2 Gary Van Zant, 2 Jenny A. Harrington,

More information

CHAPTER 5. Summarizing Discussion and Future Perspectives

CHAPTER 5. Summarizing Discussion and Future Perspectives CHAPTER 5 Summarizing Discussion and Future Perspectives 133 Summarizing Discussion Expansion and maintenance of self renewing primitive hematopoietic stem cells (HSCs) would have major implications in

More information

Automated and Standardized Counting of CFU Assays for Cord Blood Banks

Automated and Standardized Counting of CFU Assays for Cord Blood Banks Automated and Standardized Counting of CFU Assays for Cord Blood Banks 2 Automated and Standardized Colony Counting Table of Contents 4 The Colony-Forming Unit (CFU) Assay for Cord Blood Banks 5 The CFU

More information

AUTOMATION OF THE COLONY-FORMING CELL ASSAY FOR MEASURING HEMATOPOIETIC PROGENITORS IN CORD BLOOD

AUTOMATION OF THE COLONY-FORMING CELL ASSAY FOR MEASURING HEMATOPOIETIC PROGENITORS IN CORD BLOOD AUTOMATION OF THE COLONY-FORMING CELL ASSAY FOR MEASURING HEMATOPOIETIC PROGENITORS IN CORD BLOOD Bert Wognum Oliver Egeler Caren Grande Ning Yuan Steven Woodside Terry Thomas Allen Eaves STEMCELL Technologies

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study.

Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. 1 Supplemental data Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. Supplemental Fig. S2. Ingenuity Pathway Analysis (IPA) of the 56 putative caspase substrates

More information

Preparation of cord blood for infusion: bedside thaw, dilute and wash, or somewhere in between

Preparation of cord blood for infusion: bedside thaw, dilute and wash, or somewhere in between Preparation of cord blood for infusion: bedside thaw, dilute and wash, or somewhere in between Donna Wall, MD Director, Manitoba Blood and Marrow Transplant Program ISCT 2012 Disclosures: none The problem:

More information

Automated and Standardized Counting of CFU Assays of Human Hematopoietic Cells

Automated and Standardized Counting of CFU Assays of Human Hematopoietic Cells Automated and Standardized Counting of CFU Assays of Human Hematopoietic Cells 2 Automated and Standardized Colony Counting Table of Contents 4 Standardized Counting of Colony-Forming Unit Assays (CFU)

More information

Fee-for-service cores for Investigational New Drug enabling studies

Fee-for-service cores for Investigational New Drug enabling studies UC DAVIS INSTITUTE FOR REGENERATIVE CURES Fee-for-service cores for Investigational New Drug enabling studies Pipeline pathway at UC Davis Institute for Regenerative Cures Basic Research Proof of Concept

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Pl I enary Tr T anslational Medicine April 30, 2015

Pl I enary Tr T anslational Medicine April 30, 2015 Plenary I Translational Medicine April 30, 2015 HBO in Hematopoietic Stem Cell Transplantation: Lessons Learned Omar Aljitawi, MD Hematology/Oncology Hematology and Transplantation (HAT) Laboratory Pathology

More information

Cord Blood for Cellular Therapy: A Snapshot of this Evolving Market Landscape

Cord Blood for Cellular Therapy: A Snapshot of this Evolving Market Landscape GENReports: Market & Tech Analysis Cord Blood for Cellular Therapy: A Snapshot of this Evolving Market Landscape > Enal Razvi, Ph.D. Biotechnology Analyst, Managing Director SELECTBIO US enal@selectbio.us

More information

3D Cell Culture mimsys G

3D Cell Culture mimsys G 3D Cell Culture mimsys G xeno-free & nutrient permeable hydrogel for 3D cell culture mimsys G is a xeno-free and non-immunogenic, easy to handle hydrogel for cell encapsulation in 3D experiments in vitro

More information

Transmedcon 2014. Ahmedabad, Gujarat November 14-16, 2014

Transmedcon 2014. Ahmedabad, Gujarat November 14-16, 2014 FACT Accreditation for Cord Blood Banks and Cellular Therapy Nadim Mahmud, MD, PhD Associate Professor of Medicine Division of Hematology/Oncology Director, Hospital Stem Cell Laboratory Blood & Marrow

More information

Head of College Scholars List Scheme. Summer Studentship. Report Form

Head of College Scholars List Scheme. Summer Studentship. Report Form Head of College Scholars List Scheme Summer Studentship Report Form This report should be completed by the student with his/her project supervisor. It should summarise the work undertaken during the project

More information

Project Lead: Stephen Forman, M.D. PI: Elizabeth Budde, M.D., Ph.D

Project Lead: Stephen Forman, M.D. PI: Elizabeth Budde, M.D., Ph.D Phase I study using T cells expressing a CD123-specific chimeric antigen receptor and truncated EGFR for patients with relapsed or refractory acute myeloid leukemia Project Lead: Stephen Forman, M.D. PI:

More information

Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth

Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth Humoral response to therapeutic low-intensity pulsed ultrasound (LIPUS) treatment of rat maxillary socket after the removal of a molar tooth Kouki Hidaka *1, Chihiro Miyamoto *2, Satoko Wada-Takahashi

More information

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation Hematopoietic Stem Cells, Stem Cell Processing, and Joseph (Yossi) Schwartz, MD Director, Hemotherapy and Stem Cell Processing Facility E-mail: js2745@columbia.edu A 40-year old man with acute myelogenous

More information

International Beryllium Conference, Montreal, Canada March 10, 2005

International Beryllium Conference, Montreal, Canada March 10, 2005 Alternative Lymphocyte Proliferation Tests: BrdU and Flow Cytometry Based Tests International Beryllium Conference, Montreal, Canada March 10, 2005 Tim K. Takaro Department of Environmental and Occupational

More information

Stem cells possess 2 main characteristics: Sources of pluripotent stem cells: -Long-term self renewal. -The inner cell mass of the blastocyst.

Stem cells possess 2 main characteristics: Sources of pluripotent stem cells: -Long-term self renewal. -The inner cell mass of the blastocyst. Stem cells possess 2 main characteristics: -Long-term self renewal. - They give rise to all types of differentiate cells. Sources of pluripotent stem cells: -The inner cell mass of the blastocyst. - Fetal

More information

Do you have anything to add? If so, I d love to hear from you! Jessica Robinson Conference Manager Life Sciences @jessbiopharma

Do you have anything to add? If so, I d love to hear from you! Jessica Robinson Conference Manager Life Sciences @jessbiopharma 1 Who is the most influential figure in cord blood around the world? What is the biggest challenge to overcome in the use of cord blood as a source of stem cells? We asked 10 leading experts in the cord

More information

Human Umbilical Cord-derived Multipotent Mesenchymal Stromal Cells (huc-msc) Handling Instructions

Human Umbilical Cord-derived Multipotent Mesenchymal Stromal Cells (huc-msc) Handling Instructions Human Umbilical Cord-derived Multipotent Mesenchymal Stromal Cells (huc-msc) Order No.: 19401-005, 19401-010 Handling Instructions For preclinical ex vivo use. Not intended for therapeutic use. Table of

More information

Chemotherapy resistance in acute myeloid leukemia: the role of adhesion

Chemotherapy resistance in acute myeloid leukemia: the role of adhesion Chemotherapy resistance in acute myeloid leukemia: the role of adhesion Joe C. Huang, M.D. Research Elective 8/09-10/09 Mentor: Pamela S. Becker, M.D., Ph.D. Associate Professor of Medicine/Hematology

More information

Stem Cells and Inner Ear Cell Regeneration. Stefan Heller Stanford University School of Medicine

Stem Cells and Inner Ear Cell Regeneration. Stefan Heller Stanford University School of Medicine Stem Cells and Inner Ear Cell Regeneration Stefan Heller Stanford University School of Medicine Embryonic stem cells Induced pluripotent stem cells Somatic stem cells 50 µm Derived from the inner cell

More information

1. What is the critical value for this 95% confidence interval? CV = z.025 = invnorm(0.025) = 1.96

1. What is the critical value for this 95% confidence interval? CV = z.025 = invnorm(0.025) = 1.96 1 Final Review 2 Review 2.1 CI 1-propZint Scenario 1 A TV manufacturer claims in its warranty brochure that in the past not more than 10 percent of its TV sets needed any repair during the first two years

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Hematopoietic Stem-Cell Transplantation for CLL and SLL File Name: Origination: Last CAP Review: Next CAP Review: Last Review: hematopoietic_stem-cell_transplantation_for_cll_and_sll

More information

Role Of Mitochondria In Mesenchymal Stem Cells

Role Of Mitochondria In Mesenchymal Stem Cells Role Of Mitochondria In Mesenchymal Stem Cells Roman Eliseev, MD, PhD, Tamara Raymond, Regis O'Keefe, MD, PhD. University of Rochester, Rochester, NY, USA. Disclosures: R. Eliseev: None. T. Raymond: None.

More information

Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average

Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average total numbers of cells per field of view were similar

More information

The immune system. Bone marrow. Thymus. Spleen. Bone marrow. NK cell. B-cell. T-cell. Basophil Neutrophil. Eosinophil. Myeloid progenitor

The immune system. Bone marrow. Thymus. Spleen. Bone marrow. NK cell. B-cell. T-cell. Basophil Neutrophil. Eosinophil. Myeloid progenitor The immune system Basophil Neutrophil Bone marrow Eosinophil Myeloid progenitor Dendritic cell Pluripotent Stem cell Lymphoid progenitor Platelets Bone marrow Thymus NK cell T-cell B-cell Spleen Cancer

More information

10 th Annual International Cord Blood Transplantation Symposium June 7-9, 2012 Preliminary Scientific Program. Thursday, June 7

10 th Annual International Cord Blood Transplantation Symposium June 7-9, 2012 Preliminary Scientific Program. Thursday, June 7 10 th Annual International Cord Blood Transplantation Symposium June 7-9, 2012 Preliminary Scientific Program Thursday, June 7 7:00 8:00 AM Breakfast in Exhibit Hall Session IA 8:00 10:00 AM Advances in

More information

Identification and characterization of leukemia stem cells in murine MLL-AF9 acute myeloid leukemia

Identification and characterization of leukemia stem cells in murine MLL-AF9 acute myeloid leukemia Identification and characterization of leukemia stem cells in murine MLL-AF9 acute myeloid leukemia Tim C.P. Somervaille 1 and Michael L. Cleary 1, * 1 Department of Pathology, Stanford University School

More information

Stem Cell Transplantation

Stem Cell Transplantation Harmony Behavioral Health, Inc. Harmony Behavioral Health of Florida, Inc. Harmony Health Plan of Illinois, Inc. HealthEase of Florida, Inc. Ohana Health Plan, a plan offered by WellCare Health Insurance

More information

Pulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic

Pulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic Pulling the Plug on Cancer Cell Communication Stephen M. Ansell, MD, PhD Mayo Clinic Why do Waldenstrom s cells need to communicate? Waldenstrom s cells need activating signals to stay alive. WM cells

More information

Automated Cord Blood Processing:

Automated Cord Blood Processing: TM Automated Cord Blood Processing: A Follow-up to the Pilar Solves Study Comparing the AXP vs the Sepax Cord Blood Processing Systems CHRISTY KIM, PETRA CRAVENS, MINDY WILKE-DOUGLAS AND MITCHEL SIVILOTTI

More information

Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood

Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood Application Note Primary Cell Analysis Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood Cell Viability Introduction: Bone Marrow, Cord Blood, Stem

More information

Minimal residual disease detection in Acute Myeloid Leukaemia on a Becton Dickinson flow cytometer

Minimal residual disease detection in Acute Myeloid Leukaemia on a Becton Dickinson flow cytometer Minimal residual disease detection in Acute Myeloid Leukaemia on a Becton Dickinson flow cytometer Purpose This procedure gives instruction on minimal residual disease (MRD) detection in patients with

More information

Recommendations to Transplant Centres Performing Cord Blood Transplants. Why Choosing the Right Thaw Method Could Save a Patient s Life

Recommendations to Transplant Centres Performing Cord Blood Transplants. Why Choosing the Right Thaw Method Could Save a Patient s Life Recommendations to Transplant Centres Performing Cord Blood Transplants Vicki Antonenas Why Choosing the Right Thaw Method Could Save a Patient s Life Lynn O Donnell (USA) 1 The process of receiving, testing

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

JUMISC JUMISC. For further information visit our website:

JUMISC JUMISC. For further information visit our website: STEM CELL THERAPY COMPANY PROFILE & SCIENTIFIC ACTIVITIES For further information visit our website: WWW.CCMIJESUSUSON.COM 20 14 JUMISC JUMISC Carretera N-521, km. 41,8 10071 CÁCERES (SPAIN) Tel. (+34)

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

2. BONE MARROW (HEMATOPOIETIC) STEM CELLS

2. BONE MARROW (HEMATOPOIETIC) STEM CELLS 2. BONE MARROW (HEMATOPOIETIC) STEM CELLS by Jos Domen*, Amy Wagers** and Irving L. Weissman*** CONTENTS INTRODUCTION.......................................................................................

More information

The Bone Marrow in Type 1 Diabetes

The Bone Marrow in Type 1 Diabetes The Bone Marrow in Type 1 Diabetes Feasibility of Flow Cytometric Analysis of npod Bone Marrow specimens Paolo Madeddu, MD FAHA University of Bristol UK Miami January, 17 2012 2 BACKGROUND Cardiovascular

More information

Analyzing Samples for CD34 Enumeration Using the BD Stem Cell Enumeration Kit

Analyzing Samples for CD34 Enumeration Using the BD Stem Cell Enumeration Kit 2 Analyzing Samples for CD34 Enumeration Using the BD Stem Cell Enumeration Kit Presented by Ellen Meinelt, MS MLS(ASCP) CM, Technical Applications Specialist and Calin Yuan, Product Course Developer,

More information

& 2005 Nature Publishing Group All rights reserved 0268-3369/05 $30.00. www.nature.com/bmt

& 2005 Nature Publishing Group All rights reserved 0268-3369/05 $30.00. www.nature.com/bmt (25) 35, 37 42 & 25 Nature Publishing Group All rights reserved 268-3369/5 $3. www.nature.com/bmt Stem cell factor improves SCID-repopulating activity of human umbilical cord blood-derived hematopoietic

More information

No-wash, no-lyse detection of leukocytes in human whole blood on the Attune NxT Flow Cytometer

No-wash, no-lyse detection of leukocytes in human whole blood on the Attune NxT Flow Cytometer APPLICATION NOTE Attune NxT Flow Cytometer No-wash, no-lyse detection of leukocytes in human whole blood on the Attune NxT Flow Cytometer Introduction Standard methods for isolating and detecting leukocytes

More information

Peripheral Blood Stem Cell (PBSC) Collections: Why, What, When. Objectives. Sources of Stem Cells

Peripheral Blood Stem Cell (PBSC) Collections: Why, What, When. Objectives. Sources of Stem Cells Peripheral Blood Stem Cell (PBSC) Collections: Why, What, When Objectives Why do need stem cell transplants What type of cells are we using for stem cell transplants When and how we collect peripheral

More information

The Effect of Myeloma Cells on Bone Metabolism is Heterogenous and Correlates with Underlying Genetic Lesions and Bone Disease In Vivo

The Effect of Myeloma Cells on Bone Metabolism is Heterogenous and Correlates with Underlying Genetic Lesions and Bone Disease In Vivo The Effect of Myeloma Cells on Bone Metabolism is Heterogenous and Correlates with Underlying Genetic Lesions and Bone Disease In Vivo Deepika Kassen 1, Neil Rabin 1, Darren Lath 2, Peter Croucher 2 and

More information

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development Overview B cell development Transcriptional cascades Amazing aspects of lineage plasticity Conventional (B2) B cell development What happens to an autoreactive B cell? B1 vs B2 cells Key anatomical sites

More information

Xiubo Fan 1,FlorencePHGay 2,FrancescaWILim 3,JustinaMLAng 2,PatPYChu 3,SudiptoBari 3 and William YK Hwang 2,3*

Xiubo Fan 1,FlorencePHGay 2,FrancescaWILim 3,JustinaMLAng 2,PatPYChu 3,SudiptoBari 3 and William YK Hwang 2,3* Fan et al. Stem Cell Research & Therapy 2014, 5:71 RESEARCH Open Access Low-dose insulin-like growth factor binding proteins 1 and 2 and angiopoietin-like protein 3 coordinately stimulate ex vivo expansion

More information

Animal Cell Culture. Third Edition. A Practical Approach OXJORD VNIVVRSITY 1'RVSS

Animal Cell Culture. Third Edition. A Practical Approach OXJORD VNIVVRSITY 1'RVSS Animal Cell Culture Third Edition A Practical Approach Edited by John R. W. Masters 3rd Floor Research Laboratories, University College London OXJORD VNIVVRSITY 1'RVSS Contents List of protocols page xiii

More information

Stem cells and cellular therapies: from research to clinic. ns,, PhD Faculty of Biology University of Latvia

Stem cells and cellular therapies: from research to clinic. ns,, PhD Faculty of Biology University of Latvia Stem cells and cellular therapies: from research to clinic Janis Ancans ns,, PhD Faculty of Biology University of Latvia Our cells Human body originates from one stem cell Conventional drugs Long history

More information

Corporate Medical Policy Cord Blood as a Source of Stem Cells

Corporate Medical Policy Cord Blood as a Source of Stem Cells Corporate Medical Policy Cord Blood as a Source of Stem Cells File Name: Origination: Last CAP Review: Next CAP Review: Last Review cord_blood_as_a_source_of_stem_cells 2/2001 3/2015 3/2016 3/2015 Description

More information

On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma

On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma Uber die Entstehung von multinuklearen Reed-Sternberg Riesenzellen und die Rolle von CD4 T-Zellen

More information

Regulation of the HIF-1a Level Is Essential for Hematopoietic Stem Cells

Regulation of the HIF-1a Level Is Essential for Hematopoietic Stem Cells Article Regulation of the HIF-1a Level Is Essential for Hematopoietic Stem Cells Keiyo Takubo, 1, * Nobuhito Goda, 3,6 Wakako Yamada, 1 Hirono Iriuchishima, 1 Eiji Ikeda, 4 Yoshiaki Kubota, 1 Haruko Shima,

More information

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule AAGPs TM Anti-Aging Glyco Peptides Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule 1 Acknowledgements This presentation was prepared by Dr. Samer Hussein

More information

Evaluation of focal adhesions as new therapeutic targets in acute myeloid leukemia

Evaluation of focal adhesions as new therapeutic targets in acute myeloid leukemia Evaluation of focal adhesions as new therapeutic targets in acute myeloid leukemia Dr Jordi Sierra Gil IRHSP Institut de Recerca Hospital de la Santa Creu i Sant Pau Dr. Miguel Ángel Sanz Alonso Fundación

More information

Descriptive statistics Statistical inference statistical inference, statistical induction and inferential statistics

Descriptive statistics Statistical inference statistical inference, statistical induction and inferential statistics Descriptive statistics is the discipline of quantitatively describing the main features of a collection of data. Descriptive statistics are distinguished from inferential statistics (or inductive statistics),

More information

Corporate Medical Policy Cord Blood as a Source of Stem Cells

Corporate Medical Policy Cord Blood as a Source of Stem Cells Corporate Medical Policy Cord Blood as a Source of Stem Cells File Name: Origination: Last CAP Review: Next CAP Review: Last Review cord_blood_as_a_source_of_stem_cells 2/2001 3/2015 3/2016 3/2015 Description

More information

ENRICO M. NOVELLI, 1 LINZHAO CHENG, 1 YANDAN YANG, 1 WING LEUNG, 1 MANUEL RAMÍREZ, 1 VIVEK TANAVDE, 1 CHERYL ENGER, 1 and CURT I. CIVIN 1,2 ABSTRACT

ENRICO M. NOVELLI, 1 LINZHAO CHENG, 1 YANDAN YANG, 1 WING LEUNG, 1 MANUEL RAMÍREZ, 1 VIVEK TANAVDE, 1 CHERYL ENGER, 1 and CURT I. CIVIN 1,2 ABSTRACT HUMAN GENE THERAPY :2927 294 (December, 999) Mary Ann Liebert, Inc. Ex Vivo Culture of Cord Blood CD34 Cells Expands Progenitor Cell Numbers, Preserves Engraftment Capacity in Nonobese Diabetic/Severe

More information

Review. Cord blood as an alternative source of haemopoietic stem cells. J. Hows, A. Nicol, P. Denning-Kendall, C. Donaldson, M. Nieda & B.

Review. Cord blood as an alternative source of haemopoietic stem cells. J. Hows, A. Nicol, P. Denning-Kendall, C. Donaldson, M. Nieda & B. Annals of Oncology 7 (Suppi 2): 47-51, 1996. O 1996 Kluwer Academic Publishers. Printed in the Netherlands. Review Cord blood as an alternative source of haemopoietic stem cells J. Hows, A. Nicol, P. Denning-Kendall,

More information

Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma

Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma David E. Szymkowski Senior Director, Biotherapeutics Proteins by Design 1960s...1980s...2000s... Where are the bispecific antibody drugs? J Exp.

More information

14.0 Stem Cell Laboratory Services

14.0 Stem Cell Laboratory Services Laboratory Services Contact Information: To inquire about assisting with surgical harvesting of bone marrow, cellular therapy (CT) product processing, cryopreservation, storage, or any other lab services,

More information

Stem Cells in Umbilical Cord Blood: A Review

Stem Cells in Umbilical Cord Blood: A Review Stem Cells in Umbilical Cord Blood: A Review December 13, 2006 Cellular and Molecular Biotechnology of Mammalian Systems Undergraduate Students: Andrew Fu Allen Fung Graduate Student: Aizhan Tastanova

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Expression of Integrin a2 Receptor in Human Cord Blood CD341CD382CD901 Stem Cells Engrafting Long-Term in NOD/SCID-IL2Rc c null Mice WAN MAN WONG, a MIKAEL SIGVARDSSON, b INGBRITT

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

The Therapeutic Potential of Human Umbilical Cord Blood Transplantation for Neonatal Hypoxic-Ischemic Brain Injury and Ischemic Stroke

The Therapeutic Potential of Human Umbilical Cord Blood Transplantation for Neonatal Hypoxic-Ischemic Brain Injury and Ischemic Stroke The Therapeutic Potential of Human Umbilical Cord Blood Transplantation for Neonatal Hypoxic-Ischemic Brain Injury and Ischemic Stroke a,b* b,c a a b b b b a b a b c 430 Wang et al. Acta Med. Okayama Vol.

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

Deep profiling of multitube flow cytometry data Supplemental information

Deep profiling of multitube flow cytometry data Supplemental information Deep profiling of multitube flow cytometry data Supplemental information Kieran O Neill et al December 19, 2014 1 Table S1: Markers in simulated multitube data. The data was split into three tubes, each

More information

Human Umbilical Cord Blood CD34 + Progenitor Cell Care Manual

Human Umbilical Cord Blood CD34 + Progenitor Cell Care Manual Human Umbilical Cord Blood CD34 + Progenitor Cell Care Manual INSTRUCTION MANUAL ZBM0065.03 SHIPPING CONDITIONS Human Umbilical Cord Blood CD34+ Progenitor Cells, cryopreserved Cryopreserved human umbilical

More information

Flow cytometric analysis of stem cells derived from umbilical cord blood CD34+/CD45+ enumeration and viability

Flow cytometric analysis of stem cells derived from umbilical cord blood CD34+/CD45+ enumeration and viability Flow cytometric analysis of stem cells derived from umbilical cord blood CD34+/CD45+ enumeration and viability Doretha Thompson Dissertation in fulfillment of the requirements for the degree Magister Scientiae

More information

1 Materials and methods. 1.1 Materials

1 Materials and methods. 1.1 Materials Vol. 44 No. 5 SCIENCE IN CHINA (Series C) October 2001 Expansion of CD34 + cells from human umbilical cord blood by FL and/or TPO gene transfected human marrow stromal cell lines ZHANG Yi (Æ Ê), TANG Peixian

More information

The Journal of Experimental Medicine

The Journal of Experimental Medicine Supplemental Material Haines et al., http://www.jem.org/cgi/content/full/jem.20080996/dc1 The Journal of Experimental Medicine Subcloning of murine PTK7 cdna segments into pegfp-n3 and CHO cell transfection.

More information

CD34+ CD45- Cells Isolated from Human Blood Have Molecular and Functional Characteristics of Vascular Endothelial Progenitors

CD34+ CD45- Cells Isolated from Human Blood Have Molecular and Functional Characteristics of Vascular Endothelial Progenitors CD34+ CD45- Cells Isolated from Human Blood Have Molecular and Functional Characteristics of Vascular Endothelial Progenitors Yajuan Jiang 1, Alexander M. Tsankov 2, Alexander Meissner 2 and David W. O

More information

The Cord Blood Industry and Be The Match

The Cord Blood Industry and Be The Match The Cord Blood Industry and Be The Match Arthur Busse Manager of Business Analytics NMDP: Be The Match Sept. 11, 2015 Be The Match Mission Saving Lives with cellular therapy through science, service and

More information

Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-806)

Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-806) Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-86) The Hoechst purification was established for murine hematopoietic stem cells (HSC)

More information

Summary of Act for Appropriate Provision of Hematopoietic Stem Cells to be Used in Transplantations

Summary of Act for Appropriate Provision of Hematopoietic Stem Cells to be Used in Transplantations Summary of Act for Appropriate Provision of Hematopoietic Stem Cells to be Used in Transplantations Basic principles are established and the responsibilities of the national government are clarified in

More information

GRANIX (tbo-filgrastim)

GRANIX (tbo-filgrastim) RATIONALE FOR INCLUSION IN PA PROGRAM Background Neutropenia is a hematological disorder characterized by an abnormally low number of neutrophils. A person with severe neutropenia has an absolute neutrophil

More information

Detecting primitive hematopoietic stem cells in total nucleated and mononuclear cell fractions from umbilical cord blood segments and units

Detecting primitive hematopoietic stem cells in total nucleated and mononuclear cell fractions from umbilical cord blood segments and units Patterson et al. Journal of Translational Medicine (2015) 13:94 DOI 10.1186/s12967-015-0434-z RESEARCH Open Access Detecting primitive hematopoietic stem cells in total nucleated and mononuclear cell fractions

More information

BIOMEDICAL SCIENCES GRADUATE PROGRAM FALL 2012

BIOMEDICAL SCIENCES GRADUATE PROGRAM FALL 2012 THE OHIO STATE UNIVERSITY BIOMEDICAL SCIENCES GRADUATE PROGRAM FALL 2012 Reeva Aggarwal PhD Candidate MECHANISMS OF HUMAN CD34+ STEM CELL-MEDIATED REGULATION OF OSTEOPOROSIS IN A PRECLINICAL MODEL November

More information

Molecular Assessment of Dried Blood Spot Quality during Development of a Novel Automated. Screening

Molecular Assessment of Dried Blood Spot Quality during Development of a Novel Automated. Screening Molecular Assessment of Dried Blood Spot Quality during Development of a Novel Automated in situ TREC qpcr Assay for SCID Screening J Bai, T Henry, J Benfer, S Berberich, T Kreman, and L DesJardin State

More information

Supplemental Material. Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks

Supplemental Material. Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks Supplemental Material Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks Xin-Min Li, PhD 1, W. H. Wilson Tang, MD 1,2, Marian K. Mosior, PhD 3, Ying Huang,

More information

SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and

SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Supplemental Material: Western blot: SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Analysis (NIH). Quantitative

More information

Hematopoietic Stem Cell Biology

Hematopoietic Stem Cell Biology Hematopoietic Stem Cell Biology Stem Cell Biology and Regenerative Medicine Series Editor Kursad Turksen, Ph.D. kturksen@ohri.ca For other titles published in this series, go to http://www.springer.com/series/7896

More information

Drug Development Services

Drug Development Services Drug Development Services USING BLOOD AND BONE MARROW PRIMARY CELL SYSTEMS Clinically Relevant In Vitro Assays Broad Spectrum of Drug Classes Multi-Species Platforms Enhancing Drug Development through

More information

Umbilical Cord Blood Transplantation

Umbilical Cord Blood Transplantation Umbilical Cord Blood Transplantation V Rocha MD, PhD Hopital Saint Louis, Paris University 7 CIBMTR Milwaukee Umbilical Cord blood transplantation Background History Clinical results in children and adults

More information

BioArchive Freezing Curve for Cord Blood

BioArchive Freezing Curve for Cord Blood BioArchive Freezing Curve for Cord Blood Determination of the Specific Freezing in the BioArchive System to Provide the Highest Viability of Cord Blood MNC as Measured by -C Assays Introduction Freezing

More information

Equine Stem Cells. Sources, Processing, Expansion, Storage and Shipping

Equine Stem Cells. Sources, Processing, Expansion, Storage and Shipping Equine Stem Cells Sources, Processing, Expansion, Storage and Shipping Sean Owens, DVM, Diplomate ACVP Medical Director, UC Davis Veterinary Regenerative Medicine Laboratory What is a Stem Cell and What

More information

How To Run Statistical Tests in Excel

How To Run Statistical Tests in Excel How To Run Statistical Tests in Excel Microsoft Excel is your best tool for storing and manipulating data, calculating basic descriptive statistics such as means and standard deviations, and conducting

More information

Potency Assays for an Autologous Active Immunotherapy (Sipuleucel-T) Pocheng Liu, Ph.D. Senior Scientist of Product Development Dendreon Corporation

Potency Assays for an Autologous Active Immunotherapy (Sipuleucel-T) Pocheng Liu, Ph.D. Senior Scientist of Product Development Dendreon Corporation Potency Assays for an Autologous Active Immunotherapy (Sipuleucel-T) Pocheng Liu, Ph.D. Senior Scientist of Product Development Dendreon Corporation Sipuleucel-T Manufacturing Process Day 1 Leukapheresis

More information

Challenges of Hematopoietic Stem Cell Transplantation. Robert J. Soiffer, MD Dana Farber Cancer Institute

Challenges of Hematopoietic Stem Cell Transplantation. Robert J. Soiffer, MD Dana Farber Cancer Institute Challenges of Hematopoietic Stem Cell Transplantation Robert J. Soiffer, MD Dana Farber Cancer Institute Hematopoietic Stem Cell Transplantation Objectives Deliver sufficient chemo-radio therapy to destroy

More information

Diagrams and Graphs of Statistical Data

Diagrams and Graphs of Statistical Data Diagrams and Graphs of Statistical Data One of the most effective and interesting alternative way in which a statistical data may be presented is through diagrams and graphs. There are several ways in

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information