La genomica: una tecnica d avanguardia in aiuto alla viticoltura

Size: px
Start display at page:

Download "La genomica: una tecnica d avanguardia in aiuto alla viticoltura"

Transcription

1 La genomica: una tecnica d avanguardia in aiuto alla viticoltura Mario Pezzotti Alba, 20 Novembre 2012 Progetto Nebbiolo Genomics Fondazione Cassa di Risparmio di Cuneo 1

2 COME RISOLVERE I PROBLEMI NELLE PIANTE COLTIVATE? In tutte le piante coltivate: Pratiche agronomiche Chimica Genetica e Miglioramento Genetico Nella vite Pratiche agronomiche Chimica 2

3 MIGLIORAMENTO GENETICO DELLA VITE Varietà sono generalemte vecchie anni Limitata attività di miglioramento genetico Variabilità genetica utilizzata all interno di ogni varietà basata solo sulla selezione clonale 3

4 GENOMA L insieme del MATERIALE GENETICO DNA -di una cellula o di un organismo Rappresenta la potenzialità di un organismo 4

5 CTTCCTGGGC AAGTTTCAGA AACTCACTGA CAGAGCTAGC AGCTCCCATA 61 TAAATAAATA ACCAATACAA ATCTTTTCAG AGACAAATGC ATTCTCTGAC ATCTGAGGTT 121 ACAGCAAATC TCTTCTTCAC CTGTTTGCTT GTTTAGAGTT GTAATATTTG CTTTGGTGTA 181 GAGCTGAAGA CATAAATTGG LA TAACCAATGG GENOMICA AATTATCTGG CCTCAGACTT TATTTATTTT 241 CATCATTTAT TTCACTGATG TGCAAATTTA TTCCGTACCA GCAAATGTCA Genoma ATTTAATTAT 301 ATTCTACAGT ACACAGTGAA TCATGTATAC TTAGTCAAGT TGTAAATACA CTAAACCATA 361 TAAACTCACA ACAGTATATC AGCTCATGAT GGGTAAATGA CTTTTCCCTG AGAAAGAGTA 421 TCTGTTTAAC CTGCATGATC TCACTCTTTA GTATTTGCTT CTTTAGTCGA CGTTTGTTTC 481 CTAGTTTTGA ATATAATCAT GATATGGAGA GACAAGTGAA ATCACCACAA TTTTGTTTTC 541 CAAAATGGGA GACTATGCAA ATGCTGAAAT GAGAATTAAT ACATCCAAAA TATCGAACCA 601 CAATTATGGC TTTGCTTTAC TTTTTGCCCG TAAGAGACAT GTGGCCTAGA ATAGGTGGCA 661 GGTATTCCTA CCACAACCTT GCTTAGCATA GTGGTTGACT AAATATAAAT TTTAGAGATG 721 AAGGTTGTTC TATACCCAGA TTTCAACGTG ATTGCTATGC CCACTTCACT TTCTTTAAAA 781 TACATATTTT TCTTACTTCT CACTTTCTTT TTCTTCTTGG TTGACATTTT Cromosoma TTGGCTCAGG 841 GATTTTTTTT TTCCTTATGA TCTCAAGAAA TTTTTCTCAT TGAAAAAGAC ATAATCGTGC 901 TGGGAGTGGT GGCTCATGCT TGTAATCCCA GCACTTTGGG AGGCTGAGGC TGGTGGATCA 961 CCTGAGGTCA GCAGTTACAG ATGAGCCCGG CCAAAATGGT GAAACCTCAT CTCTACTAAA 021 AATACAAAAA TTTGCCAGGT GTGGTGGCAG GCACTTGTAA TCCCAGCCAC TCGGGAGGCT 081 GAGGCAGGAG AATCGCTTGA ACCCAGGAGG CAGAGGTTGC AGTGAGCCAA GATCATTCCA 141 TTGGACTCTA GCAGGGTGAC AAGAGCAAAA CTCCATCTCA GGAAAAAAAA AATCATAAAT 201 TTTCCCATAT GAAAAAAATA ACACAAGATC CGGAATACAG AGAGGAGCAT Gene AATCCTTTGC 261 AGGTCATAGA TGTAATCTTT CTTCCAGGAA AAATTTATTT CAGATAAGAC CAGAATTGGA 321 AACATATTCC ATGCCGTCAG ATAGCACTGG CTTAGGAGAC GAATGAGGAG GAGCCTGCAG 381 GCTACCTCAA GGATAAGAAG CAGGCAAAAG GCAAGCACAG GGGCGGCATG CACTC

6 The French-Italian Public Consortium for the Sequencing of the Grapevine Nuclear Genome VIGNE

7 Quale genotipo sequenziare? PN40024 clone omozigote (~ 93%) ottenuto da incorcio Pinot Noir X Helfesteiner dopo sei generazioni di autofecondazione (Colmar, Fr) Varietà coltivate PN

8 Il Genoma di PN

9 Cosa c è scritto nel genoma (annotazione) geni I geni occupano 7% del genoma Identificati i tratti ripetuti Elementi trasponibili occupano 40% genoma 9

10 Sequence anchor to chromosomes 90% of the sequence can be positioned onto 19 chromosomes 10

11 Grape Genome Sequence Annotation Computational process Gene identification genes predicted Genes are 7% of the genome Repeated sequence identification Transposable elements occupy 40% of the genome 11

12 Functional Genomic Center Granted by Fondazione Cariverona Whole grape transcriptome microarrays based on Combimatrix Verona, 9 Febbraio 2007 and NimbleGen technologies and high-throughput sequencing for DNA and RNA seq 12

13 Phenotypic diversity within V. vinifera 13 Camera di commercio di Bolzano

14 Phenotypic diversity within V. vinifera Cluster density Cluster size Berry size Berry shape 14

15 Re-Sequencing Grapevine genome= 19 chromosomes = 487 Mbp 5-6 Gb per run/4 days Genome fragmented high-throughput sequencing (Illumina Genome Analyzer II) Clustering and alignment AGCTGCTAGCTAGCTTGAGATCGATCGTTCGATCGATCGCATTTATTCGGATGATGCATCGTACTATCGAT AGCTGCTAGCTAGCTTGAGATCGATCGTTCGATCGATCGCATTTATTCGGATGATGCATCGTACTATCGAT AGCTGCTAGCTAGCTTGAGATCGATCGTTCGATCGATCGCATTTATTCGGATGATGCATCGTACTATCGAT AGCTGCTAGCTAGCTTGAGATCGATCGTTCGATCGATCGCATTTATTCGGATGATGCATCGTACTATCGAT AGCTGCTAGCTAGCTTGAGATCGATCGTTCGATCGATCGCATTTATTCGGATGATGCATCGTACTATCGAT AGCTGCTAGCTAGCTTGAGATCGATCGTTCGATCGATCGCATTTATTCGGATGATGCATCGTACTATCGAT 15

16 Nucleotide Variation Variation in DNA sequence due to the precence of two different nucleotides in the two different genomes: Single Nucletoide Polymorphism CHR-A CHR-B CHR-C caaattatta ATAATTTGGT TCCAtAATTG CGTTGCACTT CGTTATAGCG aaatttatta ATAATTTGGT TCCAtAATTG CGTTGCACTT CGTTATAGCG aaatttatta ATAATTTGGT TCCAgAATTG CGTTGCACTT CGTTATAGCG Between Tocai and PN40024: 1 difference every 114 bases More than 900,000 differences (SNP) identified 16

17 VARIAZIONE STRUTTURALE (SV) Presenza di frammenti di DNA (>1000 basi) in un genoma che sono assenti in un altro PN40024 reference Tocai Almeno 3600 varianti strutturali fra Tocai e PN

18 VARIAZIONE STRUTTURALE E VARIAZIONE FENOTIPICA IN VITE VvmybA1 Mutazione rara ed antica Mutazione/ reversione frequente Gret1 VvmybA1a VvmybA1b Gret1 solo LTR 18

19 Two grape varieties differ in the genome structure as much as a human and a chimpanzee 19

20 CROMOSOMA ESPRESSIONE GENICA mrna DNA CARATTERISTICHE DELLA BACCA FUNZIONI STRUTTURALI ATTIVITA ENZIMATICHE PROTEINA

21 1 GAATTCACGC TTTAAGGCTA TGGCCACCTT TAAATAAAGT ACAGCATTAC TAAAAAAAAA 61 TAAATAAATA GENI COMUNI ACCAATACAA E SPECIFICI ATCTTTTCAG PER AGACAAATGC DIFFERENTI ATTCTCTGAC ORGANI ATCTGAGGTT 121 ACAGCAAATC TCTTCTTCAC CTGTTTGCTT GTTTAGAGTT GTAATATTTG CTTTGGTGTA 181 GAGCTGAAGA CATAAATTGG AATTATCTGG GENOMA CCT T TATTTATTTT 241 CATCATTTAT TTCACTGATG TGCAAATTTA DNA TTCCGTACCA GCAAATGTCA ATTTAATTAT 301 ATTCTACAGT ACACAGTGAA TCATGTATAC TTAGTCAAGT TGTAAATACA CTAAACCATA 361 TAAACTCACA ACAGTATATC AGCTCATGAT GGGTAAATGA CTTTTCCCTG AGAAAGAGTA 421 TCTGTTTAAC CTGCATGATC TCACTCTTTA GTATTTGCTT CTTTAGTCGA CGTTTGTTTC 481 CTAGTTTTGA ATATAATCAT GATATGGAGA GACAAGTGAA ATCACCACAA TTTTGTTTTC Gene CAAAATGGGA GACTATGCAA ATGCTGAAAT GAGAATTAAT ACATCCAAAA TATCGAACCA Gene CAATTATGGC Gene 5 TTTGCTTTAC TTTTTGCCCG TAAGAGACAT GTGGCCTAGA ATAGGTGGCA Gene 8 Gene GGTATTCCTA CCACAACCTT GCTTAGCATA GTGGTTGACT AAATATAAAT TTTAGAGATG Gene 3 Gene 7 Gene AAGGTTGTTC TATACCCAGA TTTCAACGTG ATTGCTATGC CCACTTCACT TTCTTTAAAA Gene 6 Gene TACATATTTT TCTTACTTCT CACTTTCTTT TTCTTCTTGG TTGACATTTT TTGGCTCAGG 841 GATTTTTTTT TTCCTTATGA TCTCAAGAAA TTTTTCTCAT TGAAAAAGAC ATAATCGTGC 901 TGGGAGTGGT GGCTCATGCT TGTAATCCCA GCACTTTGGG AGGCTGAGGC TGGTGGATCA 961 CCTGAGGTCA GCAGTTACAG ATGAGCCCGG CCAAAATGGT GAAACCTCAT CTCTACTAAA 021 AATACAAAAA TTTGCCAGGT GTGGTGGCAG GCACTTGTAA TCCCAGCCAC TCGGGAGGCT 081 GAGGCAGGAG AATCGCTTGA ACCCAGGAGG CAGAGGTTGC AGTGAGCCAA GATCATTCCA 141 TTGGACTCTA GCAGGGTGAC AAGAGCAAAA CTCCATCTCA GGAAAAAAAA AATCATAAAT 201 TTTCCCATAT GAAAAAAATA ACACAAGATC CGGAATACAG AGAGGAGCAT AATCCTTTGC 261 AGGTCATAGA TGTAATCTTT CTTCCAGGAA AAATTTATTT CAGATAAGAC CAGAATTGGA 321 AACATATTCC ATGCCGTCAG ATAGCACTGG CTTAGGAGAC GAATGAGGAG GAGCCTGCAG 381 GCTACCTCAA GGATAAGAAG CAGGCAAAAG GCAAGCACAG GGGCGGCATG CACTCACACT 441 GGGGCTGCTC CTTCCTGGGC AAGTTTCAGA AACTCACTGA CAGAGCTAGC AGCTCCCATA

22 Centro di Genomica Funzionale Con il supporto di Fondazione Cariverona Verona, 9 Febbraio

23 NimbleGen _Vitus_exp_HX12 Based on 29,971 annotations on grape 12x assembly (V1 prediction) Design parameters: Probe selection is based on a scoring algorithm developed by Nimblegen Oligo length: 60 nt Maximum distance from 3 -end: 1,500 bp Tm mean = 79 C; Tm St. Dev. = 3 C GC range = 47 %; GC St. Dev. = 7 % Number of probes per transcript: 4 Number of replicates per probe: 1 Probe uniqueness was also checked against the grape genome

24 L Atlante di espressione della cv. Corvina

25 CONGELAMENTO DEI CAMPIONI IN AZOTO LIQUIDO E CONSERVAZIONE A -80 C

26 ESTRAZIONE DELL RNA: POLVERIZZAZIONE DEI CAMPIONI

27 ESTRAZIONE DELL RNA: ISOLAMENTO E PURIFICAZIONE

28 CONTROLLO DELL INTEGRITA DELL RNA MARCATURA e IBRIDAZIONE

29 RIVELAZIONE DEL SEGNALE DI FLUORESCENZA

30 Dipartimeno di Biotecnologie ANALISI DELL ESPRESSIONE GENICA Singolo array Gene attivo Chip Il segnale di fluorescenza indica che il gene è espresso, cioè che il corrispondente mrna è presente nel campione; maggiore è l intensità del segnale e maggiore è il livello di espressione genica.

31 Inflorescence - Y Inflorescence - WD Flower - FB Flower - F Stamen Pollen Petal Carpel Berry Pericarp - FS Berry Pericarp - PFS Berry Pericarp - V Berry Pericarp - MR Berry Pericarp - R erry Pericarp - PHWI erry Pericarp - PHWII rry Pericarp - PHWIII Berry Flesh - PFS Berry Flesh - V Berry Flesh - MR Berry Flesh - R Berry Flesh - PHWI Berry Flesh - PHWII Berry Flesh - PHWIII Berry Skin - PFS Berry Skin - V Berry Skin - MR Berry Skin - R Berry Skin - PHWI Berry Skin - PHWII Berry Skin - PHWIII Seed - FS Seed - PFS Seed - V Seed - MR Tendril - Y Tendril - WD Tendril - FS Rachis - FS Rachis - PFS Rachis - V Rachis - MR Rachis - R Leaf - Y Leaf - FS Leaf - S Stem - G Stem - W Bud - L Bud - W Bud - S Bud - B Bud - AB Seedling Root Common Total Global patterns of tissue gene expression Number of genes expressed in each of the 54 tissues 0 4,000 8,000 12,000 16,000 20,000 24,000 28,000 Number of expressed genes

32 Number of specifically expressed genes Global patterns of tissue gene expression Tissue specific genes among genes stamen, petal and pollen specific: MYB33-like transcription factor (JGVV59.65), involved in the onset of flowering (Miller and Gluber, 2005) - among genes pollen and stamen specific: embryogenic pollen-abundant phosphoprotein NtEPc (JGVV0.545), which appeared in the cells undergoing a dedifferentiation process from immature pollen grains to embryogenic cells (Kyo et al., 2000) Flower Berry Seed Tendril Rachis Leaf Stem Bud Root Bud specific genes distribution showed shared transcripts in active growth stages, but not during dormancy (Bud - W), undergoing into a rest period during winter. Venn Diagrams of organ specific genes distribution among flower tissues and bud developmental stages. Shared expression profiles were more common among different organs than at different developmental stages in the same organ

33 Sliding-window analysis of co-expression along grapevine chromosomes Ripe/woody tissues- Green Vegetative

34 Sliding-window analysis of co-expression along grapevine chromosome 16 id position annotation JGVV Unknown protein JGVV Alpha-glucosidase RADIAL SWELLING 3 RSW3 JGVV CYP89A2 JGVV Glutathione S-transferase 25 GSTU7 JGVV unknown JGVV CYP89A2 JGVV phenylalanin ammonia-lyase [Vitis vinifera] JGVV phenylalanin ammonia-lyase [Vitis vinifera] JGVV phenylalanin ammonia-lyase [Vitis vinifera] JGVV phenylalanin ammonia-lyase [Vitis vinifera] id position annotation JGVV stilbene synthase [Vitis vinifera] JGVV Stilbene synthase 2 JGVV stilbene synthase [Vitis vinifera] JGVV stilbene synthase [Vitis vinifera] JGVV stilbene synthase 1 [Vitis vinifera] JGVV stilbene synthase [Vitis vinifera] JGVV stilbene synthase JGVV phospho 3-hexuloisomerase JGVV no hit JGVV Unknown protein JGVV no hit

35 Giorni dall inizio dell appassimento APPASSIMENTO CORVINA CABERNET SYRAH

36 ESPRESSIONE GENICA CROMOSOMA mrna DNA CARATTERISTICHE DELLA BACCA FUNZIONI STRUTTURALI PROTEINA ATTIVITA ENZIMATICHE METABOLITI

37 RACCOLTA DEI CAMPIONI Gli acini sono stati prelevati dal fruttaio durante l appassimento Gli acini prelevati sono stati immediatamente congelati in azoto liquido

38 LIVELLO DI ESPRESSIONE LIVELLO DI ESPRESSIONE QUANTO UN GENE SI ACCENDE GENE SE UN GENE SI ACCENDE O SPEGNE LIVELLO DI PROTEINA

39 GENI MODULATI DURANTE L APPASSIMENTO: CIRCA 3.000! CORVINA CABERNET SYRAH TOTALI COMUNI SPECIFICI

40

41 Understanding relationship between genotype and phenotype One Clone in Different Environments var. Corvina clone n 48 41

42 Micro-Environmental and Agricultural Features Altitude m. a.s.l. Vineyard Planting Layout Type of Soil Sandy-Cley Vineyard Age 6-18 years Vineyard Training System Replacement Cane Guyot Parral System Type of Rootstock K5BB/41B/SO4/420A Rows Facing Direction 42

43 Name _Vitus_ exp_hx 12 Format Number of Probes Probes per gene Targets 12x135k SAM: Significance Analysis of Microarrays Unsupervised Analysis: PCA Statistical Analyses Supervised Analysis: O2PLS 43

44 t[2] PCA of berry transcriptome at ripening Replacement Cane Guyot North/South 41B PM PM PSP PSP MN MN PSP PM MN VM VM BM BM BM VM Replacement Cane Guyot East/West K5BB CS AM FA CSFA FA AM AM CS Parral System East/West 420A GIV BA BA BA GIV Parral System SO4 CC CC CC Replacement Cane Guyot North/South K5BB t [ 1] SIMCA-P :52:21 (UTC+1) 5 Classes clustered by: Vineyard Training System Rows Facing Direction Rootstock Type 44

45 GRAZIE a Sara Zenoni Anita Zamboni Silvia Dal Santo Marianna Fasoli Alberto Ferrarini Erika Cavallini Flavia Guzzo Giovanni Battista Tornielli Massimo Delledonne Lorenzo Farina Ivana Gribaudo Giorgio Gambino CNR Torino

Terapia antivirale e farmacogenomica

Terapia antivirale e farmacogenomica 1-09:47 Terapia antivirale e farmacogenomica [emilio.dimaria@unige.it] Dipartimento di Scienze della Salute Università di Genova SSD Genetica Medica EO di Genova 2-09:47 Pharmacogenomics [ or Pharmacogenetics?]

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Lezione Xl-Xll giovedì 27-X-2011

Lezione Xl-Xll giovedì 27-X-2011 Lezione Xl-Xll giovedì 27-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

The New Luxury World: l identità digitale nel lusso fa la differenza

The New Luxury World: l identità digitale nel lusso fa la differenza The New Luxury World: l identità digitale nel lusso fa la differenza Massimo Fubini Founder & CEO di ContactLab 7 Luxury Summit, Il Sole 24ORE, 10 giugno 2015 It may not be modified, organized or reutilized

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

ITALIAN NATIONAL BLOOD CENTRE REGULATION OF CORD BLOOD BANKING: GLOBAL IMPLICATIONS

ITALIAN NATIONAL BLOOD CENTRE REGULATION OF CORD BLOOD BANKING: GLOBAL IMPLICATIONS ITALIAN NATIONAL BLOOD CENTRE REGULATION OF CORD BLOOD BANKING: GLOBAL IMPLICATIONS Paolo Rebulla European Directives National Laws In the case of blood and blood components & tissues and cells European

More information

Anita Zamboni. Curriculum vitae et studiorum. 1. Contact details. 2. Degrees. 3. Positions. Born on April, 10 th, 1977 Bussolengo (VR)

Anita Zamboni. Curriculum vitae et studiorum. 1. Contact details. 2. Degrees. 3. Positions. Born on April, 10 th, 1977 Bussolengo (VR) Anita Zamboni Curriculum vitae et studiorum Born on April, 10 th, 1977 Bussolengo (VR) 1. Contact details University of Verona Biotechnology Department Strada Le Grazie, 15, 37134 Verona, Italy Tel: +39

More information

ITIL v3 - Overview. Claudio Tancini Marzo 2015 INTERNAL USE ONLY

ITIL v3 - Overview. Claudio Tancini Marzo 2015 INTERNAL USE ONLY ITIL v3 - Overview Claudio Tancini Marzo 2015 ITIL Da Wikipedia, l'enciclopedia libera. Information Technology Infrastructure Library (ITIL) è un insieme di linee guida ispirate dalla pratica (Best Practices)

More information

Milano (Italia) Light Nova Lighting

Milano (Italia) Light Nova Lighting Milano (Italia) Light Nova Lighting Light Nova is one of Neri s most innovative products in terms of lighting performance and design. Designed by our team and tested in our labs, it combines a vintage

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento. Università degli Studi di Napoli Federico II BIOGEM.

Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento. Università degli Studi di Napoli Federico II BIOGEM. Società Botanica Italiana Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento Università degli Studi di Napoli Federico II BIOGEM Organize the Summer School Challenges, methods

More information

Dall Information Security alla Cyber Security, e ritorno

Dall Information Security alla Cyber Security, e ritorno Dall Information Security alla Cyber Security, e ritorno (Come migliorare la sicurezza dell azienda attraverso un efficace governo degli incidenti) Luca Bechelli (CLUSIT) Marco Di Leo (HP) Fabio Vernacotola

More information

Nuovi domini di primo livello - Registra nuove estensioni con FabsWeb_HOST

Nuovi domini di primo livello - Registra nuove estensioni con FabsWeb_HOST Oltre 700 nuove estensioni per domini personalizzati Il conto alla rovescia è terminato! Finalmente più di 700 nuove estensioni di dominio gtld stanno per arrivare sul mercato e sono destinate a rivoluzionare

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

How to renew S&S Video Italian version. 2009 IBM Corporation

How to renew S&S Video Italian version. 2009 IBM Corporation How to renew S&S Video Italian version A. Renewal Email Lasciate che vi illustri come rinnovare le vostre licenze software IBM con Passport Advantage Online. (Let me show you how to renew your IBM software

More information

The New Luxury World: l identità digitale nel lusso fa la differenza

The New Luxury World: l identità digitale nel lusso fa la differenza The New Luxury World: l identità digitale nel lusso fa la differenza Massimo Fubini Founder & CEO di ContactLab 7 Luxury Summit, Il Sole 24ORE, 10 giugno 2015 It may not be modified, organized or reutilized

More information

Phenology. Phenology and Growth of Grapevines. Vine Performance

Phenology. Phenology and Growth of Grapevines. Vine Performance Phenology and Growth of Grapevines Ker 2007 1 Soil Depth Texture Water and nutrient supply Climate Radiation Temperature Humidity Windspeed Rainfall Evaporation Cultural decisions Vine density Scion and

More information

Laboratorio di Bioinformatica

Laboratorio di Bioinformatica Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: marco.fondi@unifi.it www.unifi.it/dblemm/ tel. 0552288308 Dip.to di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,

More information

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013 Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA 2012-2013 martedì 30 ottobre 2012 1 Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012 martedì

More information

0wn1ng the Enterprise 2.0

0wn1ng the Enterprise 2.0 0wn1ng the Enterprise 2.0 relatore: Igor Falcomatà nuove tipologie di attacco alle reti aziendali nell'epoca dei social network e del web 2.0 Broadband Business Forum 25 nov 09 - Roma free advertising

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

PAESE/COUNTRY: Certificato veterinario per l'ue/veterinary certificate to EU

PAESE/COUNTRY: Certificato veterinario per l'ue/veterinary certificate to EU PAESE/COUNTRY: Certificato veterinario per l'ue/veterinary certificate to EU Parte I: relative alla partita/part I: Details of dispatched consignment I.1. I.5. Speditore/Consigner Nome/Name Indirizzo/Address

More information

C.S.E. Nodi Tipici Parametrizzati al 15-4-2015. 14/04/2015 Copyright (c) 2015 - Castalia srl

C.S.E. Nodi Tipici Parametrizzati al 15-4-2015. 14/04/2015 Copyright (c) 2015 - Castalia srl C.S.E. Nodi Tipici Parametrizzati al 15-4-2015 14/04/2015 Copyright (c) 2015 - Castalia srl 1 Avvertenze (1) Ci sono tre sezioni in questo documento: 1. Nodi in tutte le versioni (background azzurro):

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

Chi sono in quattro punti.

Chi sono in quattro punti. vsphere 5 Licensing Chi sono in quattro punti. Massimiliano Moschini Presales/Postsales and Trainer VMUG IT Board Member VCP, VSP VTSP,VCI, V http://it.linkedin.com/in/massimilianomoschini @maxmoschini

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Un nuovo modello di efficienza all interno del Data Center Fabio Di Dionisio HP Storage Division

Un nuovo modello di efficienza all interno del Data Center Fabio Di Dionisio HP Storage Division HP Converged Storage: Un nuovo modello di efficienza all interno del Data Center Fabio Di Dionisio HP Storage Division Copyright 2014 Hewlett-Packard Development Company, L.P. The information contained

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Using Plant Growth Regulators (PGRs) in vineyards

Using Plant Growth Regulators (PGRs) in vineyards Using Plant Growth Regulators (PGRs) in vineyards Ashraf El-kereamy University of California Cooperative Extension Kern County Plant hormones: PGR vs Hormones - Endogenous organic compounds active at very

More information

scale per l arredamento d interni stairs for interior design www.scalainteriors.com

scale per l arredamento d interni stairs for interior design www.scalainteriors.com scale per l arredamento d interni stairs for interior design www.scalainteriors.com scale per l arredamento d interni stairs for interior design www.scalainteriors.com Collezione Scala. Una varietà di

More information

Milano (Italia) Light Nova Lighting

Milano (Italia) Light Nova Lighting Milano (Italia) Light Nova Lighting Light Nova is one of Neri s most innovative products in terms of lighting performance and design. Designed by our team and tested in our labs, it combines a vintage

More information

Your 2 nd best friend

Your 2 nd best friend Your 2 nd best friend Hunting cartridges NATURAL 2 Your 2 nd best friend NATURAL FATTE DA CACCIATORI PER I CACCIATORI. La qualità della cartuccia in un azione venatoria è l elemento più importante che

More information

Application Lifecycle Management. Build Automation. Fabrizio Morando Application Development Manger Microsoft Italia

Application Lifecycle Management. Build Automation. Fabrizio Morando Application Development Manger Microsoft Italia Application Lifecycle Management Build Automation Fabrizio Morando Application Development Manger Microsoft Italia Application Lifecycle Management Fondamenti di Build Management Do your systems talk business?

More information

ANTAREX. AutoTuning and Adaptivity approach for Energy efficient exascale HPC systems. Type of action: H2020: Research & Innovation Actions (RIA)

ANTAREX. AutoTuning and Adaptivity approach for Energy efficient exascale HPC systems. Type of action: H2020: Research & Innovation Actions (RIA) ANTAREX AutoTuning and Adaptivity approach for Energy efficient exascale HPC systems Call: H2020-FET-HPC-1-2014 Type of action: H2020: Research & Innovation Actions (RIA) Topics: Subtopic Project Coordinator

More information

MASSIVELY PARALLEL SEQUENCING OF MATE RNAL PLASMA DNA IN 113 CASES OF FETAL NUCHAL CYSTIC HYGROMA

MASSIVELY PARALLEL SEQUENCING OF MATE RNAL PLASMA DNA IN 113 CASES OF FETAL NUCHAL CYSTIC HYGROMA Scuola di specializzazione in Genetica Medica Journal Club 14 gennaio 2014 MASSIVELY PARALLEL SEQUENCING OF MATE RNAL PLASMA DNA IN 113 CASES OF FETAL NUCHAL CYSTIC HYGROMA Bianchi, Diana W. MD; Prosen,

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Primiano Tucci Università di Bologna

Primiano Tucci Università di Bologna Hard real-time meets embedded multicore NIOS SoPCs Primiano Tucci Università di Bologna DEIS Dipartimento di Elettronica, Informatica e Sistemistica Il paradigma System on (Programmable) Chip come fattore

More information

Basics of microarrays. Petter Mostad 2003

Basics of microarrays. Petter Mostad 2003 Basics of microarrays Petter Mostad 2003 Why microarrays? Microarrays work by hybridizing strands of DNA in a sample against complementary DNA in spots on a chip. Expression analysis measure relative amounts

More information

Public Affairs & Communication Huawei Italia

Public Affairs & Communication Huawei Italia Security Level: Talent Lab A training program sponsored by Huawei and MIUR Public Affairs & Communication Huawei Italia www.huawei.com HUAWEI TECHNOLOGIES CO., LTD. The project : TALENT LAB Talent Lab

More information

PLNT2530 Unit 6e DNA Sequencing

PLNT2530 Unit 6e DNA Sequencing PLNT2530 Unit 6e DNA Sequencing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 High-throughput

More information

DIRECTORS AND OFFICERS PROPOSTA DI POLIZZA

DIRECTORS AND OFFICERS PROPOSTA DI POLIZZA DIRECTORS AND OFFICERS PROPOSTA DI POLIZZA La presente proposta deve essere compilata dall`amministratore o dal Sindaco della Societa` proponente dotato di opportuni poteri. La firma della presente proposta

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

INFORMAZIONI GENERALI / GENERAL INFORMATION

INFORMAZIONI GENERALI / GENERAL INFORMATION INFORMAZIONI GENERALI / GENERAL INFORMATION LE FLANGE DELLA SOCIETà INTERTUBI SONO FORNITE IN ACCORDO ALLE SEGUENTI NORME: INTERTUBI S FLANGES ARE PROVIDED IN ACCORDING WITH THE FOLLOWINGS STANDARDS Norma

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

GLOBALG.A.P RISK ASSESSMENT ON SOCIAL PRACTICE (GRASP)

GLOBALG.A.P RISK ASSESSMENT ON SOCIAL PRACTICE (GRASP) GLOBLG..P RISK SSESSMENT ON SOCIL PRCTICE (GRSP) - GGN:4050373876753 Registration number of producer/ producer group (from CB):CSQ 3020P001 - - PROOF OF SSESSMENT ccording to GRSP General Regulations v1.1

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

the online and local desktop version of the Pathway tools) (2) and genome overview chart of

the online and local desktop version of the Pathway tools) (2) and genome overview chart of 1 Supplementary Figure S1. The Omics Viewer description. (1) the cellular overview (available in the online and local desktop version of the Pathway tools) (2) and genome overview chart of the maize gene

More information

Lesson 4 (A1/A2) Present simple forma interrogativa e negativa FORMA. + infinito senza to. Does he / she / it. No, I / you / we / they don t.

Lesson 4 (A1/A2) Present simple forma interrogativa e negativa FORMA. + infinito senza to. Does he / she / it. No, I / you / we / they don t. Lesson 4 (A1/A2) Present simple forma interrogativa e negativa FORMA Interrogativa Negativa Do I / you / we / they Does he / she / it I / you / we / they do not/don t He / she / it does not/doesn t + infinito

More information

L informatica nel mondo industriale

L informatica nel mondo industriale Gian Luca Sacco - Marketing Director South & Central Europe L informatica nel mondo industriale Page 1 Smarter decisions, better products. Today s Product Challenges are More Difficult Than Ever Before

More information

Progetto Ombra Milano propone un nuovo progetto dal design tutto italiano. Una SCALA di prestigio accessibile a tutti.

Progetto Ombra Milano propone un nuovo progetto dal design tutto italiano. Una SCALA di prestigio accessibile a tutti. la crisi è la migliore benedizione che ci può accadere, tanto alle persone quanto ai paesi, poiché questa porta allo sviluppo personale e ai progressi. Crisis is the best blessing that could ever happen,

More information

GIBITRE INSTRUMENTS S.R.L. VIA MEUCCI 1 24035 CURNO BG ITALY INTERNAL TENSOR CHECK. GIBITRE Instruments TENSOR CHECK COMPACT-PC

GIBITRE INSTRUMENTS S.R.L. VIA MEUCCI 1 24035 CURNO BG ITALY INTERNAL TENSOR CHECK. GIBITRE Instruments TENSOR CHECK COMPACT-PC RAPPORTO DI TARATURA N. PROVA123456 Report of Calibration No. Pagina 1 di 6 Page 1 of 6. - Data di emissione date of issue - destinatario addresse - richiesta application - in data date Si riferisce a

More information

WHO EUROPEAN HEALTHY CITIES NETWORK Annual Business and Technical Conference 14-16th of June 2012 St. Petersburg, Russia

WHO EUROPEAN HEALTHY CITIES NETWORK Annual Business and Technical Conference 14-16th of June 2012 St. Petersburg, Russia WHO EUROPEAN HEALTHY CITIES NETWORK Annual Business and Technical Conference 14-16th of June 2012 St. Petersburg, Russia Participated assessment of the health, environmental and socio-economic impacts

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

ICT PSP: regole e consigli per la partecipazione

ICT PSP: regole e consigli per la partecipazione ICT PSP: regole e consigli per la partecipazione Iacopo De Angelis NCP ICT PSP APRE APRE Chi è Centro di ricerca no-profit, creato nel 1990 con il patrocinio del Ministero della Ricerca e della Commissione

More information

Analysis of gene expression data. Ulf Leser and Philippe Thomas

Analysis of gene expression data. Ulf Leser and Philippe Thomas Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:

More information

-> Integration of MAPHiTS in Galaxy

-> Integration of MAPHiTS in Galaxy Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration

More information

Castillo et al. Rice Archaeogenetics electronic supplementary information

Castillo et al. Rice Archaeogenetics electronic supplementary information Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products

More information

SAFE TOP OPEN. Sistema di chiusura Locking system

SAFE TOP OPEN. Sistema di chiusura Locking system SAFE: I MODELLI SAFE: MODELS SAFE TOP OPEN Innovativa tastiera touch e display led integrato nella porta New touch keypad and stealthy LED display L apertura dall alto permette un ergonomico accesso al

More information

Biomedical Big Data and Precision Medicine

Biomedical Big Data and Precision Medicine Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types

More information

KENDRIYAVIDYALAYASANGATHAN.CHENNAI REGION CLASS XII COMMONPREBOARD EXAMINATION SUBJECT- BIOLOGY. Section - A

KENDRIYAVIDYALAYASANGATHAN.CHENNAI REGION CLASS XII COMMONPREBOARD EXAMINATION SUBJECT- BIOLOGY. Section - A KENDRIYAVIDYALAYASANGATHAN.CHENNAI REGION CLASS XII COMMONPREBOARD EXAMINATION SUBJECT- BIOLOGY TIMEALLOTED: 3HRS MAX.MARKS:70 General Instructions: All questions are compulsory. This question paper consists

More information

Maestri formaggiai dal 1921

Maestri formaggiai dal 1921 formaggiai dal 1921 Sono passati PIÙ DI NOVANT ANNI da quando Giuseppe Colla fondò il CASEIFICIO COLLA. Ancora OGGI dopo 4 GENERAZIONI, produciamo un FORMAGGIO di ALTISSIMA QUALITÀ, mantenendo inalterata

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

L ordine perfet to. In perfect order. Attuatore elettrico a stelo per apertura e chiusura di finestre a sporgere, a lamelle, pale frangisole e cupole

L ordine perfet to. In perfect order. Attuatore elettrico a stelo per apertura e chiusura di finestre a sporgere, a lamelle, pale frangisole e cupole Attuatore elettrico a stelo per apertura e chiusura di a sporgere, a lamelle, pale frangisole e cupole Spindle actuator for opening and closing tophung outward, skylights, solar shading and domes Aperture

More information

Tutta la formazione che cerchi, su misura per te.

Tutta la formazione che cerchi, su misura per te. Implementing and Administering Internet Information Services (IIS) 6.0 MOC2576-3 Giorni - 1.190.000 + iva Prerequisiti Almeno due anni di esperienza nell amministrazione di sistemi basati su Windows Servers:

More information

Cell Division. Use Target Reading Skills. This section explains how cells grow and divide.

Cell Division. Use Target Reading Skills. This section explains how cells grow and divide. Cell Processes and Energy Name Date Class Cell Processes and Energy Guided Reading and Study Cell Division This section explains how cells grow and divide. Use Target Reading Skills As you read, make a

More information

Microarray Technology

Microarray Technology Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except

More information

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray

More information

Research Roadmap for the Future. National Grape and Wine Initiative March 2013

Research Roadmap for the Future. National Grape and Wine Initiative March 2013 Research Roadmap for the Future National Grape and Wine Initiative March 2013 Objective of Today s Meeting Our mission drives the roadmap Our Mission Drive research to maximize productivity, sustainability

More information

La creatività in cucina. Serie Uniplan. Serie Neutro. Serie 900A Rivenditore - Dealer. Serie LD. Fancy in the kitchen

La creatività in cucina. Serie Uniplan. Serie Neutro. Serie 900A Rivenditore - Dealer. Serie LD. Fancy in the kitchen STUDIOVERDE Serie Neutro Complementi e accessori in acciaio inox. Stainless steel components and accessories. Le prestazioni sono indicative e dipendono dall applicazione pratica. Modelli e dati possono

More information

Roberto Ciccone, Orsetta Zuffardi Università di Pavia

Roberto Ciccone, Orsetta Zuffardi Università di Pavia Roberto Ciccone, Orsetta Zuffardi Università di Pavia XIII Corso di Formazione Malformazioni Congenite dalla Diagnosi Prenatale alla Terapia Postnatale unipv.eu Carrara, 24 ottobre 2014 Legend:Bluebars

More information

Cloud activities @ INFN-Bari

Cloud activities @ INFN-Bari Cloud activities @ INFN-Bari /////////////////////////////////////////////// Alessandro Italiano - Workshop di CCR sull'infrastruttura Cloud - Napoli, 12/2014////////////////////////////////////////////////

More information

ipratico POS Quick Start Guide v. 1.0

ipratico POS Quick Start Guide v. 1.0 ipratico POS Quick Start Guide v. 1.0 Version History Version Pages Comment Date Author 1.0 First Release 5/Marzo/2012 Luigi Riva 2 SUMMARY 1 GETTING STARTED 4 1.1 What do you need? 4 1.2 ipad 5 1.3 Antenna

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

AUTOTROPHES AND HETEROTROPHES

AUTOTROPHES AND HETEROTROPHES WHAT IS CLIL??? Da alcuni anni nel Liceo Linguistico Da Vinci di Alba viene sperimentata la metodologia CLIL (Content and Language Integrated Learning), anticipando quanto previsto dalla recente riforma

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

BUSTE ALUMINIUM ALLUMINIO BAGS

BUSTE ALUMINIUM ALLUMINIO BAGS BUSTE ALUMINIUM ALLUMINIO BAGS La qualità di sempre nel nuovo e pratico. L'esigenza di uno smaltimento degli imballaggi efficace e senza spese ulteriori ha promosso il dei prodotti CANNONE nelle pratiche

More information

DVD. Culture. A British police officer. 4 Riguarda il DVD. Rispondi alle. 2 Scrivi le parole del riquadro sotto le figure

DVD. Culture. A British police officer. 4 Riguarda il DVD. Rispondi alle. 2 Scrivi le parole del riquadro sotto le figure 3 Guarda il DVD e controlla le tue risposte all es. 2. Riguarda il DVD. Rispondi alle How many police officers are there in the UK? 2 Who started the police force? A British police officer Scrivi tutte

More information

Limiti verticali e classificazione Vertical limits and classification. 1 2 3 4 Amendola

Limiti verticali e classificazione Vertical limits and classification. 1 2 3 4 Amendola AIP - Italia ENR 2.1.3-1 ENR 2.1.3 ZONE DI TRAFFICO AEROPORTUALE DI AEROPORTI/ELIPORTI MILITARI NON APERTI AL TRAFFICO CIVILE MILITARY AERODROME TRAFFIC ZONE OF AIRPORTS/HELIPORTS NOT OPEN TO CIVIL TRAFFIC

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

*N.B.: le lunghezze riportate sono da intendere passaggio aria VERNICIATURA: Colori RAL 9010-9016 - 7035: + 15% Altri colori: prezzi a richiesta

*N.B.: le lunghezze riportate sono da intendere passaggio aria VERNICIATURA: Colori RAL 9010-9016 - 7035: + 15% Altri colori: prezzi a richiesta DIF DLF PREZZI / PRICES 90 Caratteristiche: Diffusori lineari a feritoie con deflettori a lama. Costruzione: Deflettori neri (standard) Deflettori bianchi RAL 900 modello DLF/DW (su richiesta) Impiego:

More information

SISTEMA ANTE EVO 2 DOOR SYSTEM EVO 2

SISTEMA ANTE EVO 2 DOOR SYSTEM EVO 2 EVO 2 Programma per ante scorrevoli in legno o con telaio in alluminio con peso massimo 50 kg. Disponibili nella versione frenata con ammortizzatori oppure con fermi tradizionali. Program for sliding doors

More information

IGCSE and GCSE Biology. Answers to questions. Section 2. Flowering Plants. Chapters 6-9. Chapter 6 Plant structure and function

IGCSE and GCSE Biology. Answers to questions. Section 2. Flowering Plants. Chapters 6-9. Chapter 6 Plant structure and function 1 IGCSE and GCSE Biology. Answers to questions Section 2. Flowering Plants. Chapters 6-9 Chapter 6 Plant structure and function Page 54 1. a Epidermis. Helps maintain shape, reduces evaporation, resists

More information

bookmatch Honey Apricot Onyx

bookmatch Honey Apricot Onyx ONYX LINE Onyx - its name from the Greek Onyks means nail because of its similar translucency to the natural nail one. Due to the variety of its colours, to its depth and exclusive patterns, each single

More information

Programmable Graphics Hardware

Programmable Graphics Hardware Programmable Graphics Hardware Alessandro Martinelli alessandro.martinelli@unipv.it 6 November 2011 Rendering Pipeline (6): Programmable Graphics Hardware Rendering Architecture First Rendering Pipeline

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Ausili, medicale e largo consumo: gli orientamenti dell Organizzazione Mondiale della Sanità

Ausili, medicale e largo consumo: gli orientamenti dell Organizzazione Mondiale della Sanità Convegno Qualitàe sicurezza del dispositivo medico: l ausilio nella vita quotidiana Padova, 7 novembre 2015 Ausili, medicale e largo consumo: gli orientamenti dell Organizzazione Mondiale della Sanità

More information

Deliberazione n.6/2013. Audit su Annual Progress Report del CERN. SEZIONE DI CONTROLLO PER GLI AFFARI COMUNITARI ED INTERNAZIONALI

Deliberazione n.6/2013. Audit su Annual Progress Report del CERN. SEZIONE DI CONTROLLO PER GLI AFFARI COMUNITARI ED INTERNAZIONALI Deliberazione n.6/2013. Audit su Annual Progress Report del CERN. SEZIONE DI CONTROLLO PER GLI AFFARI COMUNITARI ED INTERNAZIONALI IL COLLEGIO PER L ATTIVITA DI CONTROLLO SUL CERN composto dai Magistrati:

More information