I SATELLITI DI SCIENZE NATURALI I CLIL BIOTECHNOLOGY CLIL RICERCA E DIDATTICA DELLE SCIENZE PER LA SCUOLA ITALIANA PRINCIPATO

Size: px
Start display at page:

Download "I SATELLITI DI SCIENZE NATURALI I CLIL BIOTECHNOLOGY CLIL RICERCA E DIDATTICA DELLE SCIENZE PER LA SCUOLA ITALIANA PRINCIPATO"

Transcription

1 I SATELLITI DI SCIENZE NATURALI I CLIL MARINA PORTA PIA CLARA PAFUNDI CLIL BIOTECHNOLOGY PRINCIPATO RICERCA E DIDATTICA DELLE SCIENZE PER LA SCUOLA ITALIANA

2 I SATELLITI DI SCIENZE NATURALI I CLIL MARINA PORTA PIA CLARA PAFUNDI BIOTECHNOLOGY CLIL PRINCIPATO RICERCA E DIDATTICA DELLE SCIENZE PER LA SCUOLA ITALIANA

3 Direzione editoriale: Franco Menin Coordinamento: Marinella Torri, Alessandra Brunetti Redazione: Marina Mansi Progetto graico e copertina: Giuseppina Vailati Canta Ricerca iconograica: Marina Mansi Impaginazione: Fabio Bergamaschi, Studio In.pagina Disegni: Daniele Gianni Le pagine espositive sono un libero adattamento di parti dell opera I satelliti di scienze naturali Biotecnologie di Maria Vezzoli e Claudio Vicari, edita dalla Casa editrice Principato nel Si ringrazia la professoressa Alexandra McLennan per la consulenza e la revisione linguistica di tutti i materiali. Ha collaborato alla redazione del testo Martina Mirabella. Immagine di copertina: Shutterstock I materiali reperibili nel sito o allegati all edizione digitale sono messi a disposizione per un uso esclusivamente didattico. All atto della pubblicazione la casa editrice ha provveduto a controllare la correttezza degli indirizzi web ai quali si rimanda nel volume; non si assume alcuna responsabilità sulle variazioni che siano potute o possano intervenire successivamente. Per le riproduzioni di testi e immagini appartenenti a terzi, inseriti in quest opera, l editore è a disposizione degli aventi diritto non potuti reperire, nonché per eventuali non volute omissioni e/o errori di attribuzione nei riferimenti. ISBN (I CLIL Biotechnology) ISBN (sola versione digitale) Prima edizione: marzo 2015 Ristampe VI V IV III II I * Printed in Italy 2015 Proprietà letteraria riservata. È vietata la riproduzione, anche parziale, con qualsiasi mezzo effettuata, compresa la fotocopia, anche ad uso interno o didattico, non autorizzata. Le fotocopie per uso personale del lettore possono essere effettuate nei limiti del 15% di ciascun volume dietro pagamento alla SIAE del compenso previsto dall art. 68, commi 4 e 5, della legge 22 aprile 1941 n Le riproduzioni per inalità di carattere professionale, economico o commerciale o comunque per uso diverso da quello personale, possono essere effettuate a seguito di speciica autorizzazione rilasciata da EDISER (Centro licenze e autorizzazioni per le riproduzioni editoriali), corso di Porta Romana 108, Milano, e sito web Casa Editrice G. Principato S.p.A. Via G.B. Fauché Milano La casa editrice attua procedure idonee ad assicurare la qualità nel processo di progettazione, realizzazione e distribuzione dei prodotti editoriali. Stampa: SEBEGRAF - Arese (Mi)

4 i CLIL Un apprendimento integrato di lingua e contenuti La metodologia di insegnamento CLIL, Content and Language Integrated Learning, creata nel 1994 da David Marsh e Anne Maljers, rappresenta un nuovo approccio metodologico in ampia espansione nelle scuole italiane ed europee, con lo scopo di promuovere l insegnamento di una disciplina in una lingua comunitaria, solitamente la lingua inglese. Gli obiettivi del CLIL Il CLIL facilita la comunicazione nella seconda lingua, permettendo allo studente di esercitare le sue abilità su contenuti disciplinari, piuttosto che solo e unicamente sulle strutture grammaticali. Le quattro C Il metodo CLIL permette di lavorare su più piani contemporaneamente, le cosiddette 4 C : Cognition, Content, Culture, Communication. L approccio integrato e facilitato (scaffolding) favorisce la costruzione di un personale sapere globale e il conseguimento di specifiche competenze linguistiche e disciplinari. I CLIL di scienze naturali Nei CLIL di scienze naturali i contenuti sono segmentati per facilitarne la comprensione e accompagnati da numerose e diverse tipologie di esercizi, ideate non solo per valutare l acquisizione delle prestazioni previste (reading, writing, defining, completing, checking, reconstructing, filling, matching), ma anche per permettere agli studenti di raggiungere una performance adeguata alle personali capacità e ai diversi stili cognitivi. 3

5 I SATELLITI DI SCIENZE NATURALI I CLIL BIOTECHNOLOGY è proposto anche in versione ebook+, un nuovo modo per studiare i contenuti utilizzando diversi dispositivi multimediali, come computer e tablet. I contenuti digitali integrativi di questo volume sono disponibili sul sito L ebook+ è multimediale L ebook+ arricchisce il libro di testo digitale con contributi audio, video, oggetti interattivi, gallerie fotografiche e link a risorse esterne. L ebook+ è interattivo L ebook+ integra esercizi direttamente sul testo digitale per un immediata verifica dell apprendimento. L ebook+ è coinvolgente L ebook+ aiuta gli studenti a comprendere e approfondire i contenuti, rendendo l apprendimento più attivo e divertente. Nelle pagine sono inserite delle icone che indicano la presenza e il tipo di contributi disponibili sul libro di testo. È sufficiente cliccarle per accedere ai materiali didattici aggiuntivi: foto, video, esercizi, link e oggetti interattivi. Audio Integra il testo con la versione audio dei contenui. Approfondimenti Rimanda ad altre sezioni del libro digitale che contengono materiali per l approfondimento. Link Rimanda a siti e a pagine web esterne. Test Ofre esercizi, test a risposta mulipla o veriiche di apprendimento. La correzione è immediata e permete di individuare e ripassare in autonomia i contenui non assimilai. Video Integra il testo con ilmai e animazioni. HTML 5 Propone oggei interativi che integrano immagini e tesi e ofrono un nuovo modo di studiare e approfondire i contenui. Fotogallery Aggiunge fotograie, disegni e altro materiale graico al testo. Può essere una singola immagine o una gallery di immagini. 4

6 Recombinant DNA and chapter1 genetic engineering 1.1 What is biotechnology? 7 BEFORE READING 7 WHILE READING 8 Is biotechnology an ex novo science or the result of the ongoing research? 8 An important discovery: living microorganisms are at the core of the fermentation process 8 The transition from traditional to innovative biotechnology 9 AFTER READING Recombinant DNA 12 BEFORE READING 12 WHILE READING 14 Recombinant DNA technology 14 Restriction enzymes 14 How do we get recombination? 16 Further exploitations: cloning 17 AFTER READING Biotechnology: the instruments 21 BEFORE READING 21 WHILE READING 22 DNA gel electrophoresis 22 Gel electrophoresis in practice 23 Polymerase chain reaction (PCR) 24 PCR: the three steps 26 AFTER READING Genetic engineering and GMOs 30 BEFORE READING 30 WHILE READING 30 Vectors introduce new DNA into host cells 30 Genetically Modiied Organisms (GMOs) 32 AFTER READING 34 Final test chapter 1 36 Contents Genome study chapter2 and bioinformatics 2.1 Genome sequencing: the methods 39 BEFORE READING 39 WHILE READING 39 Biotechnology in real life 39 Sequencing methodologies 40 Sanger method 40 Shotgun sequencing 41 AFTER READING Genomic libraries 45 BEFORE READING 45 WHILE READING 46 Genomic libraries contain collections of DNA fragments 46 cdna libraries are built starting from mrna transcripts 48 AFTER READING Genome study: probes, microarrays and chips 51 BEFORE READING 51 WHILE READING 51 Developments in the genome study 51 AFTER READING The Human Genome Project (HGP) 55 BEFORE READING 55 WHILE READING 55 How the Human Genome Project was born 55 HGP results 56 The importance of junk DNA 57 AFTER READING Bioinformatics: a growing field of research 60 BEFORE READING 60 WHILE READING 60 The birth of Bioinformatics 60 Bioinformatics and evolutionary biology 61 RNA interference 62 AFTER READING The future: the omics 65 BEFORE READING 65 WHILE READING 65 From the HGP to the omics era 65 How can we understand the proteome? 66 AFTER READING 68 Final test chapter 2 70 Index 72 5

7 Recombinant DNA and genetic engineering 1.1 What is biotechnology? 1.2 Recombinant DNA 1.3 Biotechnology: the instruments 1.4 Genetic engineering and GMOs 1 chapter 6

8 chapter 1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.1 What is biotechnology? BEFORE READING 1 Work in group and agree on a deinition for the word biotechnology. 2 Match the words in column A with their deinitions in column B. 3 Solve the crossword below. A a DNA 1 Specialized eukaryotic cell structures delimited by a membrane. b Enzyme 2 A low-energy attractive force between hydrogen and another element. c Chromosome 3 A nucleic acid existing in diferent forms. d Bacteria 4 Nucleic acid with heritable, genetic material. e Organelles 5 Protein which catalyzes speciic cell reactions. f RNA 6 A threadlike structure within the cell, placed either in the nucleus or in the cytoplasm which bears genetic material. g Replication 7 Prokaryotic microorganisms. h Hydrogen bonds 8 The fundamental, physical and functional units of heritability. i Genes 9 The process of producing an exact copy of DNA. j Genetics 10 Study of both the genotype and phenotype of parent organisms in order to produce a hybrid with desirable features from the parents. k Artiicial selection 11 The science which studies heritability. B 7 Down 2. Study of both genotype and phenotype of parent organisms to produce a hybrid with desirable features found in their parents. (2 Words) 3. Protein which catalyzes specific cell reactions. 4. The science which studies heritability. 6. Specialized eukaryotic cell structures delimited by membrane. 10. A nucleic acid existing in different forms Across 1. Nucleic acid with the function of heritable genetic material. 5. The process of producing an exact copy of DNA. 7. The fundamental, physical and functional unit of heritability. 8. Prokaryote microorganisms. 9. A threadlike structure within the cell, placed either in the nucleus or in the cytoplasm, that bears the genetic material. 11. Low-energy attractive forces between hydrogen and another element. (2 Words)

9 chapter1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.1 What is biotechnology? WHILE READING 4 Read the text carefully. Underline any words you don t understand and look them up in the dictionary. Is biotechnology an ex novo science or the result of ongoing research? Biotechnology can broadly be deined as any technology which uses either living organisms or puriied sub-cellular components in order to obtain large quantities of useful products; improve the characteristics of plants and animals; or develop useful microorganisms for speciic uses. Although the term biotechnology is a relatively new one, it has ancient even prehistoric origins. Humans began turning milk into yogurt and cheese, and producing beer, wine and bread thousands of years ago 1. Our ancestors did not understand the mechanisms underlying these changes (rising, fermentation, etc.) and hence could not have realized that living organisms were at the core of these processes. 1 Ancient Egypts and beer An Egyptian funerary stele, dating back to 1350 B.C., depicts a man tasting beer. An important discovery: living microorganisms are at the core of the fermentation process In 1861 Louis Pasteur understood and described these common and yet mysterious events. He identiied the organisms responsible for the changes involved in things such as beer brewing and the fermentation of milk 2. Pasteur can be seen as the father of biotechnology. He laid the foundations for the fermentative processes which form the basis of the bio-industry. These processes use pure cultures of microorganisms to produce food, drink and other useful products. 2 Yogurt Yogurt is the product of milk fermented by speciic bacteria. 8

10 The transition from traditional to innovative biotechnology The transition from the traditional to the innovative stages of biotechnology is linked to the selection and characterization of strains of microorganisms and to the development of technologies for the cultivation and optimization of production 3. However, innovative biotechnology is only clearly deined by the use of recombinant DNA technology (genetic engineering). Modern biotechnology is based on a series of advances made in molecular genetics between 1950 and The conluence of the methods from genetics and molecular biology led to the development of genetic engineering around the 1980s. Over the past thirty years, genetic engineering has specialized to include a range of experimental methods to isolate, characterize and manipulate genes. Genes, made of DNA, contain the instructions to produce either functional or structural speciic proteins. The ability to locate, transfer and modify genes is an important feature of innovative biotechnology. 3 Small spelt, Triticum monococcum, grown in the Neolitic, is today used for the genetic improvement of the other species of spelt. 9

11 chapter1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.1 What is biotechnology? AFTER READING READING COMPREHENSION 5 Read the text on biotechnology. Mark the following statements as true (T) or false (F) and correct the false statements. 1 Biotechnology can functionally be deined as any technology based on the information contained in DNA. T F 2 Modern biotechnology uses non-living organisms to isolate genes. T F 3 In 1700, Pasteur discovered the microorganisms responsible for the fermentation process. 4 The transition from traditional to innovative biotechnologies is based only on the selection of the strains of microorganisms to be used. 5 Genetic engineering includes several methods in order to isolate, characterize and manipulate genes. T F T F T F EXPANDING VOCABULARY 6 Fill in the gaps with the words below. engineering biotechnology methods manipulate biology isolate experimental biology specialized genes information 1980s proteins Modern is based on a series of advances made in molecular between 1950 and The conluence of the from genetics and molecular led to the development of genetic around the. Over the past thirty years genetic engineering has to include a range of methods to isolate, characterize and genes. Genes, made of DNA, contain the to produce either functional or structural speciic. The ability to, transfer and modify is an important feature of innovative biotechnology. CONSOLIDATING KNOWLEDGE 7 Answer the following questions. a. Which organism is responsible for fermentation? b. Why can t we consider biotechnology a recent innovation? 10

12 APPLYING NEW KNOWLEDGE 8 Create a timeline in which you place at least ive signiicant events in the discovery of DNA between the 17 th and 20 th centuries. Use the appropriate software (e.g. SimpleMind software) to build your timeline as a conceptual map. 9 Read the following table and answer the questions. Biotechnology through time Before Christ In Mesopotamia, animals are frequently crossed with one another (artificial selection) in order to improve livestock. Fermentation is first done with the use of yeast to produce beer, wine and bread Anton van Leeuwenhoek discovers the existence of microorganisms thanks to the microscope. XIX century Louis Pasteur identifies the role of microorganisms. He is considered the founder of microbiology. In 1865 Gregor Mendel formulates the three fundamental laws of inheritance Karl Ereky, a Hungarian agronomist, uses the term biotechnology for the first time. In 1950, the first generation of whole plants is grown from in vitro culture Identification of the DNA double helix, responsible for the transmission of genetic information Birth of modern biotechnology Birth of genetic engineering. In 1983, Kary B. Mullis creates the polymerase chain reaction (PCR) technique, a revolution in the world of biotechnology First cloning of a mammal, Dolly the sheep, using adult sheep DNA Completion of the Human Genome Project. a. Who used the term biotechnology for the irst time? b. When was the Human Genome Project completed? c. When was fermentation irst done? d. Which animal was cloned irst? 10 Using the information in the table, try to write a short text about the origins and development of biotechnology. (You may start like this: Biotechnology is a very ancient science. In fact, even before Christ, ) 11

13 chapter 1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.2 Recombinant DNA BEFORE READING 1 Work in group and agree on a deinition for the word recombination. 2 Match the words in column A with their deinitions in column B. A a Genome 1 Organisms which spend a signiicant portion of their life in or on a host organism, causing it harm even if not immediately killing it. b Vector 2 A gram-negative bacillus abounding in the intestine of endotherms commonly used as a model organism. c DNA Ligase 3 The ability of a microorganism to withstand the efects of an antibiotic. d Parasites 4 A DNA or RNA sequence that reads the same in both directions. e Codon 5 The physical appearance or biochemical characteristic of an organism as a result of the interaction of its genotype and the environment. f Palindrome 6 An organism s complete set of DNA, including all of its genes. g Escherichia coli 7 An enzyme which joins DNA strands together by forming a phosphodiester bond. h Phenotype 8 A triplet in mrna which forms a base-pair with the corresponding anticodon of a trna molecule. i Antibiotic resistance 9 A plasmid or viral chromosome into whose genome a fragment of foreign DNA is inserted. B endotherms organisms/animals that maintain a constant body temperature independently of the environment Electron microscope image of Escherichia coli 12

14 3 Solve the crossword below. Across 5. A nucleic acid present in all living cells, which is generally single stranded (double stranded in some viruses) and plays a crucial role in transferring information from DNA to the protein synthesis system of the cell. 7. The ability of a microorganism to withstand the effects of an antibiotic. (2 Words) 9. The physical appearance or biochemical characteristic of an organism as a result of the interaction of its genotype and the environment. 10. A plasmid or viral chromosome into whose genome a fragment of foreign DNA is inserted Down 1. A gram-negative bacillus which abounds in the intestine of endotherms. It is commonly used as a model organism. (2 Words) 2. An enzyme which closes either nicks or discontinuities in one strand of double stranded DNA by creating an ester bond between adjacent 3 OH and 5 PO4 ends on the same strand. (2 Words) 3. A DNA or RNA sequence that reads the same in both directions. 4. A triplet of nucleotide bases in transfer RNA that identifies the amino acid carried and which binds to a complementary codon on messenger RNA during protein synthesis at a ribosome. 6. Organisms which spend a significant portion of their life either in or on a host organism, causing it harm even if not immediately killing it. 8. An organism s complete set of DNA, including all of its genes. 13

15 chapter1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.2 Recombinant DNA WHILE READING 4 Read the text carefully. Underline any words you don t understand and look them up in the dictionary. Recombinant DNA technology Recombinant DNA technology is a laboratory technique in which short sequences of DNA are isolated and cut in order to transfer and insert them into the genome of other cells, in turn modifying one or more genes. This technology allows for the speciic modiication of a particular gene or characteristic. Moreover, current methods allow for the transfer of DNA among individuals of species which are often very different from one another (e.g., the transfer of a bacterial gene to a plant or the introduction of a eukaryotic gene into a bacterium). In practice, recombinant DNA technology is very complex but conceptually it is based on very simple criteria: (a) identiication of the gene; (b) the cutting and isolation of the gene from the DNA molecule; (c) cohesion of the gene with a DNA vector and (d) transfer of the gene to a recipient cell. This allows for a range of possibilities, from a simple genetic improvement in the recipient individual (e.g., increased resistance to parasites) to the cloning of an introduced gene in a host cell. This latter process creates a cell which in a sense becomes a factory producing useful molecules. Restriction enzymes DNA recombination relies on cutting DNA, an operation which requires speciic enzymes (restriction enzymes and DNA ligases). At the end of the 1960s, it was found that some bacteria defended themselves from virus infection by producing special enzymes, namely restriction enzymes, which cut the extraneous DNA molecules and reduced them into smaller, non-infectious, fragments 1. These enzymes break the backbone of the DNA, the phosphodiester bond, between two subsequent nucleotides. Nowadays we know several restriction enzymes, each with a speciic recognition sequence (4-6 base pairs), known as the restriction site. Once restriction enzymes have completed the cut, two types of 1 Enzymes acting as scissors Bacteria defend themselves from the attack of viruses (bacteriophages) thanks to the action of restriction enzymes. 1 A bacteriophage introduces its genetic material into the bacterial cell. 2 A restriction enzyme cuts viral DNA at the level of speciic sequences of nucleotides. 3 Other enzymes further degrade viral DNA into even smaller fragments. 4 Bacterial DNA is protected by the restriction enzymes attack thanks to methyl groups on the restriction site of the enzyme. 14

16 single-stranded ends can be obtained, each containing a sequence of bases able to bind to another one for complementarity 2: - blunt ends, when the two helices are interrupted in the centre of the restriction site: A-A T-T T-T A-A sticky ends, when the two helices are cut asymmetrically, resulting in one longer than the other: G A-A-T-T-C C-T-T-A-A G Note that, reading these sequences in the 5-3 direction, they are palindrome. Restriction enzymes never cut the DNA of their producing cell. Indeed, bacteria protect their DNA through methylation, the addition of a methyl group (-CH 3 ) to every restriction site on the bacterial DNA. Today, there are hundreds of restriction enzymes and once isolated, extracted and puriied from various organisms, they are used in the laboratory as biochemical scissors. They are so called because when incubated with the DNA of an organism in a test tube, they are able to cut that organism s DNA at each point where a restriction site is present. Thus, the same DNA sample can be cut by more than one enzyme, each recognizing a different restriction site. In this way molecular biologists can blunt end the simplest DNA end of a double stranded molecule. Both strands terminate in a base pair sticky end long overhangs, stretches of unpaired nucleotides in the end of a DNA molecule. These unpaired nucleotides can be in either strand, creating either 3 or 5 overhangs. These overhangs are in most cases palindromic. These ends are called sticky since they are easily joined back together by a ligase 2 How recombinant DNA originates The restriction enzyme recognizes the palindromic sequences and cuts them asymmetrically (red arrows), thus producing fragments with sticky ends. Such fragments pair with the complementary bases and hydrogen bonds form, linking the two strands of DNA. The result is a recombinant DNA molecule. Restriction sites of EcoRI in two different DNA molecules DNA 5' CGATCCAGGAATTCATCCAGCC AG A CAGCC CC 3' 3' GCTAGGTCCTTAAGTAGGTCGG TC GTCGG GG 5' 5' AGGCTCTAGAATTCTTCTAGCT TAG TTC TAGCT 3' 3' TCCGAGATCTTAAGAAGATCGA GAT ATC AAG GATC ATCGA 5' Fragments with sticky ends CGATCCAGG AGG GCTAGGTCCTTAA TCC AATTCATCCAGCC ATCCAG CAGCC CC GTAGGTCGG GTCGG GG AGGCTCTAG TAG TCCGAGATCTTAA ATC AATTCTTCTAGCT T TAGCT GAAGATCGA ATCGA CGATCCAGGAATTCTTCTAGCT AG TTC TAGCT GCTAGGTCCTTAAGAAGATCGA TCC AAGATC ATCGA Recombinant DNA 15

17 chapter1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.2 Recombinant DNA choose among different sites and cut a DNA fragment with surgical accuracy Table 1. The obtained fragments of DNA are called restriction fragments. Since the recognizing sequences do not occur at regular intervals, restriction fragments have different lengths. This allows them to be distinguished, both by the determination of the number of single fragments and their molecular size and by the identiication and puriication of fragments of particular interest. As we will see in the next paragraph, gel electrophoresis is one method used to either separate or purify DNA fragments. Table 1 Some restriction enzymes, the original organism and the recognized sequence Enzymes Original organism Recognized sequence EcoRI Escherichia coli 5 GAATTC3 3 CTTAAG5 EcoRV Escherichia coli 5 GATATC3 3 CTATAG5 BamHI Bacillus amyloliquefaciens 5 GGATCC3 3 CCTAGG5 HindIII Haemophilus inluenzae 5 AAGCTT3 3 TTCGAA5 How do we get recombination? During DNA duplication, Okazaki fragments are joined together by enzymes called DNA ligases. Once biologists were able to isolate these enzymes, they realized that they could be useful in welding together any two DNA sequences. In 1973, Stanley Cohen and Herbert Boyer irst cut two plasmids of Escherichia coli (both containing a gene for antibiotic resistance) with restriction enzymes and then joined these with a DNA ligase. Once the resulting plasmid was inserted into Escherichia coli cells they became resistant to both antibiotics. The era of recombinant DNA was born 3! The oblique cut created by most restriction enzymes on palindrome restriction sites on the DNA strand is fundamental in obtaining recombinant DNA. Between the two types of cut, sticky ends are the most suitable to produce recombinant DNA. This is because they can be easily linked through hydrogen bonds between the complementary bases of other DNA sequences (e.g., that of a plasmid) cut by the same restriction enzyme and regardless of their origin. DNA ligases stabilize the bonds between adjacent fragments joining the 5 end of one of them to the 3 end of the next one. Some DNA ligases are also able to combine restriction enzymes with blunt ends using slightly different mechanisms. Note that DNA ligases are very sensitive to temperature (which greatly affects hydrogen bonds) and require ATP to operate. Using these enzymes, molecular biologists are able to produce recombinant DNA from a variety of sources. 3 Plasmids Circular DNA molecule of the plasmids of a bacteria, containing a few useful genes, none of which are indispensable to the cell s life. plasmid bacterial chromosome Okazaki fragments the simplest DNA end of a double stranded molecule. Both strands terminate in a base pair ATP (Adenosine TriPhosphate) substance present in all living cells which provides energy for many metabolic processes 16

18 Further exploitations: cloning Nature has provided molecular biologists with the tools for their toolbox, but the extraordinary variety of life offers biotechnology much more than this. Often, a function lacking in a certain species can be found in another species. Finding a methodology is often suficient to allow for the insertion of an exogenous gene of interest into the genome of the species with the deicient function. Nature even provides the appropriate organisms to do this: viruses. The most common application of recombinant DNA in biotechnology is the cloning (i.e., the production of many copies) of a particular gene in order to either analyse or obtain large quantities of its protein product 4. In the latter case, recombinant DNA must either be inserted or transfected into host cells. These cells are considered transgenic after this modiication. The choice of the host cell is extremely important for the attempt to be successful. Host cells can be either prokaryotic or eukaryotic. Once the host species have been chosen, recombinant DNA is brought into contact with a population of host cells and, under appropriate conditions, it is inserted into some of them. Early successes in recombinant DNA technology were achieved using bacteria as they are easy to grow and manipulate in the laboratory. Additionally, their molecular biology (e.g., Escherichia coli) is widely understood and there are several genetic markers available to identify the cells hosting the recombinant DNA. Moreover, bacteria contain plasmids, small, circular chromosomes easily manipulated to carry recombinant DNA into a cell. However, bacteria are not ideal for the study and the expression of eukaryotic genes. There is too much of a difference between the transcription and translation of genomes in prokaryotes and eukaryotes and these functions are often regulated by signals contained within the DNA itself. It is better, therefore, to choose a eukaryotic host, the most common of which are yeasts (like Saccharomyces cerevisiae) because they have a short cell cycle (just a few hours); a relatively small genome (approximately 12 million base pairs and 6000 genes); and they are easily cultivated in the laboratory. Yeasts share many basic features with eukaryotes except for those involved in the multi-cellular state. These latter features require their DNA to be carried inside a vector and the gene to be transferred into either an animal or plant genome. For example, some human proteins must be chemically modiied in order to operate after translation. As all the host cells duplicate themselves, the researcher must be able to recognize which cells actually contain the sequence to be cloned. A common method used to detect cells containing recombinant DNA is to mark the inserted sequence with reporter genes. These are genes whose phenotype is easy to observe and hence can serve as a genetic marker for the sequences of interest. 4 A researcher observes culture plates on which genetically modiied plants are growing transfected inserted into a cell of a bacterial plasmid which contains a foreign virus or genetic material prokaryotic single-celled organism which lacks a membrane-bound nucleus, mitochondria, or any other membrane-bound organelles eukaryotic any organism whose cells contain a nucleus and other structures (organelles) enclosed within membranes 17

19 chapter1 ReCoMbiNANT DNA AND GeNeTiC engineering 1.2 Recombinant DNA GENIC CLONING THROUGH PLASMIDS Escherichia coli bacteria plasmid bacterial chromosome cell containing the gene to be cloned 1 The plasmid and the DNA of the cell are isolated and then cut with the same restriction enzyme. 2 The DNA fragment to be cloned is inserted into the plasmid. 2 1 gene to be cloned gene to be cloned 3 The recombinant plasmid is inserted into the bacterium. 4 The bacterium in culture quickly replicates into great numbers and lots of recombinant plasmid copies are obtained. 5 The genes or the proteins of the cloned bacterium are isolated. recombinant plasmid 3 gene to be cloned 6 6 The genes are inserted into other organisms; e.g. into plants to increase their resistance to diseases or cold, or into bacteria to allow them to eliminate toxic waste. recombinant bacterium bacteria clones The proteins produced have useful applications. In medicine they are used for different therapies: against strokes (by helping to dissolve blood clots); keeping diabetes under control (insulin); and in treating children who do not produce enough growth hormones. 18

20 AFTER READING READING COMPREHENSION 5 Read the text on recombinant DNA. Mark the following statements as true (T) or false (F) and correct the false statements. 1 It is possible to transfer genes from prokaryotic to eukaryotic cells. T F 2 Restriction enzymes recognize a speciic DNA sequence. T F 3 Restriction enzymes also cut bacterial DNA. T F 4 DNA ligases use the same mechanism to join both blunt ends and sticky ends. T F 5 The reporter gene is generally used to mark DNA sequences. T F EXPANDING VOCABULARY 6 Fill in the gaps with the words below. species recombinant host cloning prokaryotic protein population inserted transgenic The most common application of DNA in biotechnology is the (i.e., the production of many copies) of a particular gene in order to either analyse or obtain large quantities of its product. In the latter case, recombinant DNA must be either or transfected into host cells. These cells are considered after this modiication. The choice of the cell is extremely important in order for the attempt to be successful. Host cells can be either or eukaryotic. Once the host have been chosen, recombinant DNA is brought into contact with a of host cells and, under appropriate conditions, it is inserted into some of them. CONSOLIDATING KNOWLEDGE 7 Answer the following questions. a. What is the major diference between genetic recombination in prokaryotes and eukaryotes? 19

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

DNA TECHNOLOGY- methods for studying and manipulating genetic material.

DNA TECHNOLOGY- methods for studying and manipulating genetic material. 1 DNA TECHNOLOGY- methods for studying and manipulating genetic material. BIOTECHNOLOGY, the manipulation of organisms or their components to make useful products. Biotechnology today usually refers to

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy II. Pathways of Discovery in Microbiology 1.6 The Historical Roots of Microbiology 1.6 The Historical Roots of Microbiology 1.7 Pasteur and the Defeat of Spontaneous Generation 1.8 Koch, Infectious Disease,

More information

Biotechnology. Selective breeding Use of microbes (bacteria & yeast)

Biotechnology. Selective breeding Use of microbes (bacteria & yeast) Biotechnology bio and technology The use of living organisms to solve problems or make useful products. Biotechnology has been practiced for the last 10,000 years. Selective breeding Use of microbes (bacteria

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

RECOMBINANT DNA TECHNOLOGY

RECOMBINANT DNA TECHNOLOGY RECOMBINANT DNA TECHNOLOGY By; Dr. Adeel Chaudhary 2 nd yr Molecular Genetics Medical Technology College of Applied Medical Sciences Recombinant DNA is a form of artificial DNA that is made through the

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Gene Cloning Technology

Gene Cloning Technology Gene Cloning Technology Also known as: Genetic engineering or Genetic manipulation (GM) technology implies precision engineering being applied to DNA molecules Recombinant DNA technology - implies that

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

Name Period _. Regents Biology Date _ REVIEW 5: GENETICS

Name Period _. Regents Biology Date _ REVIEW 5: GENETICS Name Period _ Regents Biology Date _ REVIEW 5: GENETICS 1. Chromosomes: a. Humans have 46 chromosomes, or _23 _ homologous pairs. Homologous: _Chromosomes of the same position and size b. Chromosome pairs

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Name: Period: Date: Biotechnology refers to technology used to DNA. The procedures are often referred to as. DNA is cut into small pieces using (RE).

Name: Period: Date: Biotechnology refers to technology used to DNA. The procedures are often referred to as. DNA is cut into small pieces using (RE). Name: Period: Date: I. OVERVIEW OF GENETIC ENGINEERING: Biotechnology refers to technology used to DNA. The procedures are often referred to as. is the genetic material of all living organisms. o All organisms

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Biol 101 Exam 5: Molecular Genetics Fall 2008

Biol 101 Exam 5: Molecular Genetics Fall 2008 MULTIPLE CHOICE. This exam has 60 questions. All answers go on the SCANTRON provided. Choose the one alternative that best completes the statement or answers the question. 1) The genetic material of all

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Cells. DNA and Heredity

Cells. DNA and Heredity Cells DNA and Heredity ! Nucleic acids DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) Determines how cell function " change the DNA and you change the nature of the organism Changes of DNA allows

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Lecture 13. Molecular Cloning

Lecture 13. Molecular Cloning Lecture 13 Molecular Cloning Recombinant DNA technology depends on the ability to produce large numbers of identical DNA molecules (clones). Clones are typically generated by placing a DNA fragment of

More information

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #6 NAME DATE HOUR RECOMBINANT DNA GENETIC ENGINEERING Molecular Genetics Activity #6 page 1 GENETIC ENGINEERING Molecular Genetics Activity #6 page 2 PART I: PRODUCING

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Lecture 36: Basics of DNA Cloning-II

Lecture 36: Basics of DNA Cloning-II Lecture 36: Basics of DNA Cloning-II Note: Before starting this lecture students should have completed Lecture 35 Sequential steps involved in DNA cloning using plasmid DNA as vector: Molecular cloning

More information

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA

Microbiology / Active Lecture Questions Chapter 9 Biotechnology & Recombinant DNA 1 Chapter 9 Biotechnology & Recombinant DNA 1 2 Restriction enzymes were first discovered with the observation that a. DNA is restricted to the nucleus. b. phage DNA is destroyed in a host cell. c. foreign DNA is kept out of a cell. d. foreign DNA

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things.

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Computat onal Biology Lecture 1 Life In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Both are composed of the same atoms and

More information

I. Gene transfer and genetic engineering (Chapter 8) A. General concepts 1. Genetic information is contained in the nucleotide sequence of DNA

I. Gene transfer and genetic engineering (Chapter 8) A. General concepts 1. Genetic information is contained in the nucleotide sequence of DNA I. Gene transfer and genetic engineering (Chapter 8) A. General concepts 1. Genetic information is contained in the nucleotide sequence of DNA (sometimes RNA). Amino acids are specified by a triplet codon.

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

Recombinant Paper Plasmids Cut-and-Paste Biotechnology

Recombinant Paper Plasmids Cut-and-Paste Biotechnology Recombinant Paper Plasmids Cut-and-Paste Biotechnology OBJECTIVE / RIONALE Bioengineers make news using recombinant DNA techniques in hopes of curing genetic diseases, better understanding cancer, and

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

Biotechnology in Medicine and Agriculture

Biotechnology in Medicine and Agriculture Biotechnology in Medicine and Agriculture Bởi: OpenStaxCollege It is easy to see how biotechnology can be used for medicinal purposes. Knowledge of the genetic makeup of our species, the genetic basis

More information

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad Biochem 717 Gene Cloning Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad How to construct a recombinant DNA molecule? DNA isolation Cutting of DNA molecule with the help of restriction

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Gene Cloning and DNA Analysis: An Introduction

Gene Cloning and DNA Analysis: An Introduction Gene Cloning and DNA Analysis: An Introduction Brown, Terry A. ISBN-13: 9781405111218 Table of Contents PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

Genetic engineering or Genetic manipulation (GM) technology. implies precision engineering being applied to DNA molecules

Genetic engineering or Genetic manipulation (GM) technology. implies precision engineering being applied to DNA molecules Gene Cloning Technology Also known as: Genetic engineering or Genetic manipulation (GM) technology implies precision engineering being applied to DNA molecules Recombinant DNA technology - implies that

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg UNIT 3: Molecular Genetics Chapter 6: DNA: Hereditary Molecules of Life pg. 268-6.4: DNA Replication and Repair pg. 282-290 The DNA molecule is capable of replicating on its own. This is important for

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Plasmid-based cloning vectors

Plasmid-based cloning vectors Page: 1 Molecular Cloning A glaring problem in most areas of biochemical research is obtaining sufficient amounts of the substance of interest. For example, a 10 L culture of E. coli grown to its maximum

More information

PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA Analysis are Important

PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS. Chapter 1 Why Gene Cloning and DNA Analysis are Important TABLE OF CONTENTS PART 1 THE BASIC PRINCIPLES OF GENE CLONING AND DNA ANALYSIS Chapter 1 Why Gene Cloning and DNA Analysis are Important 1.1 The early development of genetics 1.2 The advent of gene cloning

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Common Course Topics Biology 1406: Cell and Molecular Biology

Common Course Topics Biology 1406: Cell and Molecular Biology Common Course Topics Biology 1406: Cell and Molecular Biology 1. Introduction to biology --the scientific study of organisms --properties of life --assumptions, methods and limitations of science --underlying

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Biotechnology and Genomics

Biotechnology and Genomics Chapter14: pp. 249-263 BIOLOGY 10th Edition Biotechnology and Genomics Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA probe array tagged DNA did bind to

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Bacterial Transformation

Bacterial Transformation laroslav Neliubov/ShutterStock, Inc. 1 Bacterial Transformation Introduction Microorganisms or microbes are divided into three groups: prokaryotes, eukaryotes, and viruses. Prokaryotes include bacteria,

More information

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor

More information

Vectors cont.. Pattern of Infection. Lytic cycle. Pattern of Infection. Question. Dr. Dinithi Peiris Dept. of Zoology

Vectors cont.. Pattern of Infection. Lytic cycle. Pattern of Infection. Question. Dr. Dinithi Peiris Dept. of Zoology Vectors cont.. Dr. Dinithi Peiris Dept. of Zoology 1 2 Pattern of Infection Lytic cycle 3 Pattern of Infection 4 Question What is the unique feature in this life cycle Phages causes lysis & cell death

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

GENETICS OF BACTERIA AND VIRUSES

GENETICS OF BACTERIA AND VIRUSES GENETICS OF BACTERIA AND VIRUSES 1 Genes of bacteria are found in bacterial chromosomes Usually a single type of chromosome May have more than one copy of that chromosome Number of copies depends on the

More information

Many cells will not take up plasmid during transformation Cells with plasmid can be identified because original plasmid contained gene for antibiotic

Many cells will not take up plasmid during transformation Cells with plasmid can be identified because original plasmid contained gene for antibiotic Many cells will not take up plasmid during transformation Cells with plasmid can be identified because original plasmid contained gene for antibiotic resistance (ampicillin) Use medium with ampicillin

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2 Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial

More information

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19 Health and Life Sciences Faculty Course Title: Biological and Forensic Science Module code: 216 BMS Module Title: Molecular Genetics Overview of the Recombinant DNA technology- the process of subcloning

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

2. Enzymes that cleave DNA at specific sites are called.

2. Enzymes that cleave DNA at specific sites are called. Biotechnology 1. The most recent techniques developed in the biological sciences allow the manipulation of DNA with the ultimate goal of intervening directly with the fate of organisms. 2. Enzymes that

More information

Chapter 2. Introduction to some basic features of genetic information: From DNA to proteins

Chapter 2. Introduction to some basic features of genetic information: From DNA to proteins Chapter 2 Introduction to some basic features of genetic information: From DNA to proteins DAVID QUIST, 1 KAARE M. NIELSEN 1, 2 AND TERJE TRAAVIK 1, 3 1 THE NORWEGIAN INSTITUTE OF GENE ECOLOGY (GENØK),

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Isolation and Electrophoresis of Plasmid DNA

Isolation and Electrophoresis of Plasmid DNA Name Date Isolation and Electrophoresis of Plasmid DNA Prior to lab you should be able to: o Explain what cloning a gene accomplishes for a geneticist. o Describe what a plasmid is. o Describe the function

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Plasmids are small, double strand, closed circular DNA molecules. Isolated from bacterial cells. Replicate independently

More information