Molecular phylogenetic analysis in ecogenotoxicological studies. D. Davolos*,V. Iannilli**, E. De Matthaeis**, B. Pietrangeli*

Size: px
Start display at page:

Download "Molecular phylogenetic analysis in ecogenotoxicological studies. D. Davolos*,V. Iannilli**, E. De Matthaeis**, B. Pietrangeli*"

Transcription

1 Vol. 1, no. 3-4, Molecular phylogenetic analysis in ecogenotoxicological studies D. Davolos*,V. Iannilli**, E. De Matthaeis**, B. Pietrangeli* * ISPESL, Department of Production Plants and Environmental Interaction, Rome ** University of Rome La Sapienza, Department of Animal and Human Biology ABSTRACT The usefulness of taxa belonging to the Amphipoda (Crustacea) in environmental toxicology is welldocumented in literature and a growing number of studies are addressing this line of research. However, as with most ecotoxicology studies, this research is rarely supported by analyses of the genetic structure and evolutionary history of the taxa under examination.the availability of such information becomes crucial when research is being carried out on the effects, such as genotoxic ones, of exposure to particular substances. In this work, two crustaceans (Orchestia garbinii and Gammarus aequicauda;amphipoda) from aquatic habitats and with different ecological characteristics were chosen as potential candidates for ecogenotoxicological assessment for water, as well as for sediments in toto. Data are presented on the genetic structure and on the relationships among populations of these Crustaceans, inferred by using sequences of mitochondrial genes. Furthermore, various methods are discussed, which are helpful in assessing genotoxicity in tissues of organisms exposed in the laboratory and in populations taken from contaminated sites. 69 (Key words: ecogenotoxicology, molecular phylogeny,amphipoda) BOW PO/base indexing: EUOSHA - OSH: Genetic toxicology (26601D), Environmental pollution (05481D), Measurement and assessment (12561D) CIS: Ecogenetics (Wopg), Ecotoxicology (Sepe), Crustacea (Fidu),Water pollution (Bubue), Sampling and analysis (Qe) Reviewed and accepted: 20/02/2006 by Giovanni Alfredo Zapponi; 17/03/2006 by Laura Mancini - National Institute of Health (ISS)

2 INTRODUCTION 70 The development of Community and national norms on the subject of water protection, geared initially towards the protection of drinking water, bathing water and of the consumption of edible aquatic organisms, is currently geared towards an approach of integrated protection, taking into account the necessity to safeguard the entire aquatic ecosystem. In fact, defence of the whole hydric environment from pollution caused by the introduction of dangerous substances from specific and widespread sources is necessary in order to ensure the protection of human health (e.g. from risks deriving from the transfer of contaminants through processes of bioaccumulation and biomagnification). Criteria for toxicity and ecotoxicity are therefore extremely useful for defining environmental quality standards that are necessary to achieve a good chemical state in bodies of water 1-2. The usefulness of determined taxa in environmental toxicology is well-documented in scientific literature 3-5. However, ecotoxicology studies are rarely supported by analyses of the genetic structure or the evolutionary history of the taxa under examination.the availability of this information 6-14 turns out to be indispensable when research is being carried out on the effects (e.g. the genotoxic effects) from exposure to particular substances Two Crustaceans belonging to Amphipoda and linked to aquatic environments were chosen for this study, as potential candidates for ecogenotoxicological assessment (direct, indirect and long-term effects) both for water and for sediments in toto.analyses were carried out on the talitrid, Orchestia garbinii (Fig. 1), a semiterrestrial species found along the banks of lakes and rivers in Europe, and the gammarid, Gammarus aequicauda (Fig. 2), found in salt water and the lagoon systems of the Mediterranean. Figure 1 - Orchestia garbinii (Crustacea,Amphipoda,Talitridae): adult male, 20 mm Figure 2 - Gammarus aequicauda (Crustacea,Amphipoda, Gammaridae): adult male, 15 mm In this paper, we present phylogenetic results on those crustaceans with the focus on gene sequences of mitochondrial DNA (mtdna). We will also discuss various methods that are helpful for evaluating genotoxicity and mutagenesis in tissues of organisms exposed in the laboratory and in populations taken from contaminated sites.

3 1. MATERIALS AND METHODS The sampling sites of O. garbinii were: Lake Garda (Verona ) and Lake Bracciano (Rome) (Fig. 3a,b).The samples of G. aequicauda were taken from the following sites: Lake Patria (Caserta); the mouth of the River Ombrone (Grosseto); the mouth of the River Mignone (Viterbo); the mouth of the River Candeloro, Manfredonia (Foggia). Figure 3 - Sampling sites of Orchestia garbinii: (a) Lake Garda and (b) Lake Bracciano Lake Garda (a) 71 Lake Bolsena Lake Vico Lake Bracciano (b)

4 The methods used for amplification by Polymerase Chain Reaction (PCR) and the sequencing of mitochondrial genes of the subunits I and II of the cytochrome oxidase (COI and COII) 23-5 and of 16S ribosomal RNA (16S rrna) are shown in 14, Homologous sequences of the mtdna of talitrids 14 (one sequence is deposited in GenBank, NCBI, with access number AY555730), of gammarids 28,29 and of other Crustacea (extracted from GenBank) were used to carry out phylogenetic analyses by the Neighbour- Joining and Maximum Parsimony methods 14. Molecular phylogenetic inferences were carried out by using nucleotidic sequences (examining both transitions and transversions) and the deduced amino acid sequences (with Poisson correction) 14. From 500 to 0 bootstrap replications were calculated for each phylogenetic reconstruction RESULTS 72 Mitochondrial regions encoding protein and ribosomal RNA of O. garbinii and of G. aequicauda were amplified through the PCR method and then sequenced.the alignments with homologous sequences of Crustacea generally resulted as unambiguous.the gene trna LeuUUR was found between the genes for the subunits I and II of the cytochrome oxidase (COI and COII) in G. aequicauda, while COI-NC-COII 14 rearrangement was found in O. garbinii. Inferences on the evolutionary relationships of O. garbinii and G. aequicauda (potential candidates for ecogenotoxicological assessment for water as well as for sediments) were obtained through phylogenetic reconstruction using mitochondrial sequences. Figs. 4 and 5 show some results of a phylogenetic analysis of the two Amphipods examined and of other Crustacea, based on sequences of nucleotides and amino acids encoded by the COI and COII genes. Fig. 6 shows a phylogenetic study of O. garbinii and G. aequicauda based on nucleotide sequences of ribosomal RNA of the large subunit (16S rrna). Figure 4 - Molecular phylogeny of O. garbinii, talitrids and other Crustacea (sequences extracted from GenBank) obtained through (a) Neighbour-Joining on 121 amino acids (Poisson correction) encoded by a region of the COI gene and (b) Maximum Parsimony (consensus tree) on 367 nucleotides of the COI gene Panulirus japonicus Pagurus longicarpus Penaeus monodon Orchestia gammarellus (I. Cumbrae) Orchestia gammarellus (I.Wight) Orchestia mediterranea (I.Wight) Talorchestia deshayesii (I.Wight) Talitrus saltator (I.Wight) Talitrus ssltator (I. Cumbrae) Orchestia stephenseni Orchestia garbinii (L. Garda) Orchestia garbinii (L. Bracciano) Parhjale hawaiiensis Triops cancriformis Daphnia pulex Artemia francescana Tigriopus japonicus Hyalidae Talitridae Talitroidea 0,05 (a)

5 66 Triops cancriformis Daphnia pulex Artemia francescana Panulirus japonicus Penaeus monodon Pagurus longicarpus Parhyale hawaiiensis Hyalidae Orchestia garbinii (L. Garda) Orchestia garbinii (L. Bracciano) Orchestia gammarellus (I. Cumbrae) Orchestia gammarellus (I.Wight) Orchestia mediterranea (I.Wight) Orchestia stephenseni (AY555730) Talitrus saltator (I.Wight) Talitrus saltator (I. Cumbrae) Talorchestia deshayesii (I.Wight) Talitridae Talitroidea (b) Figure 5 - Molecular phylogeny of O. garbinii, of G. aequicauda and other Crustacea (sequences extracted from Genbank) obtained through Maximum Parsimony (consensus tree) on 114 amino acids encoded by regions of the COI and COII genes Daphnia pulex Triops cancriformis Pagurus longicarpus Penaeus monodon Gammarus aequicauda (Mignone) Gammarus aequicauda (L. Patria) Gammarus aequicauda (Ombrone) Gammarus aequicauda (Candeloro) Parhyale hawaiiensis Hyalidae Orchestia garbinii (L. Bracciano) Orchestia garbinii (L. Garda) Talitrus saltator (I.Wight) Talitrus saltator (I. Cumbrae) Talorchestia deshayesii (I.Wight) Orchestia gammarellus (I.Wight) Orchestia gammarellus (I. Cumbrae) Orchestia mediterranea (I.Wight) Gammaridae Talitridae Talitroidea 73 Figure 6 - Molecular phylogeny of O. garbinii, of G. aequicauda and of other Crustacea (sequences extracted from GenBank) obtained through Maximum Parsimony (consensus tree) on 246 nucleotides of the 16S rrna gene (500 bootstrap replications) Pagurus longicarpus Penaeus monodon Gammarus locusta Gammarus aequicauda (Black Sea) Gammarus aequicauda (L. Patria) Gammarus aequicauda (Mignone) Gammarus balcanicus Gammarus fasciatus Gammarus mucronatus Gammarus annulatus Gammarus oceanicus Gammarus elvirae Gammarus lacustris (L. Hovsgol) Chaetogammarus marinus Orchestia garbinii (L. Garda) Orchestia garbinii (L. Bracciano) Orchestia cavimana (AY744911) Parhyale hawaiiensis Hyalidae Gammaridae Talitridae Talitroidea

6 3. DISCUSSION 74 Many human activities (in the industrial, urban, agricultural sectors, etc.) have caused an increase in the environmental concentration of particular pollutants including heavy metals, mutagenic substances, etc.the negative effects (direct and indirect) of xenobiotic agents can be significant in natural populations 12-30, with a potential risk of exposure and repercussions on human health 31. In recent years, many research projects have focussed attention on the identification of species that are useful in ecogenotoxicological assessments on different types of matrices. However, the lack of phylogenetic analyses of the taxa under examination may entail a margin of error in the interpretation of the research results, e.g. environmental-genotoxicological 16,17,21,22. Low levels of genetic divergence found among the populations of O. garbinii validate this organism as a suitable subject for ecotoxicological investigation on various geographical scales It should be noted that our research group is involved in further molecular studies to examine populations of O. garbinii and G. aequicauda sampled in other geographical areas, analysing especially the control region of mtdna which generally presents hypervariable portions 36 and non-coding mitochondrial segments 14,37,38. Furthermore, studies into genotoxicology 39 and mutagenesis (Fig. 7) are underway on organisms exposed in the laboratory. Figure 7 - Nucleotidic mutation in the COI gene highlighted by sequencing of mtdna. (Davolos, study pending).the chromatograms are visualized with Chromas software version

7 4. CONCLUSIONS Due to their biological characteristics and the ease with which they may be grown in the laboratory 22,40, the O. garbinii and G. aequicauda species analyzed here are particularly suited to experiments on genotoxicological exposures. In literature, we can find various molecular protocols that are used to assess the levels of genotoxicity 18,31,41. Among these, the electrophoretic analysis of DNA samples in agarose gel is useful for the identification and quantification of the kind of damage caused at DNA level 39, In addition, using in vivo and in vitro methods followed in DNA sequencing analysis, it is possible to identify any nucleotidic mutations induced 21,22,45. Nevertheless, the information on the genetic structure of the populations examined is absolutely necessary for the interpretation of the results of environmental-genotoxicological studies REFERENCES 1. Italia. Decreto Legislativo 11 maggio 1999, n. 152.Testo aggiornato del decreto legislativo 11 maggio 1999, n. 152, recante: Disposizioni sulla tutela delle acque dall inquinamento e recepimento della direttiva 91/271/CEE concernente il trattamento delle acque reflue urbane e della direttiva 91/676/CEE relativa alla protezione delle acque dall inquinamento provocato dai nitrati provenienti da fonti agricole, a seguito delle disposizioni correttive ed integrative di cui al decreto legislativo18 agosto 2000, n Gazzetta Ufficiale n. 246, Supplemento Ordinario n. 172, 20 ottobre Unione Europea. Direttiva 2000/60/CE del Parlamento Europeo e del Consiglio del 23 ottobre 2000 che istituisce un quadro per l azione comunitaria in materia di acque. Gazzetta ufficiale delle Comunità europee L327/1-72, 22 dicembre Schulz R. Using a freshwater amphipod in situ bioassay as a sensitive tool to detect pesticide effects in the field. Environ Toxicol Chem 2003;22: Schill RO, Kohler HR. Does the environment or the source of the population define stress status and energy supply in the freshwater amphipod Gammarus fossarum? Ecotoxicology 2004;13: Borgmann U, Couillard Y, Doyle P, Dixon DG.Toxicity of sixty-three metals and metalloids to Hyalella azteca at two levels of water hardness. Environ Toxicol Chem 2005;24: Meyran JC, Monnerot M,Taberlet P.Taxonomic status and phylogenetic relationships of some species of the genus Gammarus (Amphipoda) from mtdna sequences. Mol Phylogenet Evol 1997;8: Meyran JC, Gielly L,Taberlet P. Environmental Ca and mtdna polymorphism among populations of Gammarus fossarum (Amphipoda). Mol Ecol 1998;7: Meyran JC, Taberlet P. mtdna polymorphism among alpine populations of Gammarus lacustris (Amphipoda). Freshw Biol 1998;39: Müller J. Mitochondrial DNA variation and the evolutionary history of cryptic Gammarus fossarum types. Mol Phylogenet Evol 2000;15: De Matthaeis E, Davolos D, Cobolli M Genetic divergence between populations and species of talitrids from Aegean islands. J Hered 2000;89: De Matthaeis E, Davolos D, Cobolli M, Ketmaier V. Isolation by distance in equilibrium and non equilibrium populations of four talitrid amphipod species in the Mediterranean sea. Evolution 2000;54: Davolos D, Ketmaier V, Cobolli M, De Matthaeis E. Struttura genetica e livelli di differenziamento tra popolazioni e specie di Orchestia (Amphipoda, Talitridae) del Mediterraneo. Biogeographia 2002;23:

8 Iannilli V, Ketmaier V, Ruffo S, De Matthaeis E. Multidisciplinary approach to the systematics of the Italian freshwater Gammarus (Amphipoda). In: Proceedings of the 4th European Crustacean Conference. Lodz (Poland); Abstracts, p Davolos D, Maclean N. Mitochondrial COI-NC-COII sequences of talitrid amphipods (Crustacea). Heredity 2005;94: Hogg ID, Larose C, de Lafontaine Y, Doe KG. Genetic evidence for a Hyalella species complex within the Great Lakes - St. Lawrence River drainage basin: implications for ecotoxicology and conservation biology. Can J Zool 1998;76: Stanton JL, Schizas NV, Chandler GT, Coull BC, Quattro JM. Ecotoxicology and population genetics: the emergence of phylogepgraphic and evolutionary ecotoxicology. Ecotoxicology 2001;10: Theodorakis CW. Integration of genotoxic and population genetic endpoints in biomonitoring and risk assessment. Ecotoxicology 2001;10: Perkins EJ, Lotufo GR. Playing in the mud-using gene expression to assess contaminant effects on sediment dwelling invertebrates. Ecotoxicology 2003;12: Whitehead A, Anderson SL, Kuivila KM, Roach JL, May B. Genetic variation among interconnected populations of Catostomus occidentalis: implications for distinguishing impacts of contaminants from biogeographical structuring. Mol Ecol 2003;12: Snape JR, Maund SJ, Pickford DB, Hutchinson TH. Ecotoxicogenomics: the challenge of integrating genomics into aquatic and terrestrial ecotoxicology.aquat Toxicol 2004;67: Davolos D, Pietrangeli B, Maclean N. Mitochondrial DNA sequence analysis and molecular phylogeny of Orchestia cavimana (Crustacea) in freshwater genotoxicological studies. In: Proceedings of the 34th Annual Meeting of the European Environmental Mutagen society (EEMS 2004). Maastricht, the Netherlands: University of Maastricht; 2004.Abstracts PW Davolos D, Maclean N, Pietrangeli B. A molecular phylogenetic study of the freshwater Orchestia cavimana (Crustacea). Riv Biol 2004;97: Capaldi RA.The complexity of a respiratory complex. Nature Struct Biol 1996;3: Saraste M. Oxidative Phosphorylation at the fin de siècle. Science 1999;283: Tsukihara T,Aoyama H,Yamashita E,Tomizaki T,Yamaguchi H, Shinzawa-Itoh, et al. Structures of metal sites of oxidized bovine heart cytochrome c oxidase at 2.8 Å. Science 1995;269: Davolos D, Maclean N. Evolutionary relationships among supralittoral talitrid amphipods (Crustacea) inferred from mitochondrial sequence analysis. In: Proceedings of the XXI Giornata dell Ambiente. Aree costiere. Roma, Italy:Accademia Nazionale dei Lincei. [2004];205: Müller JC, Schramm S, Seitz A. Genetic and morphological differentiation of Dikerogammarus invaders and their invasion history in Central Europe. Fresh Biol 2002;47: Macdonald KS III,Yampolsky L Duffy JE. Molecular and morphological evolution of the amphipod radiation of Lake Baikal. Mol Phylogenet Evol 2005;35: Iannilli V, De Matthaeis E. Genetic divergence within Gammarus aequicauda (Martynov, 1931) based on 16S mitochondrial DNA. In: Proceedings of The Sixth International Crustacean Congress. Glasgow, Scotland UK: University of Glasgow; Wurgler FE, Kramers PG. Environmental effects of genotoxins (eco-genotoxicology). Mutagenesis 1992;7: Jha AN. Genotoxicological studies in aquatic organisms: an overview. Mutat Res 2004;552: Sato H, Aoki Y. Mutagenesis by environmental pollutants and bio-monitoring of environmental mutagens. Curr Drug Metab 2002;3:311-9.

9 33. De Matthaeis E, Ketmaier V, Latella L, Ruffo S, Scapini F,Tarocco M. Multidisciplinary approach to the study of a terrestrial Amphipod: the case of Orchestia cavimana. In: Proceedings of the IV European Crustacean Conference. Lodz, Poland; Abstracts Ketmaier V,Amendola D, Scapini F, De Matthaeis E. Large scale phylogeography of the landhopper Orchestia cavimana: combining allozymes and mtdna. In: Proceedings of the XIth International Colloquium on Amphipoda.Tunis; Fialkowski W, Rainbow PS, Smith BD, Zmudzinski L. Seasonal variation in trace metal concentrations in three talitrid amphipods from the Gulf of Gdansk, Poland. J Exp Mar Biol Ecol 2003;288: Chu KH, Li CP,Tam YK, Lavery S.Application of mitochondrial control region in population genetic studies of the shrimp Penaeus. Mol Ecol Notes 2003;3: Davolos D, Iannilli V, De Matthaeis E.Analysis on the mitochondrial region between the COI and COII genes in Crustacea. In: Proceedings of The Sixth International Crustacean Congress. Glasgow, Scotland UK: University of Glasgow; Davolos D, Iannilli V, De Matthaeis E. Molecular analysis on the mitochondrial COI-tRNALeuUUR- COII region in Gammarus aequicauda (Amphipoda, Gammaridae). In: Proceedings of the First Congress of Italian Evolutionary Biologists. Ferrara, Italy: University of Ferrara; Setini A, Iannilli V. DNA strand breakage come biomarker di esposizione ai metalli. In: Proceedings of the 66th Annual Congress of the U.Z.I Sept Roma, Italy: Hecker A, Quennedey B,Testeniere O, Quennedey A, Graf F, Luquet G. Orchestin, a calcium-binding phosphoprotein, is a matrix component of two successive transitory calcified biomineralizations elaborated by a terrestrial crustacean. J Struct Biol 2004;146: Lee RF, Steinert S. Use of the single cell gel electrophoresis/comet assay for detecting DNA damage in aquatic (marine and freshwater) animals. Mutat Res 2003;544: Costa FO, Neuparth T, Costa MH,Theodorakis CW, Shugart LR. Detection of DNA strand breakage in a marine amphipod by agarose gel electrophoresis: exposure to X-rays and copper. Biomarkers 2002;7: Dixon DR, Pruski AM, Dixon LR, Jha AN. Marine invertebrate eco-genotoxicology: a methodological overview. Mutagenesis 2002;17: Park S, Imlay JA. High levels of intracellular cysteine promote oxidative DNA damage by driving the fenton reaction. J Bacteriol 2003;185: Braman J (ed.). In Vitro Mutagenesis Protocols. 2nd Edn.Totowa NJ: Humana Press;

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

PRACTICAL APPROACH TO ECOTOXICOGENOMICS

PRACTICAL APPROACH TO ECOTOXICOGENOMICS ANNOUNCEMENT PRACTICAL APPROACH TO ECOTOXICOGENOMICS Advanced Workshop Studies in Biology and Applied Biosciences Department of Biology University of Aveiro, 30 April- 4 May 2007 This one-week post-graduate

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

La Carta di Roma sul Capitale Naturale e Culturale

La Carta di Roma sul Capitale Naturale e Culturale La Carta di Roma sul Capitale Naturale e Culturale Premessa Il semestre italiano di presidenza dell Unione Europea Giugno-Dicembre 2014 ha dato particolare rilievo alla biodiversità, nel quadro degli obblighi

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516

BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516 BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516 1. Mission, Aims and Objectives The new BSc (Hons)/ MSc course is a

More information

BARCODING LIFE, ILLUSTRATED

BARCODING LIFE, ILLUSTRATED BARCODING LIFE, ILLUSTRATED Goals, Rationale, Results Barcoding is a standardized approach to identifying animals and plants by minimal sequences of DNA. 1. Why barcode animal and plant species? By harnessing

More information

COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS

COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS OVERVIEW In the online activity Biodiversity and Evolutionary Trees: An Activity on Biological Classification, you generated

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

Bioprospecting. for. Microalgae

Bioprospecting. for. Microalgae Microalgae for Bioprospecting Dr. J. Polle Department of Biology Brooklyn College of CUNY 2900 Bedford Ave, 200NE Brooklyn, NY 11220 jpolle@brooklyn.cuny.edu http://www.dunaliella.org Presentation Outline

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

The politics of water management: bathing waters in Italy

The politics of water management: bathing waters in Italy The politics of water management: bathing waters in Italy Anna Trono University of the Salento, Italy 1. Introduction As stated in European Union Directive 2006/7/EC, concerning the management of water

More information

Robert G. Young & Sarah Adamowicz University of Guelph Cathryn Abbott & Tom Therriault Department of Fisheries and Oceans

Robert G. Young & Sarah Adamowicz University of Guelph Cathryn Abbott & Tom Therriault Department of Fisheries and Oceans Evaluating Canadian zooplankton biodiversity through DNA barcodes: assessing non-indigenous species presence to provide a framework for future monitoring Robert G. Young & Sarah Adamowicz University of

More information

Environmental Applied Science and Management PhD / MASc

Environmental Applied Science and Management PhD / MASc Environmental Applied Science and Management PhD / MASc www.ryerson.ca/graduate Ryerson University, 350 Victoria Street Toronto, ON M5B 2K3 Canada September 2010 (70716) Environmental Applied Science and

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Classification of Carcinogens: Aspects of the Mode of Action for genotoxic substances

Classification of Carcinogens: Aspects of the Mode of Action for genotoxic substances Classification of Carcinogens: Aspects of the Mode of Action for genotoxic substances Günter Speit Universität t Ulm Institut für f r Humangenetik D-89069 Ulm (Germany) Genotoxic carcinogens are mutagenic

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

New environmental biomarkers. Mari Murtomaa Centre for Arctic medicine / Thule Institute University of Oulu

New environmental biomarkers. Mari Murtomaa Centre for Arctic medicine / Thule Institute University of Oulu New environmental biomarkers Mari Murtomaa Centre for Arctic medicine / Thule Institute University of Oulu New environmental biomarkers Biomarkers theory and practice Case study: Old sawmill area contaminated

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Bio EOC Topics for Ecology, Evolution and Natural Selection:

Bio EOC Topics for Ecology, Evolution and Natural Selection: Bio EOC Topics for Ecology, Evolution and Natural Selection: UEvolutionU Difference between macroevolution and microevolution Sexual reproduction and natural selection are mechanisms of microevolution

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Biology Institute: 7 PhD programs Expertise in all areas of biological sciences

Biology Institute: 7 PhD programs Expertise in all areas of biological sciences Biology Institute: 7 PhD programs Expertise in all areas of biological sciences!" #$%&'()*" '+**$,%' Biology Institute: PhD programs Programs Website: http://www.ib.unicamp.br/pos About the Biology Institute

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF

Total Test Questions: 71 Levels: Grades 10-12 Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

National policy for the flood risk management plans (FD implementation)

National policy for the flood risk management plans (FD implementation) National policy for the flood risk management plans (FD implementation) Giuseppina Monacelli, Barbara Lastoria ISPRA Italian National Institute for Environmental Protection and Research ISPRA: Italian

More information

Introduction to protection goals, ecosystem services and roles of risk management and risk assessment. Lorraine Maltby

Introduction to protection goals, ecosystem services and roles of risk management and risk assessment. Lorraine Maltby Introduction to protection goals, ecosystem services and roles of risk management and risk assessment. Lorraine Maltby Problem formulation Risk assessment Risk management Robust and efficient environmental

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Influential passengers:

Influential passengers: Influential passengers: monitoring invasive species through High Throughput DNA Sequencing during EXPO2015 Maurizio Casiraghi ZooPlantLab, The research topics in the scientific area are committed to the

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

Keystone Biology Exam Information: Module A: Cell and Cell Processes

Keystone Biology Exam Information: Module A: Cell and Cell Processes Keystone Biology Exam Information: Module A: Cell and Cell Processes Basic Biological Principles- Day 1 Describe the characteristics of life shared by prokaryotic and eukaryotic organisms. Compare cellular

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

MASTER OF SCIENCE IN BIOLOGY

MASTER OF SCIENCE IN BIOLOGY MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate

More information

DNA Barcoding in Plants: Biodiversity Identification and Discovery

DNA Barcoding in Plants: Biodiversity Identification and Discovery DNA Barcoding in Plants: Biodiversity Identification and Discovery University of Sao Paulo December 2009 W. John Kress Department of Botany National Museum of Natural History Smithsonian Institution New

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

IMPURITIES IN NEW DRUG PRODUCTS

IMPURITIES IN NEW DRUG PRODUCTS INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE IMPURITIES IN NEW DRUG PRODUCTS Q3B(R2) Current

More information

GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS

GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS -ii- GUIDELINES ON THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Monitoring Genetic and Metabolic Potential for In Situ Bioremediation: Mass Spectrometry. Progress Report

Monitoring Genetic and Metabolic Potential for In Situ Bioremediation: Mass Spectrometry. Progress Report Monitoring Genetic and Metabolic Potential for In Situ Bioremediation: Mass Spectrometry September 1997 Progress Report Principal Investigator Michelle V. Buchanan (423) 574-4868 (Phone) (423) 576-8559

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Revealing the costs of air pollution from industrial facilities in Europe a summary for policymakers

Revealing the costs of air pollution from industrial facilities in Europe a summary for policymakers Revealing the costs of air pollution from industrial facilities in Europe a summary for policymakers A new European Environment Agency (EEA report, Revealing the costs of air pollution from industrial

More information

Organophosphate Pesticides as Pollutants of Urban Lakes and Streams

Organophosphate Pesticides as Pollutants of Urban Lakes and Streams Organophosphate Pesticides as Pollutants of Urban Lakes and Streams Anne Jones-Lee, PhD & G. Fred Lee, PhD, PE, DEE G. Fred Lee & Associates, El Macero, California Presented at North American Lake Management

More information

Introductory Biotechnology for High School Teachers - UNC-Wilmington

Introductory Biotechnology for High School Teachers - UNC-Wilmington Workshop Dates: June 20-24, 2011 Introductory Biotechnology for High School Teachers - UNC-Wilmington Participants will learn basic scientific concepts and techniques in biotechnology, as well as how to

More information

Common Course Topics Biology 1406: Cell and Molecular Biology

Common Course Topics Biology 1406: Cell and Molecular Biology Common Course Topics Biology 1406: Cell and Molecular Biology 1. Introduction to biology --the scientific study of organisms --properties of life --assumptions, methods and limitations of science --underlying

More information

Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1

Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood

More information

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 seema@iasri.res.in Genomics A genome is an organism s

More information

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation

Name Class Date. KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. frameshift mutation Unit 7 Study Guide Section 8.7: Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype. VOCABULARY mutation point mutation frameshift mutation mutagen MAIN IDEA: Some mutations

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Code of Conduct and Best Practice for Access and Benefit Sharing

Code of Conduct and Best Practice for Access and Benefit Sharing Code of Conduct and Best Practice for Access and Benefit Sharing Contents Introduction... 1 CETAF Code of Conduct on Access and Benefit sharing... 3 Annex 1: Statement of Use of Biological Material...

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Sediment and Dredged Material Management - Relevance and Objectives 18 September 2003

Sediment and Dredged Material Management - Relevance and Objectives 18 September 2003 - Relevance and Objectives 1. Scope of the Dutch German Exchange (DGE) The Netherlands and Germany have large river systems such as Danube, Rhine, Meuse, Elbe, Weser and Ems, which have important hydrological

More information

Lab 2 - Illustrating Evolutionary Relationships Between Organisms: Emperor Penguins and Phylogenetic Trees

Lab 2 - Illustrating Evolutionary Relationships Between Organisms: Emperor Penguins and Phylogenetic Trees Biology 18 Spring 2008 Lab 2 - Illustrating Evolutionary Relationships Between Organisms: Emperor Penguins and Phylogenetic Trees Pre-Lab Reference Reading: Review pp. 542-556 and pp. 722-737 in Life by

More information

Common Course Topics Biology 1414: Introduction to Biotechnology I

Common Course Topics Biology 1414: Introduction to Biotechnology I Common Course Topics Biology 1414: Introduction to Biotechnology I Assumptions Students may be enrolled in this course for several reasons; they are enrolled in the Biotechnology Program, they need a science

More information

Unit 1 - Fundamental Biology Skills and Knowledge

Unit 1 - Fundamental Biology Skills and Knowledge PREP TM AP* Biology Prep Course Syllabus Foundational Topics Review 10 units that cover fundamental biology topics typically covered in a general biology course. This content is perfect to use as a summer

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES

PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Certification in Secondary Education in Biology Villanova University

Certification in Secondary Education in Biology Villanova University Certification in Secondary Education in Biology Villanova University I. Knowing the Content The professional education program provides evidence that Biology certification candidates complete a program

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

OECD FELLOWSHIP SUMMARY REPORT

OECD FELLOWSHIP SUMMARY REPORT OECD FELLOWSHIP SUMMARY REPORT Name: Rolf Altenburger Subject: Status and research need in toxicogenomic mixture toxicity analysis Host Institution: University of Queensland, Brisbane, QLD Host Supervisor:

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Overview on EFSA data requirements for the safety evaluation of food enzymes applications

Overview on EFSA data requirements for the safety evaluation of food enzymes applications Overview on EFSA data requirements for the safety evaluation of food enzymes applications Fidel Toldrá and Klaus-Dieter Jany EFSA CEF Panel Info session on Food Enzymes applications Parma, 27 May 2014

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information

Biology. University of Wisconsin-Green Bay 1

Biology. University of Wisconsin-Green Bay 1 University of Wisconsin-Green Bay 1 Biology Disciplinary Major or Minor (http://catalog.uwgb.edu/undergraduate/planning/disciplinary-majors-minors) (Bachelor of Science) Biology is one of UW-Green Bay's

More information

Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined

Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,

More information

MCAS Biology. Review Packet

MCAS Biology. Review Packet MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative

The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information