Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl Acyl Carrier Protein Reductase*

Size: px
Start display at page:

Download "Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl Acyl Carrier Protein Reductase*"

Transcription

1 THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 15, Issue of April 12, pp , by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Structural Elucidation of the Specificity of the Antibacterial Agent Triclosan for Malarial Enoyl Acyl Carrier Protein Reductase* Received for publication, December 17, 2001 Published, JBC Papers in Press, January 15, 2002, DOI /jbc.M Remo Perozzo, Mack Kuo, Amar bir Singh Sidhu, Jacob T. Valiyaveettil, Robert Bittman, William R. Jacobs, Jr. **, David A. Fidock, and James C. Sacchettini From the Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas , the Department of Microbiology and Immunology and the **Howard Hughes Medical Institute, Albert Einstein College of Medicine, The Bronx, New York 10461, and the Department of Chemistry and Biochemistry, Queens College of The City University of New York, Flushing, New York The human malaria parasite Plasmodium falciparum synthesizes fatty acids using a type II pathway that is absent in humans. The final step in fatty acid elongation is catalyzed by enoyl acyl carrier protein reductase, a validated antimicrobial drug target. Here, we report the cloning and expression of the P. falciparum enoyl acyl carrier protein reductase gene, which encodes a 50-kDa protein (PfENR) predicted to target to the unique parasite apicoplast. Purified PfENR was crystallized, and its structure resolved as a binary complex with NADH, a ternary complex with triclosan and NAD, and as ternary complexes bound to the triclosan analogs 1 and 2 with NADH. Novel structural features were identified in the PfENR binding loop region that most closely resembled bacterial homologs; elsewhere the protein was similar to ENR from the plant Brassica napus (root mean square for C s, 0.30 Å). Triclosan and its analogs 1 and 2 killed multidrug-resistant strains of intra-erythrocytic P. falciparum parasites at sub to low micromolar concentrations in vitro. These data define the structural basis of triclosan binding to PfENR and will facilitate structure-based optimization of PfENR inhibitors. * This work was supported by awards from the NIAID (National Institutes of Health Grant AI 43268) and the Robert A. Welch Foundation (to J. C. S.) and the Howard Hughes Medical Institute-Research Resources Program for Medical Schools (to D. A. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Current address: Dept. of Applied Biosciences, Swiss Federal Institute of Technology (ETH), Zurich CH-8057, Switzerland. To whom correspondence should be addressed. Tel.: ; Fax: ; Treatment of Plasmodium falciparum malaria has depended for decades on the use of the aminoquinoline chloroquine or the synergistic antifolate combination pyrimethamine-sulfadoxine. These drugs were characterized by their potency against the P. falciparum asexual intra-erythrocytic stages (responsible for malaria pathogenesis), their affordability and their safety. The occurrence and spread of drug-resistant strains of P. falciparum have largely contributed to a recent resurgence of malaria, which claims 1 to 3 million lives annually and which is endemic in inter-tropical areas representing 40% of the world s population (1). The current situation of antimalarial chemotherapy and resistance, in conjunction with the reappearance of malaria in formerly well-controlled areas, reinforces the need for new, highly potent antimalarials. Recent investigations into Apicomplexan parasites, including Plasmodium and Toxoplasma, have uncovered the existence of a unique organelle, the apicoplast (2 4). The finding that ciprofloxacin-mediated inhibition of plastid replication in Toxoplasma gondii tachyzoites blocked parasite propagation provided evidence for the indispensable nature of this nonphotosynthetic plastid organelle (5). Studies of plastid inhibitors and apicoplast mis-segregation mutants confirmed the essential requirement of this organelle for normal parasite development and indicated that inhibition of apicoplast function or loss of this organelle resulted in parasite death following reinvasion of host cells (5 7). This organelle appears to derive ultimately from a cyanobacterial endosymbiont (4, 8, 9) and as such was postulated to contain prokaryotic-type metabolic pathways, of significant interest from the perspective of developing antiparasitic drugs (10). Recent studies indicate that these pathways include fatty acid and isoprenoid biosynthesis (11, 12). Proteins involved in these pathways are often the products of nuclear genes that encode N-terminal signal and transit peptide sequences for apicoplast localization (12 14). Fatty acids play a critical role in providing metabolic precursors of biological membranes and represent an important form of metabolic energy, making their biosynthetic pathway an excellent target for antimicrobial agents. In higher eukaryotes and yeast the biosynthetic enzymes are integrated into large multifunctional single polypeptides, commonly referred to as type I fatty acid synthases (FAS-I). 1 The FAS-I system utilizes acetyl CoA for iterative 2-carbon elongation of fatty acids. In contrast to the large eukaryotic FAS-I enzyme, plants and most prokaryotes perform the same enzymatic steps using separate, discrete enzymes. This system is referred to as type II fatty acid synthase (FAS-II) (15 18). The first evidence in favor of a FAS-II pathway in malaria parasites (see Scheme 1) came from the work of Waller et al. (12). These investigators reported the presence of nuclear genes encoding the FAS-II proteins acyl carrier protein (ACP), and FabZ ( -hydroxyacyl-acp dehydratase) in Toxoplasma gondii and ACP, FabH ( -ketoacyl- ACP synthase III), and FabF ( -ketoacyl-acp synthase II) in P. falciparum and provided evidence for their targeting to the apicoplast (12, 14). Recent in vitro studies confirm that P. falciparum actively synthesizes fatty acids, predominantly C10 to C14 (19). Inhibition of fatty acid biosynthesis has been repeatedly validated as an appropriate target for antimicrobials. Specific inhibitors of the FAS-II pathway include triclosan and thiolactomycin. Triclosan, a specific inhibitor of FAS-II trans-2-enoyl- 1 The abbreviations used are: FAS-I, type I fatty acid synthase; FAS- II, type II fatty acid synthase; ACP, acyl carrier protein; ENR, enoyl acyl carrier protein reductase; MES, 2-(N-morpholino)ethanesulfonic acid; PfENR, the translation product of the pfenr gene. This paper is available on line at

2 Enoyl-ACP Reductase of P. falciparum mg/kg given to mice that already had a parasitemia of 13 27%. Liver and kidney function tests were normal even at this highest dose, indicating that the further development of triclosan and its analogs may result in pharmacologically suitable compounds for use in humans. In this report, we present the cloning of the pfenr gene and the three-dimensional structure of its translation product, PfENR, bound to triclosan and analogs that show biological activity. These data provide a framework for understanding the inhibitory mechanisms of fatty acid biosynthesis of P. falciparum and a model for undertaking structure-based drug development of selective FAS-II antimalarials. SCHEME 1. Enzymes of fatty acid elongation in E. coli. There are four reactions in each cycle of fatty acid elongation. The first reaction is initiated by -ketoacyl-acp synthase III, which condenses malonyl- ACP with acetyl-coa. Reduction of the resulting -ketoester is accomplished by -ketoacyl-acp reductase. The third reaction is catalyzed by -hydroxyacyl-acp dehydratase. The final reaction is catalyzed by a single NADH-dependent enoyl-acp reductase that converts trans-2- enoyl-acp to acyl-acp. The malonyl-acp used by the condensing enzymes arises from the transacylation of malonyl-coa to ACP catalyzed by malonyl-coa:acp transacylase. Malonyl-CoA is synthesized by acetyl-coa carboxylase (not shown). All GenBank TM accession numbers for the corresponding enzymes of P. falciparum are shown in parentheses. ACP reductase (ENR, also known as inha or FabI) is effective against a broad spectrum of bacteria (20), including Escherichia coli (21, 22), mycobacteria (23), and multidrug-resistant Staphylococcus aureus (24, 25) and is widely used as an antimicrobial in household formulations, including soaps and toothpaste. Recently, triclosan was found to inhibit P. falciparum growth with an IC 50 of 1 M (19, 26). This compares with a reported IC 50 against P. falciparum of about 50 M for thiolactomycin, which inhibits the condensing enzymes FabB, FabF, and FabH in plants and bacteria (Ref. 12 and references therein). In vivo efficacy studies using Plasmodium berghei in mice showed that subcutaneous administration of 3 mg/kg triclosan for 4 days resulted in 75% reduction in parasitemia (19). Full parasite clearance was achieved with a single injection of EXPERIMENTAL PROCEDURES pfenr Sequence Identification and Cloning Overlapping pfenr sequences were PCR-amplified from a P. falciparum (3D7 strain) gametocyte cdna psport plasmid library (kindly provided by Dr. Thomas Templeton, Weill Medical College of Cornell University, New York) using vector-specific primers (M13/pUC forward and reverse) combined with the following pfenr primers: 5 -TTTATTGCTGGTATAGGAGATA- CAAAT and 5 -ATTTGTATCTCCTATACCAGCAATAAA, 5 -TGGCCT- CCTGTTTATAATATTTTT and 5 -AAAAATATTATAAACAGGAGGC- CA, 5 -GAAGAAACGAAAAATAATAAAAGATATAAT and 5 -ATATCT- TTTATTATTTTTCGTTTCTTC, 5 -CCAGGCTATGGTGGAGGTATG and 5 -CATACCTCCACCATAGCCTGG, 5 -GATTATGCAATAGAGTA- TTCA and 5 -CATATTATTTAAGTGTTTCAT. PCR conditions were: 1 (94 C for 2 min); 35 (94 C for 20 s, 48 C for 10 s, 52 C for 10 s, and 60 C for 2 min). Amplified PCR fragments were isolated and directly sequenced using internal primers. Full-length pfenr gene was amplified using primers W1 (5 -AACGT- CCCATGGATAAAATATCACAACGGTTATTATTCCTCTTTCTACAT) and W2 (5 -ATATGGATCCTCATTCATTTTCATTGCGATATATATCA- TCTGGTAAAAACAT), which contain NcoI and BamHI sites, respectively (underlined). Four silent mutations (shown in lowercase letters) were introduced with mutagenic primers M1 (5 -GAgAAGGAAGAgAAgAAgAATTCAGCTAGCCAAAATTATACATTTATAGATTAT and M2 (5 -GAATTcTTcTTcTCTTCCTTcTCACCTGAATTGTTCATAATATTA- TGAACATC) using a two-step megaprimer PCR method (27, 28). In the first step, the cdna library was used as a template to amplify both a 5 fragment with the primers W1 and M2 and a 3 fragment with the primers M1 and W2. Both reactions used the PCR conditions: 1 (94 C for 2 min); 30 (94 C for 20 s, 53 C for 40 s, and 60 C for 3 min). For the second step, both fragments were gel-purified and combined in a PCR reaction with primers W1 and W2, yielding the full-length pfenr. After restriction digestion, the gene was ligated into the pet28a vector (Novagen) and transfected into E. coli (NovaBlue, Novagen). A construct containing the four silent mutations was identified and verified by restriction digestion, PCR, and automated sequencing with internal primers. This construct harboring the stabilized pfenr gene was used as a template to prepare a N-terminal and C-terminal truncated version, using expression primers E1 (5 -ACGTCCCATGGTGCATCATCATCA- TCATCATAATGAAGATATTTGTTTTATTGCTGGTATAGG) and E2 (5 -ATATGGATCCTCAATCATCTGGTAAAAACATTATATTTAATCC- GTTATCCACATATATTGTCTG) (NcoI and BamHI sites underlined) and the PCR conditions described above. This truncated gene was ligated into pet28a, and its sequence was verified. Recently, the full-length pfenr gene sequence also appeared in the P. falciparum genome data base as sequence from the P. falciparum blob chromosomes that comigrate on pulse-field gels. This has been confirmed independently by two other publications (19, 26). When compared with these recently published sequences, our data from multiple independent PCR products show a Gln at position 35 instead of His, and an Asn instead of a Tyr at position 88 of the complete amino acid sequence. Both changes occur at the N terminus of the enzyme in a region that is structurally distant to the site of enzymatic function. PfENR Expression and Purification BL21(DE3) Codon -RIL cells (Novagen) harboring the expression plasmids were grown in Terrific broth. When the A 600 reached 0.8, the cells were induced with 1 mm isopropyl-1-thio- -D-galactopyranoside for 5 h at 37 C. Cell pellets were resuspended in buffer A (20 mm Tris/HCl, ph 8.0, 500 mm NaCl, 50 mm imidazole) and disrupted using a French press. The filtered supernatant was applied to a metal chelate affinity column loaded with nickel. The column was washed with buffer B (20 mm Tris/HCl, ph 8.0, 500 mm NaCl, 150 mm imidazole) and eluted with buffer C (20 mm Tris/HCl, ph 8.0, 500 mm NaCl, 400 mm imidazole). The protein was

3 13108 Enoyl-ACP Reductase of P. falciparum TABLE I Data collection and refinement statistics Data collection ENR NADH ENR NAD triclosan ENR NADH 1 ENR NADH 2 Maximum resolution (Å) Space group P P P P a b(å) c(å) ( ) Unique reflections R sym (%) a Completeness (%) Redundancy I/ Refinement statistics Resolution range (Å) Number of reflections Number of atoms Protein Water Ligand(s) R cryst (%) b R free (%) c Average B-factors (Å 2 ) Protein (subunit A/B) 32/31 35/36 34/32 35/34 NAD /NADH (subunit 32.3/ / / /26.0 A/B) Inhibitors (subunit A/B) 14.9/ / /21.6 a R sym h i I hi I h / h i I hi, where I hi is the intensity of observation I of reflection h. b R cryst h F obs F calc / F obs, where F obs and F calc are observed and calculated structure factors, respectively. c R free was calculated on 10% of the data omitted at random. TABLE II Observed K m and V max values for ENRs of different organisms using crotonoyl-coa as substrate Organism K m V max concentrated using Centriprep 30 and applied to a Superdex 75 sizeexclusion column equilibrated with buffer D (20 mm Tris/HCl, ph 7.5, 150 mm NaCl). Crystallization and Data Collection Using hanging drop and vapor diffusion methods, PfENR was crystallized as a binary complex with NADH bound to the enzyme and as a ternary complex with NAD and triclosan. The protein in buffer D (20 mg/ml) was incubated with 4 mm NAD and1mm triclosan for the ternary complex and with 4 mm NADH for the binary complex. Two microliters of these mixtures was mixed with 2 l of well solution consisting of 2.35 M (NH 4 ) 2 SO 4 and 100 mm buffer, ph 5.6 (sodium acetate for the ternary, MES for the binary complex) and equilibrated against the reservoir solution at 18 C. The crystals of both complexes were isomorphous, belonged to the space group P (cell dimensions a b Å, c 84.0 Å), and contained a dimer (half of the functional tetramer) in the asymmetric unit. Crystals of ternary complexes with NADH and the triclosan analogs 1 and 2 were prepared by soaking binary ENR NADH crystals. The inhibitors were dissolved in acetonitrile, directly added to the drops containing crystals of binary complexes, and incubated for a week. Diffraction data was collected at room temperature to to 2.50-Å resolution from single crystals using a MacScience DIP2030 image plate detector with double-focusing mirrors coupled to a Rigaku x-ray generator utilizing a copper rotating anode (CuK wavelength 1.54 Å). The data were processed and scaled using DENZO/SCALEPACK (29). Structure Determination and Refinement The structure of the ternary ENR NAD triclosan complex was solved by molecular replacement with AMORE (30) using only protein coordinates of the Brassica napus ENR structure (Protein Data Bank entry 1ENO) as a search M M min 1 P. falciparum a B. napus 178 NA b E. coli S. oleracea a The data for P. falciparum reflect the mean values of two independent experiments. Other data were taken from the literature (42, 60 62). b NA, not available. model. The initial solution was used as a template for the Automated Protein Modeling Server (available at to generate a three-dimensional model of the PfENR sequence. The resulting model was then used to calculate an initial electron density map at 2.43 Å, which showed strong and continuous density for NAD and triclosan. Several rounds of model refinement included the addition of missing amino acids. In a late stage, water was automatically added and the final refinement was carried out without any noncrystallographic symmetry restraints. This yielded a final R work of 17.1% and a value for R free of 21.3%. The first 9 amino acids (including the His 6 -tag) were not resolved, and 40 of the 43 amino acids comprising an insertion next to the binding loop area did not show any density. There were no additional breaks in the main chain, although the density was weak for residues Ile 153 Lys 155 and Glu 179 Asn 183 that form two small loop regions. The average B-value for protein atoms was 36 Å 2. The final model contained a total of 289 amino acids, one NAD molecule, one triclosan molecule, and 57 water molecules in each monomer. PROCHECK analysis showed 90% of all residues in the most favored and 10% in the generously allowed regions of the Ramachandran diagram. Because crystals of the binary complex with NADH were isomorphous to the ternary complex, the protein coordinates of the latter were used to calculate the initial binary complex density maps. The first map calculated at 2.40 Å clearly identified the NADH cofactor with strong and continuous density. Subsequent refinement led to an R work of 17.6% and an R free of 22.4%. Again, no density was observed for the first 9 amino acids and the same 40 amino acids of the binding loop insertion of each monomer, and the same areas for the loops showed weak density. The average B-value for main-chain atom positions of the binary structure was 31 Å 2. The final model contained a total of 289 amino acids, one NADH molecule, and 77 water molecules in each monomer. The ternary structures with bound inhibitors 1 and 2 were solved using the method described above. Initial maps showed strong density for NADH, and additional differences in electron density at the inhibitor binding site. Good density for 1 was only observed in monomer B, whereas 2 showed excellent density in both monomers. The inhibitors were built into the model, and subsequent refinement for 1 led to an R work of 18.7% and an R free of 23.2%, with a total of 289 amino acids, one NADH, and 69 solvent molecules in each monomer and one 1 molecule in subunit B. The ternary structure with bound 2 was refined to an R work of 17.6% and an R free of 22.7%. The model comprised 289 amino acids, one NADH molecule, one 2 molecule, and 64 solvent molecules in each monomer. Both structures lacked density for the initial 9 amino acids and the same residues of the large loop insertion. The density for the two small loops was weak. The average B-values of the main-chain atoms of the ternary ENR NADH 1 and ENR NADH 2 complexes were

4 Enoyl-ACP Reductase of P. falciparum FIG. 1. Predicted amino acid sequence of P. falciparum ENR (Plafal) aligned with sequences of homologous enzymes from Brassica napus (Branap), Escherichia coli (Esccol), and Mycobacterium tuberculosis (Myctub). The degree of sequence identity was 48, 16, and 30%, respectively. Green indicates completely conserved residues, yellow indicates two or more highly conserved residues, and blue indicates at least one similar amino acid residue. The secondary structure of P. falciparum ENR is shown above the sequences. The putative signal sequence cleavage site located between Cys 20 and Phe 21 is marked by the downward arrow (2). The first amino acid (Glu 78 ) of the mature enzyme is marked the double arrow (s). The residues proposed to be catalytically important are indicated by asterisks (*). The 43-amino acid low complexity region is underlined in red. 33 and 34 Å 2, respectively. The statistics for all the structural determinations are presented in Table I. Enzyme Assay All experiments were carried out on a Shimadzu UV-1201 UV-visible spectrophotometer at 25 C in 20 mm Tris/HCl, ph 7.6, 150 mm NaCl. Kinetic parameters were determined spectrophotometrically by following the oxidation of NADH to NAD at 340 nm ( 6.3 mm 1 cm 1 ). K m and V max values for crotonoyl-coa were determined at a fixed and saturating concentration of NADH (200 M) and by varying the substrate concentration (0 500 M). K m and V max values for NADH were determined at variable concentrations of NADH and a fixed and saturating concentration of crotonoyl-coa (500 M). Kinetic parameters were obtained by fitting the initial velocity data to the Michaelis-Menten equation. Inhibition constants were determined under conditions of saturating substrate (500 M crotonoyl-coa, 200 M NADH) and variable inhibitor concentration. Values for K i were determined from the x-intercept of a Dixon plot, assuming uncompetitive inhibition. Mean values of two independent experiments are reported for kinetic parameters and inhibition data. Whole Cell Assay The inhibitory activities of triclosan and its analogs against P. falciparum asexual blood stages were determined using a 72-h in vitro assay that measures decreases in [ 3 H]hypoxanthine uptake as a marker of growth inhibition (31, 32). Synthesis of Inhibitors 1 and 2 Compound 1, N-(2,4-dichlorophenyl)-2 -hydroxyaniline, was prepared with a 61% overall yield by the (DPPF)PdCl 2 (DPPF, 1,1 -bisdiphenylphosphino)ferrocene-catalyzed amination of 2,4-dichlorobromobenzene with o-anisidine in the presence of sodium tert-butoxide (33), followed by demethylation of the resulting aryl methyl ether with boron tribromide in dichloromethane at low temperature. Compound 2, 4-chloro-2-hydroxyphenyl 6 -hydroxynaphthyl ether, was synthesized with a 46% overall yield by copper-catalyzed coupling of 2-bromo-4-methoxynaphthalene with 4-chloro-2-methoxyphenol using cesium carbonate as a base and 1-naphthoic acid as an additive to increase the efficiency of the coupling of the less soluble phenoxide (34), followed by demethylation of the resulting aryl methyl ether. RESULTS AND DISCUSSION Identification, Cloning, and Expression of PfENR Fulllength P. falciparum ENR was cloned using PCR primers designed on the basis of sequence alignments of reported microbial and plant ENRs as well as contig data from the P. falciparum genome project. Primers were chosen to conserved regions and were used in combination with vector-specific primers to PCR amplify overlapping fragments of the pfenr gene from a P. falciparum gametocyte stage cdna library. This yielded a single-exon open reading frame of 1299 bp with an A/T content of 72.0%. The predicted start codon was preceded by stop codons in all three reading frames located in a 0.5-kb 5 -untranslated region with an increased A/T content of 85.0%. A stretch of 10 contiguous adenosines turned out to be particularly vulnerable for deletion mutations and was associated with minimal expression of full-length or truncated PfENR. Four silent mutations were introduced in this region, and the resulting construct was stable in E. coli and was used as a template for all further PCR reactions and expression studies. To increase protein yield and facilitate the crystallization process, the PfENR protein was expressed without the N-terminal signal and translocation peptide and the following 18 residues, as well as the C-terminal 7 amino acids, which were predicted to extend into solvent and potentially interfere with crystallization but not contribute to enzyme function. When BL21(DE3) Codon -RIL cells (Novagen) were used for expression, the purification typically resulted in mg of truncated PfENR per liter of media. The K m and V max values of the truncated PfENR (Table II) were indistinguishable from the full-length enzyme carrying silent point mutations. PfENR Sequence Characteristics pfenr encoded a predicted

5 13110 Enoyl-ACP Reductase of P. falciparum FIG.2.Tertiary structure of PfENR. a, representation of subunit B of the PfENR tetramer with the cofactor NADH and inhibitor triclosan bound to their active sites. Helices are shown in gold, the -strands in green, NADH and triclosan are colored by atom type. The tertiary structure shows the Rossmann fold typical of dinucleotide-binding enzymes (43). The chain break visible at the top of the inhibitor binding site is due to the PfENR substrate binding loop that was not resolved in the crystal structures. b, front view of the PfENR tetramer, in which each subunit is represented as a differently colored tube. The bound NADH is colored by atom type. Three perpendicular 2-fold symmetry axes intersect in the center, creating a molecule of internal 222 symmetry. protein of 432 amino acids with an expected molecular mass of 49.8 kda. Sequence alignments (Fig. 1) revealed that PfENR showed much greater overall sequence similarity to plant ENRs than to microbial ENRs. Regions of homology with plant enzymes were divided by a 43-amino acid insert (residues ) that was enriched in the polar residues asparagine (30%), lysine (12%), glutamine (9%), and serine (9%). This low complexity insertion was demonstrated to be coding, because it was routinely identified in cdna libraries (generated from oligodt-primed DNase I-treated poly(a) RNA and prepared from either asexual or sexual stage intra-erythrocytic parasites), it did not have typical splice acceptor and donor sequences (35), and it maintained the same A/T content as the other coding regions. Similar insertions have previously been reported in P. falciparum enzymes and are thought to generally have minimal impact on function (36 39). PfENR has a long N-terminal extension (similar in length to plant ENRs) that is characteristic of bipartite N-terminal presequences found in Plasmodium and Toxoplasma parasite proteins targeted to the apicoplast (12, 14). Using prediction programs SIGNALP and PSORT, a putative cleavage site for the signal peptide could be detected between residues Cys 20 and Phe 21 (40, 41). The size of the adjacent apicoplast translocation signal was recently discovered to be 56 amino acids long, with Glu 78 being the first amino acid of the mature enzyme (19). Sequence alignments revealed 33 completely conserved and 44 highly conserved residues in the PfENR sequence when compared with the ENRs of E. coli, B. napus, and Mycobacterium tuberculosis. Mapping of the completely conserved residues onto the three-dimensional structure of PfENR showed Gly 104, Tyr 277, Met 281, Lys 285, Ala 312, and Pro 314 located immediately adjacent to the nicotinamide ring of NADH. These residues are likely to play an important role in substrate recognition and/or the catalytic function of the enzyme. The remaining conserved residues were dispersed throughout the structure, occurring mainly at the interfaces between the subunits of the tetramer (Fig. 2b) or in positions where they were predicted to stabilize the orientation of secondary structure. Prokaryotic FAS-II enoyl reductases catalyze the NADH/ NADPH-dependent reduction of 2-trans-enoyl-ACP by the direct transfer of the 4S hydrogen atom of NADH to the C 3 position of the, -unsaturated thioester, via an intermediate enolate anion. Protonation of C 2, by an as yet unknown group, would lead to the collapse of the enolate intermediate and yield the saturated product. Enoyl reductase activity assays on purified PfENR demonstrated a strict NADH dependence and substrate specificity for short-chain and medium-chain fatty acids, including crotonoyl-coa (C4:1), as well as octenoyl-coa (C8:1) and dodecenoyl-coa (C12:1). Kinetic studies using crotonoyl-coa gave K m and V max values of 48 3 M and 16 2 M min 1, respectively. This observed K m value for PfENR was similar to that measured for the homologous plant enzymes from B. napus and Spinacia oleracea but significantly lower than the K m of 2700 M determined for the E. coli ENR (Table II) (42). Using crotonoyl-coa as substrate, analysis of NADH oxidation gave a K m of 30 3 M and a V max of 77 6 M min 1. The Tertiary Structure of the PfENR Subunit Overall, the structure was reminiscent of the Rossmann fold (43) and was similar to all other structurally defined homologous enzymes. The PfENR subunit comprised a single domain of Å (Fig. 2a). Each subunit was composed of seven -strands ( 1 7) that formed a parallel -sheet and nine helices ( 1 9) that were connected to the -strands by a number of loops of varying length. The parallel -sheet was flanked by helices 1, 2, 4, 5, 6, and 9, with 3 arranged along the top of 2 and 4. Helix 8 was located at the C termini of strands 6 and 7. Comparison of the C positions of the E. coli, M. tuberculosis, and B. napus ENRs showed that the overall structure of all enzymes was very similar (the C root mean square for superimposition of PfENR with ENR from B. napus: 0.30 Å; from E. coli: 0.78 Å; from M. tuberculosis: 0.75 Å; Fig. 3, a, c, and e). Whereas the core region built of the -sheet was nearly identical in all structures, major differences were nevertheless discernible between PfENR and the ENRs of E. coli and M. tuberculosis. The loop regions between 2 3, 3 3 4, and 4 5 of PfENR were longer due to insertions in the sequence, and helix 2 was shifted away from the protein, toward the solvent, relative to the bacterial ENRs. Helix 3, a small helix in the loop region between 3 and 4, was not observed in the microbial structures but was present in the plant ENR. The aforementioned 43-amino acid low complexity insertion in PfENR sequence localized to an important loop region ( 7 and 8), near the catalytic center of the protein. This region is thought to be a determinant in substrate specificity, because it participates in acyl substrate binding, as shown in the M. tuberculosis structure in which the bound fatty acyl substrate was held in place by the substrate binding loop (44). Only 3 amino acids of the low complexity insertion were visible in the electron density maps, indicating that most of this region was disordered even in the presence of bound substrate and inhibitor. Nonetheless, the last visible amino acids just before (Lys 325 ) and after (Tyr 366 ) the low complexity region were in nearly the exact same position as the comparable loop residues in the E. coli enzyme structure (Fig. 3d). For the E. coli ENR, this loop was disordered when NAD was bound, but became ordered upon binding of the inhibitor triclosan (45, 46). In the M. tuberculosis ENR this loop was shifted away in a more open conformation (Fig. 3f), presumably for the binding pocket to accommodate the binding of the longer fatty acid substrates

6 Enoyl-ACP Reductase of P. falciparum FIG. 3.Superimposition of PfENR with homologous enzymes. a, overall structures of PfENR (red) and B. napus ENR (yellow) revealed a major difference occurring in the lid region (magnified view in b), for which the loop of the B. napus enzyme made a turn in the direction opposite to that found in P. falciparum, M. tuberculosis, and E. coli ENRs. c, comparison of PfENR (red) and the E. coli ENR (green) is shown on the left, whereas the lid region has been magnified and is presented in d. Both lid regions adopted very similar orientations and conformations. e, major structural differences were found for the lid region when the ENR of P. falciparum (red) and M. tuberculosis (gold) were superimposed. (C16 C56, precursors of mycolic acid) used by the mycobacterial enzyme. The loop region of B. napus ENR was very different because 6 makes a turn in the opposite direction when compared with all other structures, and connects 6 with 7 of B. napus ENR, resulting in a substrate binding pocket that is more solvent exposed (Fig. 3b). Earlier investigations into E. coli, B. napus, and M. tuberculosis ENRs have found a correlation between the length of the substrate binding loop and the fatty acyl substrate chain length (44). If this held for P. falciparum ENR, one could expect that very long-chain fatty acids would serve as substrate and, by analogy to the M. tuberculosis ENR, the PfENR would not use very short-chain acyl-coas as substrate. However, kinetic studies indicated that the P. falciparum ENR can use crotonoyl-coa (C4:1) (Table II), with kinetics in line with those observed for S. oleracea and B. napus ENRs. The Quaternary Structure of P. falciparum ENR In gel filtration studies, PfENR formed a tetramer in solution (data not shown), in agreement with all other bacterial and plant ENRs reported to date. In support of this, the packing in the crystal showed an obvious homotetramer possessing internal 222 symmetry (Fig. 2b). The estimated dimensions for the tetramer were Å. The solvent-accessible surface areas for the subunits and the tetramer were calculated using DSSP (47) and were determined to be about 15,000 Å 2 for each subunit and 43,000 Å 2 for the tetramer. Approximately 1600 Å 2 (11%) of the surface area of subunit A was buried, making intermolecular contacts with subunit B, 1700 Å 2 (12%) with subunit C, and 900 Å 2 (6%) with subunit D. Thus, the total surface area involved in intermolecular contacts of each subunit was 4200 Å 2 or 29%. This type of organization for PfENR was comparable to the crystal structures elucidated for enoyl- ACP reductases from E. coli (48), B. napus (49), and M. tuberculosis (44). Analysis of the Nucleotide Binding Site Both the ENR NADH binary complex and the ENR NAD /NADH inhibitor ternary complexes showed excellent electron density for the cofactors (Fig. 4a). NAD and NADH were localized to the enzyme in an extended conformation at the C-terminal end of the -sheet with both ribose sugar rings found as C2 -endo conformers and the nicotinamide moiety in the syn conformation (Fig. 4b). The adenine ring was located in a pocket on the surface of the protein, formed by the side chains of Trp 131, Phe 167, Ala 169, Ser 170, Asn 218 and the main chain between residues Phe 167 and Asp 168. Hydrogen bonds were formed between the adenine nitrogen atoms at position N1 with the peptide nitrogen atom of Ala 169 and at position N6 with the side chain of Asp 168. Both the 2 and 3 adenine ribose hydroxyl groups were hydrogenbonded to the same ordered water molecule, which in turn was hydrogen-bonded with the peptide nitrogen of Trp 131. This mode of hydrogen bonding in P. falciparum was different from many NAD /NADH-linked dehydrogenases for which the common mechanism for cofactor recognition involves hydrogen bonding between an acidic residue and both ribose hydroxyl groups (50). However, the recognition of the adenine ribose hydroxyl groups was similar to that observed in B. napus and E. coli ENRs. In PfENR, the 2 -hydroxyl group of the adenine ribose occupied a small depression flanked by Gly 106, Trp 131 and Val 134, which resulted in a tight fit for the NAD /NADH cofactor. This spatial arrangement leaves no room for the extra phosphate group of NADPH and is consistent with the previous observation that NADH was a much more efficient cofactor than NADPH for PfENR function (19). The pyrophosphate moiety of NAD (NADH) lay close to the C-terminal part of the -sheet and interacted with the glycinerich region of the loop connecting 1 and 1, with 1 being the nucleotide binding helix. Contacts through hydrogen bonds were made by the pyrophosphate oxygen atoms with the peptide nitrogen of Tyr 111 and, mediated by a solvent molecule, with the main-chain carbonyl of Gly 104, the peptide nitrogen of Gly 112 and the side-chain hydroxyl of Ser 215. By way of an additional water molecule, hydrogen bonding also occurred with the peptide nitrogen of Gly 104. The cofactor was bound by this series of hydrogen bonds and was not further supported by positively charged side chains close to the nucleotide binding site. The nicotinamide binding pocket was composed of the side chains of Tyr 111, Leu 265, Tyr 267, Tyr 277, Ala 312, Gly 313, Pro 314, Leu 315, and Ile 369. Both 2 - and 3 -ribose hydroxyl groups hydrogen-bonded to the amino group of the Lys 285, whereas only the 3 -group interacted with a solvent molecule that was contacted by the side chain of His 214. The nicotinamide ring was completely ordered on the enzyme, where it interacted via specific hydrogen bonds formed by the oxygen and nitrogen of the carboxamide moiety and the Leu 315 peptide nitrogen and cofactor pyrophosphate moiety. These interactions appeared to stabilize the packing of the A-face of the nicotinamide ring against the phenolic ring of Tyr 111, exposing the B-face to the active site. Thus, the cofactor adopted the same conformation

7 13112 Enoyl-ACP Reductase of P. falciparum FIG. 4.Structural details of the substrate/inhibitor binding site. a, stereo view of the 2F o F c electron density map contoured at 1 for bound analog 2 and NADH cofactor. Shown are residues 277 and b, stereo view of the three superimposed PfENR inhibitor complexes. Residues involved in the formation of the binding pocket are shown. The most important amino acids for interactions are labeled. Triclosan is shown in red, 1 in blue, and 2 in green. The corresponding cofactor of each inhibitor complex is colored accordingly. Hydrogen bonds with Tyr 277 and the 2 -hydroxyl group of the nicotinamide ribose, as well as three additional hydrogen bonds mediated through the hydroxyl group of the naphthalene ring of 2 are shown as yellow dotted lines. The binding mode of triclosan, 1, and 2 showed the same stacking interactions to the nicotinamide ring of the cofactor with respect to ring A. Inhibitor 2 also exhibited three additional hydrogen bonds mediated through the hydroxyl group of the naphthalene ring that could interact with the side-chain nitrogen of Asn 218 and the main-chain oxygen and nitrogen of Ala 219. for stereospecific hydride transfer via the pro-4s hydrogen of NADH as that observed with E. coli, B. napus, and M. tuberculosis ENRs (44 46, 49, 51 55). The structural characteristics of PfENR cannot account for the recent finding by Surolia and Surolia (19) of a reduced but significant incorporation of [ 14 C]malonyl-CoA in the presence of NADPH in a P. falciparum cell-free fatty acid synthesis system. This raises the question whether there might exist additional, so far not described malonyl-coa- and NADPH-dependent metabolic pathways in P. falciparum. Just recently, the structure of another FAS-II enzyme that uses NADPH has been solved. This -ketoacyl-acp reductase (FabG) structure was reported from B. napus (56), and we have obtained partial sequence for the homologous P. falciparum protein as an initial step toward enzyme characterization. Location of the Fatty Acyl Binding Pocket Earlier structural studies of M. tuberculosis ENR complexed to the C16 fatty acyl substrate analog and NAD revealed that the C16 substrate bound in a U-shaped conformation, with the trans double bond position directly adjacent to the nicotinamide ring of NAD and the side chain of Tyr 277 interacting directly with the C16 substrate thioester carbonyl oxygen (44). The binding crevice for the fatty acyl portion of the substrate was built of hydrophobic residues that were derived primarily from the substrate binding loop. The ENR structures from P. falciparum, B. napus, and E. coli showed a similar patch of predominantly hydrophobic side chains adjacent to the position of the nicotinamide ring and the fatty acid chain binding area. With PfENR, the corresponding amino acids and side chains flanking the putative binding site were Tyr 267, Gly 276, Tyr 277, Met 281, Pro 314, Ala 319, Ala 320, Ala 322, Ile 323, Ile 369, and Ala 372. Most residues were located in helices 7 and 8 and formed a hydrophobic fingershaped cavity with the approximate dimensions of Å. One side of the cavity was accessible to solvent. Based on volumetric measurements of the fatty acyl binding cavity in the PfENR NADH binary complex, there was only enough space to accommodate a substrate of six to eight carbon atoms in length. This implies that there must be sufficient flexibility in the PfENR pocket to bind longer substrates (up to at least C16), which probably occurs via an opening movement of the flexible loop. In view of the present biochemical and structural information, it is possible that the extensive substrate binding loop of Pf ENR, which includes the low complexity region, would allow for broader specificity in the fatty acyl chain. Analysis of the Triclosan Binding Site Three distinct classes of chemically synthesized agents have been shown to act by inhibiting this enzyme in the bacterial FAS-II pathway. Isoniazid targets the ENR homolog, InhA, from M. tuberculosis after activation and covalent attachment to the nicotinamide ring of NADH (57). The mechanism of inhibition of the diazaborines is through a covalent bond between a boron atom in the diazaborine and the 2 -hydroxyl group of the nicotinamide ribose moiety in this enzyme (17, 42, 48). Another extremely potent bacterial ENR inhibitor is triclosan, which, in contrast to the other antimicrobials, forms a non-covalent complex with NAD and protein primarily via hydrogen bonds. The crystal structure of PfENR solved with protein incubated with NAD and triclosan revealed the mode of triclosan binding (Fig. 4b). Comparison of the P. falciparum ENR NAD triclosan structure with the corresponding E. coli and B. napus structures (45, 53) demonstrated that, for the malaria enzyme, the binding mode for triclosan was very similar, showing the same stacking interaction with the nicotinamide ring of NAD and comparable hydrogen-bonding pattern with the 2 -hydroxyl group of the nicotinamide ribose and with Tyr 277. Ring A (the phenol ring) of the inhibitor interacted face-to-face with the nicotinamide ring of NAD allowing -cation interactions. The same ring formed additional van der Waals interactions with the side chains of Tyr 267, Tyr 277, Pro 314, Phe 368, and Ile 369. The phenolic hydroxyl hydrogenbonded to the 2 -hydroxyl moiety of the nicotinamide ribose and the oxygen atom of Tyr 277, and the amino nitrogen of Lys 285 was within 4.6 Å. These residues are completely con-

8 Enoyl-ACP Reductase of P. falciparum served in all known ENRs and have been implicated in the enzyme s catalytic mechanism (49, 58). The 4-chloro atom of ring A was surrounded by mainly hydrophobic residues making van der Waals contacts with the side chains of Tyr 267, Pro 314, and Phe 368. The ether oxygen atom of triclosan interacted with the 2 -hydroxyl group of the nicotinamide ribose, and it approached to within 3.65 Å of one of the oxygen atoms of the nicotinamide ribose phosphate group. Ring B (2,4-dichlorophenoxy ring) of triclosan was located in a pocket bounded by the pyrophosphate and nicotinamide moieties of NAD, by the peptide backbone residues and by the side chains of Asn 218, Val 222, Tyr 277, and Met 281. Although the 4-chloro atom of ring B was placed adjacent to the side chains of Val 222 and Met 281 and residues , the 2-chloro atom was surrounded by the -carbon atom, the side chain of Ala 217, and atoms of the nicotinamide ribose pyrophosphate moiety. One ordered water molecule was observed in the inhibitor binding site of the binary ENR NADH complex, interacting FIG. 5.Structures of triclosan and derivatives tested for inhibitory activity. Biochemical activity assays were performed using purified recombinant PfENR. Out of the presented compounds, only triclosan, 1, and 2 showed significant biochemical inhibition (cut-off 100 M) of purified PfENR. The corresponding K i values for the active compounds are indicated. through hydrogen bonds with the 2 -hydroxyl group of the nicotinamide ribose and with Tyr 277. This water molecule was very close to the position of the phenolic hydroxyl group of the inhibitors and was displaced upon triclosan binding. Superposition of the binary and ternary complex structures revealed subtle conformational changes in the protein upon inhibitor binding, with the most pronounced change being a slight shift of helix 7 by0.5å toward the solvent. The Triclosan Analogs 1 and 2 Recently, the antibacterial activities of several 2-hydroxydiphenylethers as well as hexachlorophene and 2-hydroxydiphenylmethanes were determined (55). Studies with a des-hydroxyl analog of triclosan showed a more than 10,000-fold reduced affinity for E. coli ENR and implicated a critical antibacterial role for the triclosan 2-hydroxy group (55). Moreover, it was proposed that the ether oxygen of triclosan might be critical to the formation of the ternary complex, because corresponding 2-hydroxydiphenylmethanes did not result in tight binding (59), whereas the replacement of the ether oxygen with sulfur abolished the inhibitory activity (21). Ring B of triclosan was considered to be of minor importance, because variations in this region had less effect on inhibitor activity. Synthesis of 20 triclosan analogs (originally designed to target the closely related M. tuberculosis ENR) and subsequent screening against purified PfENR revealed that PfENR inhibition was sensitive to the hydroxyl group at position 2 in ring A, which could not be replaced with methoxy groups or sulfur derivatives, as observed for the bacterial ENRs. These studies led us to identify a diphenylamine derivative (1, Fig. 5) with moderate inhibitory activity (K i M). Bound to PfENR, this inhibitor, which carried nitrogen as a bridging atom, adopted a very similar conformation compared with triclosan (2,4-dichloroaniline ring). The extensive hydrogen bonding network involving the 2-hydroxy group of ring A and the - stacking interaction with the nicotinamide ring system were completely maintained, emphasizing the importance of these interactions (Fig. 4b). Another analog, 2, was found to have a K i of nm against purified PfENR, close to the 50 6nM K i observed with triclosan (Fig. 5). Structural analysis of this 6-hydroxy naphthalene derivative complexed to PfENR in the presence of NADH revealed an electron density that was clearly detectable after the first round of refinement, showing strong and continuous difference density in both monomers of PfENR. Ring A of 2 again stacked to the nicotinamide ring system in the same way as observed for triclosan. The extended ring B of 2 was oriented in the same direction as the corresponding ring in triclosan but was tilted by 10 degrees out of the plane found for ring B of triclosan and 1. This now allowed for three potential new hydrogen bonds mediated through the hydroxyl group of the naphthalene ring, the side-chain nitrogen of Asn 218 and the main-chain oxygen and nitrogen of Ala 219 (Fig. 4, a and b). Reduced affinity of 2 for PfENR may be a result of the missing chlorine in this analog. Because most bacterial ENRs have a Phe at the position comparable to Asn 218 of PfENR, it is likely TABLE III Activities of triclosan and analogs against P. falciparum drug-resistant or drug-sensitive strains Strain Resistant to a Triclosan IC 50 b 1 IC 50 2 IC 50 FCB CQ, QN, CYC Dd2 CQ, QN, PYR, SDX HB D7 SDX a CQ, chloroquine; CYC, cycloguanil; QN, quinine; PYR, pyrimethamine; SDX, sulfadoxine. b IC 50 values (mean S.D.) values are in micromolar and were determined by linear regression analysis of [ 3 H]hypoxanthine uptake curves plotted as a function of compound concentration. All compounds were tested in duplicate on two to five separate occasions. M

9 13114 Enoyl-ACP Reductase of P. falciparum that 2 will be specific for the malarial protein. In Vitro Whole Cell Test Whole cell assays against P. falciparum parasites propagated in human erythrocytes in vitro demonstrated 50% killing at a concentration of M for 1 and M for 2 (Table III). Compound efficacy was similar against drug-sensitive and multidrug-resistant strains. Triclosan proved even more effective with IC 50 values against multiple P. falciparum lines in the M range, values that are consistent with reports from other groups (19, 26). We note that 1 was more effective than 2 in killing P. falciparum asexual blood stages in culture even though the latter displayed a better K i value against purified PfENR. These findings raise the issue of compound solubility and uptake into the parasitized erythrocyte and support the requirement to combine both tests in subsequent studies that aim to define a structure-activity relationship and identify compounds as active as triclosan and more suitable for systemic administration in humans. These data report critical structural information for a new and promising target for the development of novel antimalarial compounds. The elucidation of triclosan interactions with this target, PfENR, and the identification of two triclosan analogs that bind to this enzyme and that are active in vitro against P. falciparum provide the first data on structure-activity relationships of PfENR inhibitors. Further structure-based and medicinal chemistry approaches are warranted to leverage the uniqueness of this enzymatic pathway in malaria parasites as a strategy to counter the spread of lethal, drug-resistant P. falciparum infections. Acknowledgments Preliminary sequence data for the P. falciparum blob chromosomes were obtained from The Sanger Center website at Sequencing of P. falciparum blob chromosomes was accomplished as part of the Malaria Genome Project with support by The Wellcome Trust. Preliminary sequence data for P. falciparum chromosomes 10 and 11 was obtained from The Institute for Genomic Research website at Sequencing of chromosomes 10 and 11 was part of the International Malaria Genome Sequencing Project. REFERENCES 1. WHO (1999) The World Health Report, pp , World Health Organization, Geneva 2. McFadden, G. I., Reith, M. E., Munholland, J., and Lang-Unnasch, N. (1996) Nature 381, Wilson, R. J., Denny, P. W., Preiser, P. R., Rangachari, K., Roberts, K., Roy, A., Whyte, A., Strath, M., Moore, D. J., Moore, P. W., and Williamson, D. H. (1996) J. Mol. Biol. 261, Kohler, S., Delwiche, C. F., Denny, P. W., Tilney, L. G., Webster, P., Wilson, R. J., Palmer, J. D., and Roos, D. S. (1997) Science 275, Fichera, M. E., and Roos, D. S. (1997) Nature 390, Sullivan, M., Li, J., Kumar, S., Rogers, M. J., and McCutchan, T. F. (2000) Mol. Biochem. Parasitol. 109, He, C. Y., Shaw, M. K., Pletcher, C. H., Striepen, B., Tilney, L. G., and Roos, D. S. (2001) EMBO J. 20, Palmer, J. D., and Delwiche, C. F. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, McFadden, G. I., and Waller, R. F. (1997) Bioessays 19, McFadden, G. I., and Roos, D. S. (1999) Trends Microbiol. 7, Jomaa, H., Wiesner, J., Sanderbrand, S., Altincicek, B., Weidemeyer, C., Hintz, M., Turbachova, I., Eberl, M., Zeidler, J., Lichtenthaler, H. K., Soldati, D., and Beck, E. (1999) Science 285, Waller, R. F., Keeling, P. J., Donald, R. G., Striepen, B., Handman, E., Lang- Unnasch, N., Cowman, A. F., Besra, G. S., Roos, D. S., and McFadden, G. I. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, Roos, D. S., Crawford, M. J., Donald, R. G., Kissinger, J. C., Klimczak, L. J., and Striepen, B. (1999) Curr. Opin. Microbiol. 2, Waller, R. F., Reed, M. B., Cowman, A. F., and McFadden, G. I. (2000) EMBO J. 19, Rock, C. O., and Cronan, J. E. (1996) Biochim. Biophys. Acta 1302, Fulco, A. J. (1983) Prog. Lipid Res. 22, Kater, M. M., Koningstein, G. M., Nijkamp, H. J., and Stuitje, A. R. (1994) Plant Mol. Biol. 25, Smith, S. (1994) FASEB J. 8, Surolia, N., and Surolia, A. (2001) Nat. Med. 7, Bhargava, H. N., and Leonard, P. A. (1996) Am. J. Infect. Control 24, Heath, R. J., Yu, Y. T., Shapiro, M. A., Olson, E., and Rock, C. O. (1998) J. Biol. Chem. 273, McMurry, L. M., Oethinger, M., and Levy, S. B. (1998) Nature 394, McMurry, L. M., McDermott, P. F., and Levy, S. B. (1999) Antimicrob. Agents Chemother. 43, Bartzokas, C. A., Paton, J. H., Gibson, M. F., Graham, F., McLoughlin, G. A., and Croton, R. S. (1984) N. Engl. J. Med. 311, Webster, J. (1992) J. Hosp. Infect. 21, McLeod, R., Muench, S. P., Rafferty, J. B., Kyle, D. E., Mui, E. J., Kirisits, M. J., Mack, D. G., Roberts, C. W., Samuel, B. U., Lyons, R. E., Dorris, M., Milhous, W. K., and Rice, D. W. (2001) Int. J. Parasitol. 31, Higuchi, R., Krummel, B., and Saiki, R. K. (1988) Nucleic Acids Res. 16, Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds) (1990) PCR Protocols: A Guide to Methods and Application, pp , Academic Press, San Diego, CA 29. Otwinowski, Z., and Minor, W. (1997) Methods Enzymol. 276, Navaza, J. (1994) Acta Crystallogr. Sect. A 50, Fidock, D. A., Nomura, T., and Wellems, T. E. (1998) Mol. Pharmacol. 54, Desjardins, R. E., Canfield, C. J., Haynes, J. D., and Chulay, J. D. (1979) Antimicrob. Agents Chemother. 16, Driver, M. S., and Hartwig, J. F. (1996) J. Am. Chem. Soc. 118, Marcoux, J. F., Doye, S., and Buchwald, S. L. (1997) J. Am. Chem. Soc. 119, Coppel, R. L., and Black, C. G. (1998) in Malaria: Parasite Biology, Pathogenesis, and Protection (Sherman, I. W., ed) pp , ASM Press, Washington, D. C. 36. Gardner, M. J., Tettelin, H., Carucci, D. J., Cummings, L. M., Aravind, L., Koonin, E. V., Shallom, S., Mason, T., Yu, K., Fujii, C., Pederson, J., Shen, K., Jing, J., Aston, C., Lai, Z., Schwartz, D. C., Pertea, M., Salzberg, S., Zhou, L., Sutton, G. G., Clayton, R., White, O., Smith, H. O., Fraser, C. M., and Hoffman, S. L. (1998) Science 282, Kappes, B., Yang, J., Suetterlin, B. W., Rathgeb-Szabo, K., Lindt, M. J., and Franklin, R. M. (1995) Mol. Biochem. Parasitol. 72, Farber, P. M., Becker, K., Muller, S., Schirmer, R. H., and Franklin, R. M. (1996) Eur. J. Biochem. 239, Gilberger, T. W., Schirmer, R. H., Walter, R. D., and Muller, S. (2000) Mol. Biochem. Parasitol. 107, Claros, M. G., Brunak, S., and von Heijne, G. (1997) Curr. Opin. Struct. Biol. 7, Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. (1997) Protein Eng. 10, Bergler, H., Wallner, P., Ebeling, A., Leitinger, B., Fuchsbichler, S., Aschauer, H., Kollenz, G., Hogenauer, G., and Turnowsky, F. (1994) J. Biol. Chem. 269, Rossmann, M. G., Moras, D., and Olsen, K. W. (1974) Nature 250, Rozwarski, D. A., Vilcheze, C., Sugantino, M., Bittman, R., and Sacchettini, J. C. (1999) J. Biol. Chem. 274, Roujeinikova, A., Levy, C. W., Rowsell, S., Sedelnikova, S., Baker, P. J., Minshull, C. A., Mistry, A., Colls, J. G., Camble, R., Stuitje, A. R., Slabas, A. R., Rafferty, J. B., Pauptit, R. A., Viner, R., and Rice, D. W. (1999) J. Mol. Biol. 294, Qiu, X., Janson, C. A., Court, R. I., Smyth, M. G., Payne, D. J., and Abdel- Meguid, S. S. (1999) Protein Sci. 8, Kabsch, W., and Sander, C. (1983) Biopolymers 22, Baldock, C., Rafferty, J. B., Sedelnikova, S. E., Baker, P. J., Stuitje, A. R., Slabas, A. R., Hawkes, T. R., and Rice, D. W. (1996) Science 274, Rafferty, J. B., Simon, J. W., Baldock, C., Artymiuk, P. J., Baker, P. J., Stuitje, A. R., Slabas, A. R., and Rice, D. W. (1995) Structure 3, Wierenga, R. K., De Maeyer, M. C. H., and Hol, W. G. J. (1985) Biochemistry 24, Baldock, C., Rafferty, J. B., Stuitje, A. R., Slabas, A. R., and Rice, D. W. (1998) J. Mol. Biol. 284, Dessen, A., Quemard, A., Blanchard, J. S., Jacobs, W. R., Jr., and Sacchettini, J. C. (1995) Science 267, Stewart, M. J., Parikh, S., Xiao, G., Tonge, P. J., and Kisker, C. (1999) J. Mol. Biol. 290, Roujeinikova, A., Sedelnikova, S., de Boer, G. J., Stuitje, A. R., Slabas, A. R., Rafferty, J. B., and Rice, D. W. (1999) J. Biol. Chem. 274, Ward, W. H., Holdgate, G. A., Rowsell, S., McLean, E. G., Pauptit, R. A., Clayton, E., Nichols, W. W., Colls, J. G., Minshull, C. A., Jude, D. A., Mistry, A., Timms, D., Camble, R., Hales, N. J., Britton, C. J., and Taylor, I. W. (1999) Biochemistry 38, Fisher, M., Kroon, J. T., Martindale, W., Stuitje, A. R., Slabas, A. R., and Rafferty, J. B. (2000) Struct. Fold. Des. 8, Rozwarski, D. A., Grant, G. A., Barton, D. H. R., Jacobs, W. R., Jr., and Sacchettini, J. C. (1998) Science 279, Parikh, S., Moynihan, D. P., Xiao, G., and Tonge, P. J. (1999) Biochemistry 38, Heath, R. J., Li, J., Roland, G. E., and Rock, C. O. (2000) J. Biol. Chem. 275, Bernstein, N. K., Cherney, M. M., Loetscher, H., Ridley, R. G., and James, M. N. (1999) Nat. Struct. Biol. 6, Slabas, A. R., Sidebottom, C. M., Hellyer, A., Kessel, R. M. J., and Tombs, M. P. (1986) Biochim. Biophys. Acta 877, Shimakata, T., and Stumpf, P. K. (1982) Arch. Biochem. Biophys. 218, 77 91

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys

A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys Questions- Proteins & Enzymes A. A peptide with 12 amino acids has the following amino acid composition: 2 Met, 1 Tyr, 1 Trp, 2 Glu, 1 Lys, 1 Arg, 1 Thr, 1 Asn, 1 Ile, 1 Cys Reaction of the intact peptide

More information

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal

More information

(c) How would your answers to problem (a) change if the molecular weight of the protein was 100,000 Dalton?

(c) How would your answers to problem (a) change if the molecular weight of the protein was 100,000 Dalton? Problem 1. (12 points total, 4 points each) The molecular weight of an unspecified protein, at physiological conditions, is 70,000 Dalton, as determined by sedimentation equilibrium measurements and by

More information

The peptide bond is rigid and planar

The peptide bond is rigid and planar Level Description Bonds Primary Sequence of amino acids in proteins Covalent (peptide bonds) Secondary Structural motifs in proteins: α- helix and β-sheet Hydrogen bonds (between NH and CO groups in backbone)

More information

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group. Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are

More information

Protein Physics. A. V. Finkelstein & O. B. Ptitsyn LECTURE 1

Protein Physics. A. V. Finkelstein & O. B. Ptitsyn LECTURE 1 Protein Physics A. V. Finkelstein & O. B. Ptitsyn LECTURE 1 PROTEINS Functions in a Cell MOLECULAR MACHINES BUILDING BLOCKS of a CELL ARMS of a CELL ENZYMES - enzymatic catalysis of biochemical reactions

More information

Myoglobin and Hemoglobin

Myoglobin and Hemoglobin Myoglobin and Hemoglobin Myoglobin and hemoglobin are hemeproteins whose physiological importance is principally related to their ability to bind molecular oxygen. Myoglobin (Mb) The oxygen storage protein

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

NAME. EXAM I I. / 36 September 25, 2000 Biochemistry I II. / 26 BICH421/621 III. / 38 TOTAL /100

NAME. EXAM I I. / 36 September 25, 2000 Biochemistry I II. / 26 BICH421/621 III. / 38 TOTAL /100 EXAM I I. / 6 September 25, 2000 Biochemistry I II. / 26 BIH421/621 III. / 8 TOTAL /100 I. MULTIPLE HOIE (6 points) hoose the BEST answer to the question by circling the appropriate letter. 1. An amino

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Solution key Problem Set 1

Solution key Problem Set 1 Solution key-7.016 Problem Set 1 Question 1 The following line-angle drawings represent three chemical structures. On each drawing, the hydrogen atoms that should be bonded to the NON-carbon atoms are

More information

Biochemistry 2000 Sample Question Proteins. (1) Identify the secondary structure described in each of the following statements:

Biochemistry 2000 Sample Question Proteins. (1) Identify the secondary structure described in each of the following statements: (1) Identify the secondary structure described in each of the following statements: a. A coiled peptide chain held in place by hydrogen bonding between peptide bonds in the same chain b. A structure that

More information

Peptide bonds: resonance structure. Properties of proteins: Peptide bonds and side chains. Dihedral angles. Peptide bond. Protein physics, Lecture 5

Peptide bonds: resonance structure. Properties of proteins: Peptide bonds and side chains. Dihedral angles. Peptide bond. Protein physics, Lecture 5 Protein physics, Lecture 5 Peptide bonds: resonance structure Properties of proteins: Peptide bonds and side chains Proteins are linear polymers However, the peptide binds and side chains restrict conformational

More information

Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell

Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php

More information

Molecules of Life. Chapter 3 Part 2

Molecules of Life. Chapter 3 Part 2 Molecules of Life Chapter 3 Part 2 3.5 Proteins Diversity in Structure and Function Proteins are the most diverse biological molecule (structural, nutritious, enzyme, transport, communication, and defense

More information

Chapter 2 - Chemical Foundations

Chapter 2 - Chemical Foundations Chapter 2 - Chemical Foundations I. Introduction By weight, cells are about 70% water, about 1% ions, about 6% small organic molecules (including amino acids, sugars, nucleotides), and about 23% macromolecules.

More information

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose 1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

Introduction to Proteins; Amino Acids, the Building Blocks of Proteins

Introduction to Proteins; Amino Acids, the Building Blocks of Proteins Introduction to Proteins; Amino Acids, the Building Blocks of Proteins Reading: Berg, Tymoczko & Stryer: Chapter 2, pp. 25-34 Appendix to Chapter 2, pp. 60-61 (visualizing protein structures) Review General

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Biochemistry 462a Hemoglobin Structure and Function Reading - Chapter 7 Practice problems - Chapter 7: 1-6; Proteins extra problems

Biochemistry 462a Hemoglobin Structure and Function Reading - Chapter 7 Practice problems - Chapter 7: 1-6; Proteins extra problems Biochemistry 462a Hemoglobin Structure and Function Reading - Chapter 7 Practice problems - Chapter 7: 1-6; Proteins extra problems Myoglobin and Hemoglobin Oxygen is required for oxidative metabolism

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES

CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

WEEK ONE VOCABULARY. Adhesion- the attraction between water molecules and other molecules

WEEK ONE VOCABULARY. Adhesion- the attraction between water molecules and other molecules WEEK ONE VOCABULARY Acid- hydrogen donors; acids increase the hydrogen ion concentration in solution Adhesion- the attraction between water molecules and other molecules Alpha (α) helix- secondary protein

More information

Copyright 2000-2003 Mark Brandt, Ph.D. 54

Copyright 2000-2003 Mark Brandt, Ph.D. 54 Pyruvate Oxidation Overview of pyruvate metabolism Pyruvate can be produced in a variety of ways. It is an end product of glycolysis, and can be derived from lactate taken up from the environment (or,

More information

Solutions for Biochemistry Unit Exam

Solutions for Biochemistry Unit Exam Solutions for Biochemistry Unit Exam Question 1 a) An example of a structural representation is shown in the adjacent box. Draw a structural representation of the amino acid, Aspartic acid, which has the

More information

MBLG1001 Lecture 8 page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Lecture 8

MBLG1001 Lecture 8 page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Lecture 8 MBLG1001 Lecture 8 page 1 University of Sydney Library Electronic Item CURSE: MBLG1001 Lecturer: Dale ancock Lecture 8 CMMNWEALT F AUSTRALIA Copyright Regulation WARNING This material has been reproduced

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Paper: 6 Chemistry 2.130 University I Chemistry: Models Page: 2 of 7. 4. Which of the following weak acids would make the best buffer at ph = 5.0?

Paper: 6 Chemistry 2.130 University I Chemistry: Models Page: 2 of 7. 4. Which of the following weak acids would make the best buffer at ph = 5.0? Paper: 6 Chemistry 2.130 University I Chemistry: Models Page: 2 of 7 4. Which of the following weak acids would make the best buffer at ph = 5.0? A) Acetic acid (Ka = 1.74 x 10-5 ) B) H 2 PO - 4 (Ka =

More information

8/20/2012 H C OH H R. Proteins

8/20/2012 H C OH H R. Proteins Proteins Rubisco monomer = amino acids 20 different amino acids polymer = polypeptide protein can be one or more polypeptide chains folded & bonded together large & complex 3-D shape hemoglobin Amino acids

More information

Lecture 15: Enzymes & Kinetics Mechanisms

Lecture 15: Enzymes & Kinetics Mechanisms ROLE OF THE TRANSITION STATE Lecture 15: Enzymes & Kinetics Mechanisms Consider the reaction: H-O-H + Cl - H-O δ- H Cl δ- HO - + H-Cl Reactants Transition state Products Margaret A. Daugherty Fall 2004

More information

Carbohydrates, proteins and lipids

Carbohydrates, proteins and lipids Carbohydrates, proteins and lipids Chapter 3 MACROMOLECULES Macromolecules: polymers with molecular weights >1,000 Functional groups THE FOUR MACROMOLECULES IN LIFE Molecules in living organisms: proteins,

More information

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma

More information

Lecture 3. The Ribosome, rrna and mrna. Major players in protein synthesis: mrna, trna and the ribosome

Lecture 3. The Ribosome, rrna and mrna. Major players in protein synthesis: mrna, trna and the ribosome The Ribosome, rrna and mrna (3.1) Lecture 3 The Ribosome, rrna and mrna Major players in protein synthesis: mrna, trna and the ribosome mrna trna Ribosome Protein Messenger RNA, a copy of DNA blueprint

More information

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10 CSC 2427: Algorithms for Molecular Biology Spring 2006 Lecture 16 March 10 Lecturer: Michael Brudno Scribe: Jim Huang 16.1 Overview of proteins Proteins are long chains of amino acids (AA) which are produced

More information

Papers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function

Papers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function Papers listed: Cell2 During the semester I will speak of information from several papers. For many of them you will not be required to read these papers, however, you can do so for the fun of it (and it

More information

Helices From Readily in Biological Structures

Helices From Readily in Biological Structures The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

MBLG1001_lecture 4 Page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Forming the Protein

MBLG1001_lecture 4 Page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Forming the Protein MBLG1001_lecture 4 Page 1 University of Sydney Library Electronic Item URSE: MBLG1001 Lecturer: Dale ancock Forming the Protein MMWEALT F AUSTRALIA opyright Regulation WARIG This material has been reproduced

More information

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things.

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Computat onal Biology Lecture 1 Life In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Both are composed of the same atoms and

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

Unit 1: Chemistry of Life Guided Reading Questions (70 pts total)

Unit 1: Chemistry of Life Guided Reading Questions (70 pts total) AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Unit 1: Chemistry of Life Guided Reading Questions (70 pts total) Chapter

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

2.1 Nucleic acids the molecules of life

2.1 Nucleic acids the molecules of life 1 2.1 Nucleic acids the molecules of life Nucleic acids information molecules of the cells form new cells stored in chromosomes in nucleus of the cell in the form of a code in DNA / parts of the code are

More information

This class deals with the fundamental structural features of proteins, which one can understand from the structure of amino acids, and how they are

This class deals with the fundamental structural features of proteins, which one can understand from the structure of amino acids, and how they are This class deals with the fundamental structural features of proteins, which one can understand from the structure of amino acids, and how they are put together. 1 A more detailed view of a single protein

More information

Briefly explain biosynthesis of cell constituents (requires energy)

Briefly explain biosynthesis of cell constituents (requires energy) 3 Cell Metabolism Chapter 3 Cell Metabolism - review Student Learning Outcomes: Describe central role of enzymes as catalysts Vast array of chemical reactions Many enzymes are proteins Role of NAD + /NADH

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Refinement of a pdb-structure and Convert

Refinement of a pdb-structure and Convert Refinement of a pdb-structure and Convert A. Search for a pdb with the closest sequence to your protein of interest. B. Choose the most suitable entry (or several entries). C. Convert and resolve errors

More information

Combinatorial Biochemistry and Phage Display

Combinatorial Biochemistry and Phage Display Combinatorial Biochemistry and Phage Display Prof. Valery A. Petrenko Director - Valery Petrenko Instructors Galina Kouzmitcheva and I-Hsuan Chen Auburn 2006, Spring semester COMBINATORIAL BIOCHEMISTRY

More information

Fatty Acid Biosynthesis

Fatty Acid Biosynthesis Synthesis takes place in the cytosol Intermediates covalently linked to acyl carrier protein Activation of each acetyl CoA. acetyl CoA + CO 2 Malonyl CoA Four-step repeating cycle, extension by 2-carbons

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

ENZYMES. Serine Proteases Chymotrypsin, Trypsin, Elastase, Subtisisin. Principle of Enzyme Catalysis

ENZYMES. Serine Proteases Chymotrypsin, Trypsin, Elastase, Subtisisin. Principle of Enzyme Catalysis ENZYMES Serine Proteases Chymotrypsin, Trypsin, Elastase, Subtisisin Principle of Enzyme Catalysis Linus Pauling (1946) formulated the first basic principle of enzyme catalysis Enzyme increase the rate

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

JBS FUNDAMENT Thermofluor Screen

JBS FUNDAMENT Thermofluor Screen Cat. No. CS-330 Amount 1 Kit For in vitro use only. Quality guaranteed for 3 months. Store at 4 C. Application Screen for thermal stability of proteins as a function of the FUNDAMENTAL variables ph and

More information

ENZYME MECHANISM C H A P T E R 7

ENZYME MECHANISM C H A P T E R 7 C H A P T E R 7 ENZYME MECHANISM Active Site Transition State Catalysis Lock and Key Induced Fit Nonproductive Binding Entropy Strain and Distortion Transition-State Stabilization Transition-State Analogs

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport.

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport. 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism s cells. As a basis for understanding this concept: 1.

More information

A) at equilibrium B) endergonic C) endothermic D) exergonic E) exothermic

A) at equilibrium B) endergonic C) endothermic D) exergonic E) exothermic CHEM 2770: Elements of Biochemistry Mid Term EXAMINATION VERSION B Date: October 29, 2014 Instructor: H. Perreault Location: 172 Schultz Time: 4 or 6 pm. Duration: 1 hour Instructions Please mark the Answer

More information

Introduction to Proteins and Enzymes

Introduction to Proteins and Enzymes Introduction to Proteins and Enzymes Basics of protein structure and composition The life of a protein Enzymes Theory of enzyme function Not all enzymes are proteins / not all proteins are enzymes Enzyme

More information

1. In most animal cells, a complex network of proteins provides which of the following?

1. In most animal cells, a complex network of proteins provides which of the following? Organic Molecules and Water 1. In most animal cells, a complex network of proteins provides which of the following? A. organization B. shape C. movement D. all of these 2. Technology Enhanced Questions

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Chemical Basis of Life Module A Anchor 2

Chemical Basis of Life Module A Anchor 2 Chemical Basis of Life Module A Anchor 2 Key Concepts: - Water is a polar molecule. Therefore, it is able to form multiple hydrogen bonds, which account for many of its special properties. - Water s polarity

More information

Student Handout 1 A dual coloring scheme allows students to first 3dmoleculardesigns.com Introduction - Page 1

Student Handout 1 A dual coloring scheme allows students to first 3dmoleculardesigns.com Introduction - Page 1 Proteins are large, linear polymers of amino acids that spontaneously fold into complex 3D shapes. Although protein structure appears to be very complex, the chemical properties that determine protein

More information

It s the amino acids!

It s the amino acids! Catalytic Mechanisms HOW do enzymes do their job? Reducing activation energy sure, but HOW does an enzyme catalysis reduce the energy barrier ΔG? Remember: The rate of a chemical reaction of substrate

More information

AP BIOLOGY 2008 SCORING GUIDELINES

AP BIOLOGY 2008 SCORING GUIDELINES AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.

More information

Protein Purification and Analysis

Protein Purification and Analysis Protein Purification and Analysis Numbers of genes: Humans ~40,000 genes Yeast ~6000 genes Bacteria ~3000 genes Solubility of proteins important for purification: 60-80% soluble, 20-40% membrane Some proteins

More information

Free Energy and Enzymes (Chapter 6) Outline. 1. The "extra" electrons have been stripped from other atoms in the cell.

Free Energy and Enzymes (Chapter 6) Outline. 1. The extra electrons have been stripped from other atoms in the cell. Free Energy and Enzymes (Chapter 6) Outline Growing Old With Molecular Mayhem A. Free radicals are molecules with extra electrons. 1. The "extra" electrons have been stripped from other atoms in the cell.

More information

1- Fatty acids are activated to acyl-coas and the acyl group is further transferred to carnitine because:

1- Fatty acids are activated to acyl-coas and the acyl group is further transferred to carnitine because: Section 10 Multiple Choice 1- Fatty acids are activated to acyl-coas and the acyl group is further transferred to carnitine because: A) acyl-carnitines readily cross the mitochondrial inner membrane, but

More information

Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush

Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush α-keratins, bundles of α- helices Contain polypeptide chains organized approximately parallel along a single axis: Consist

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Chemistry 20 Chapters 15 Enzymes

Chemistry 20 Chapters 15 Enzymes Chemistry 20 Chapters 15 Enzymes Enzymes: as a catalyst, an enzyme increases the rate of a reaction by changing the way a reaction takes place, but is itself not changed at the end of the reaction. An

More information

18.2 Protein Structure and Function: An Overview

18.2 Protein Structure and Function: An Overview 18.2 Protein Structure and Function: An Overview Protein: A large biological molecule made of many amino acids linked together through peptide bonds. Alpha-amino acid: Compound with an amino group bonded

More information

Docking of B-cell epitope antigen to specific hepatitis B antibody

Docking of B-cell epitope antigen to specific hepatitis B antibody J. Chem. Sci., Vol. 119, No. 5, September 2007, pp. 553 558. Indian Academy of Sciences. Docking of B-cell epitope antigen to specific hepatitis B antibody R RAJKANNAN 1 and E J PADMA MALAR 2, * 1 Department

More information

Determination of NADH Concentrations with the Synergy 2 Multi-Detection Microplate Reader using Fluorescence or Absorbance

Determination of NADH Concentrations with the Synergy 2 Multi-Detection Microplate Reader using Fluorescence or Absorbance Determination of NADH Concentrations with the Synergy 2 Multi-Detection Microplate Reader using Fluorescence or Absorbance Do you know what your redox state is? Many biological assays have as their basis

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Lesson Overview. Carbon Compounds. Lesson Overview 2.3

Lesson Overview. Carbon Compounds. Lesson Overview 2.3 Lesson Overview 2.3 The Chemistry of Carbon Carbon atoms can form strong covalent bonds with many other elements. Molecules containing carbon are called organic. Living organisms are composed of molecules

More information

1. Enzymes. Biochemical Reactions. Chapter 5: Microbial Metabolism. 1. Enzymes. 2. ATP Production. 3. Autotrophic Processes

1. Enzymes. Biochemical Reactions. Chapter 5: Microbial Metabolism. 1. Enzymes. 2. ATP Production. 3. Autotrophic Processes Chapter 5: Microbial Metabolism 1. Enzymes 2. ATP Production 3. Autotrophic Processes 1. Enzymes Biochemical Reactions All living cells depend on biochemical reactions to maintain homeostasis. All of the

More information

Microreview. Nucleic acid structure

Microreview. Nucleic acid structure Nucleic acid structure Microreview 1 er : sequence of the nucleotides, each distinguished by its base. 2 ary : antiparallel double helix. 3 ary : folding of sequentially remote secondary structure to form

More information

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond 11 Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Structural Components of Nucleotides Base Sugar Phosphate Glycosidic bond H NUCLEOTIDE H 1 RNA DNA Table 3-1 Nucleic acid polymer

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch19_PT MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Enzymes are members of which class of biomolecules? A) carbohydrates B) nucleic acids C)

More information

Chapter 8: Energy and Metabolism

Chapter 8: Energy and Metabolism Chapter 8: Energy and Metabolism 1. Discuss energy conversions and the 1 st and 2 nd law of thermodynamics. Be sure to use the terms work, potential energy, kinetic energy, and entropy. 2. What are Joules

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information