REFERENCE PROTOCOL NAKTUINBOUW

Size: px
Start display at page:

Download "REFERENCE PROTOCOL NAKTUINBOUW"

Transcription

1 REFERENCE PROTOCOL NAKTUINBOUW Real-time RT-PCR (RT TaqMan PCR) for pospiviroids (CEVd, CLVd, MPVd, PCFVd, PSTVd, TASVd, TCDVd and TPMVd) on seeds of pepper (Capsicum annuum) Protocol number: SPN-V044e Version: v1.1 Date: Validation: Under validation This protocol is a translation of the Dutch protocol SPN-V044. In case of discrepancies between the English and Dutch text, the Dutch text prevails. This protocol is made available without any warranty. Naktuinbouw cannot guarantee that the results obtained by laboratories that follow this protocol are accurate and representative. Many factors (e.g. personnel skills, lab conditions, quality of reagents, sampling methods etc.) can influence the results. Consequently, Naktuinbouw will not accept any liability with respect to the use of this protocol.

2 1. Objective To detect the absence or presence of potentially relevant pospiviroidae (CEVd, CLVd, MPVd, PCFVd, PSTVd, TASVd, TCDVd and TPMVd) in pepper seeds by isolation of RNA followed by TaqMan RT PCR. 2. Principle RNA from seed extract of pepper is isolated and purified with a Qiagen RNeasy mini plant kit. The possible presence of viroid RNA is demonstrated by means of RT TaqMan PCR using selective sets of primers and labeled TaqMan probes. Each subsample is spiked with DLVd as an internal amplification control (IAC) to monitor the performance of RNA extraction and RT Taqman PCR. 3. Abbreviations cdna Complementary DNA CEVd Citrus exocortis viroid CLVd Columnea latent viroid Ct-value Cycle threshold value (number of PCR cycli till reaching the threshold) DLVd Dahlia latent viroid (spike viroid) GH+ buffer Guanidine hydrochloride extraction buffer IAC Internal amplification control MPVd Mexican papita viroid NC seed Negative control pepper seeds (process control) PC seed Positive control TASVd contaminated pepper seed lot (process control) PCFVd Pepper chat fruit viroid PSTVd Potato spindle tuber viroid RT Taqman Reverse transcriptase Taqman TASVd Tomato apical stunt viroid TCDVd Tomato chlorotic dwarf viroid TPMVd Tomato planta macho viroid 4. Materials Biorad CFX 96 PCR apparatus DLVd stock GH+ buffer (see appendix) Grinding bags 100 ml (Interscience BagPage) Hard Shell PCR plates (Biorad, Catalog no. HSP9645) Interscience BagMixer 100 Positive RNA controls RNase-free water RNeasy plant mini kit (Qiagen) Taqman RNA-to-Ct 1 step kit (Applied Biosystems, productno / ) Thermoshaker Naktuinbouw 2/9 SPN-V044e v1.1

3 5. Method 5.1 Safety and warnings Disinfection of seeds with hypochlorite and / or trisodium phosphate strongly decreases the sensitivity of this assay. Viroids can be present in very high concentrations in plant tissue and cross-contamination is a possibility. Accuracy of operations is important to reduce the chance of cross-contamination. Wear gloves and use pipets with filter tips at all times. 5.2 Execution Preparation of pepper seed samples 1. Weigh from each sample (3.000 or seeds) 3 subsamples of 1000 or 50 subsamples of 400 seeds and transfer each subsample to a grinding bag (Interscience BagPage 100ml). 2. Calculate the required amount of GH+ extraction buffer based on the total number of subsamples. Dilute the DLVd spike 10x. Add 10 μl diluted DLV spike for each 100 ml GH+ extraction buffer as internal amplification control (IAC). 3. Add to each bag with 1,000 or 400 seeds respectively 20 or 12 ml GH+ extraction buffer including the DLVd IAC. 4. Soak the seeds for minutes at room temperature. 5. Extract the subsamples for 4 minutes using the Interscience BagMixer (position 4). 6. Preheat thermoshaker (setting: 65 C, 850 rpm). 7. Transfer 1.5 ml of seed extract per subsample gently into 1.5 ml tube. 8. Include a TASVd-contaminated subsample (PC pepper seed with a Ct of about 20-23) and a negative control (NC pepper seed with a Ct > 37) per sample series. 9. Incubate in thermoshaker for 15 minutes (setting: 65 C, 850 rpm). 10. Centrifuge the tubes for 10 minutes at 16,000 g. NB. Handle the PC seed as the last subsample in order to minimize the chance of cross-contamination RNA isolation 1. Use RNeasy plant mini kit for the isolation of RNA. 2. Transfer 750 µl supernatant into QIAshredder-spin-column (purple). 3. Centrifuge tubes for 2 minutes at 16,000 g. 4. Store leftover of supernatant at -20 C until the test is completed. 5. Transfer 600 µl supernatant (avoid pellet) to new 1,5 ml tube with 300 µl ethanol (96-100%). 6. Mix well by pipetting up en down. 7. Transfer 700 µl of extract into RNeasy-mini-column (pink). 8. Centrifuge 1 minute at 16,000 g. 9. Transfer filter to new collection tube. 10. Add 700 μl RW1-wash buffer to RNeasy-mini-column. 11. Centrifuge 30 seconds at 16,000 g. 12. Place RNeasy-mini-column in new collection tube. 13. Transfer 500 μl RPE-wash buffer (including ethanol) to RNeasy-mini-column. 14. Centrifuge 30 seconds at g. 15. Transfer filter to new collection tube. 16. Transfer 500 μl RPE-wasbuffer (including ethanol) to RNeasy-mini-column. 17. Centrifuge 2 minutes at 16,000 g to dry RNeasy-silicagel-membrane. 18. Place RNeasy-mini-column in new collection tube. 19. Transfer 75 µl RNase-free water to RNeasy-mini-column. 20. Incubate 1 minute. 21. Centrifuge 1 minute at 8,000 g. 22. Continue directly with PCR or store purified RNA at -20 C Taqman RT-PCR 1. Prepare Taqman RT-PCR mix (Table 4a, 4b, 4c and 4d). NB. Work on ice as much as possible and prevent prolonged exposure of probes to light. Wear clean lab coat and gloves to minimize the risk of cross-contamination. 2. Calculate the required amount of reaction mix based on the number of subsamples & controls Transfer 19 µl mix into a strip of white PCR tubes or PCR plates with white bottom / green border. 4. Pipette 6 µl of the purified RNA sample in 19 µl mix. Naktuinbouw 3/9 SPN-V044e v1.1

4 5. Cover the strip / plate after adding the RNA. 6. In each run, include a no-template control and positive RNA controls (Table 3) giving a Ct value of approximately Run the Taqman RT PCRs according to the following program (Table 5). Table 3. Positive RNA controls per mix Mix Relevant RNA controls A PSTVd, TCDVd, MPVd, PCFVd and DLVd (IAC) B CEVd, CLVd and DLVd (IAC) C TPMVd and Nad5 D TASVd Table 4a. PCR mix PSTVd, TCDVd, MPVd (FAM), PCFVd (VIC) and DLVd (IAC)(Texas red) PCR mix 1 reaction RNase-free water 4,625 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi A primer mix (351a) 0,75 μl 10 µm Pospi A probe mix (351b) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Total 25 μl Table 4b. PCR mix CEVd, CLVd (FAM) and DLVd (IAC)(Texas red) PCR mix 1 reaction RNase-free water 4,625 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi B primer mix (352a) 0,75 μl 10 µm Pospi B probe mix (352b) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Total 25 μl Table 4c. PCR mix TPMVd (FAM) and Nad5 (IAC)(Texas red) PCR mix 1 reaction RNase-free water 4,625 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi C primer mix (353a) 0,75 μl 10 µm Pospi C probe mix (353b) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Total 25 μl Naktuinbouw 4/9 SPN-V044e v1.1

5 Table 4d. PCR mix TASVd (FAM) PCR mix 1 reaction RNase-free water 3,875 μl TaqMan RT-PCR Mix (2x) (Applied biosystems) 12,5 μl 10 µm Pospi TASVd-F2-200 (281a) 0,75 μl 10 µm Pospi TASVd-R2-269 (281b) 0,75 μl 10 µm Pospi TASVd-P2-228 (281c) 0,5 μl TaqMan RT Enzym Mix (40x) (Applied biosystems) 0,625 μl Subtotal 19 μl Sample (RNA) 6 μl Totaal 25 μl Table 5. RT-Taqman program CFX96 (version 2 or higher) for mixes Table 4a, 4b, 4c and 4d temperature time hold 48 C 15' 00" hold 95 C 10' 00" 40 cycli 95 C 0' 15" 60 C 1' 00" 6. Evaluation and interpretation 6.1 Evaluation test result Turn on FAM, VIC and TR signal for all 96 wells. Use single threshold setting (RFU 200). Turn on option "fluorescent drift correction". Check shape of curve (S-shape) for positive samples. Compare, if necessary, with PC seed. Please note that the TPMVd Taqman RT occasionally gives atypical planar curves (no S-shaped curve) that should be considered as noise. In case of doubt always check with responsible person. Monitor the performance of PCs to maintain the reliability of the test list and note the RFU value used per data set. See decision matrix (Table 6a, b, c, and d) for interpretation of the results of samples. Based on the signals in different channels, an indication of the identity of a viroid can be obtained. 6.2 Validity of test result Results may only be issued if the positive controls give a clear signal (Ct seed PC and RNA PC between and 28-32, respectively). Results may only be issued if Ct in the negative control samples > 35. The Ct DLVd must be < 32. For the matrix pepper seeds the Ct values for the Nad5 IAC are less important since the reproducibility is not optimal. Also Nad5 degradation is much faster than viroid degradation and the quantity of Nad5 is variable per seed lot. For a subsample Nad5 Ct > 32 can be acceptable provided that the IAC DLVd is < 32 and the TPMVd PC is clearly positive. Contact the responsible person when the results differ from the expectations. Contact the responsible person when a seed sample is suspect. Naktuinbouw 5/9 SPN-V044e v1.1

6 6.3 Decision matrix (subsample level) Table 6a. Decision matrix PCR mix 4A: PSTVd, TCDVd, MPVd (FAM), PCFVd (VIC) and DLVd (IAC)(TR) Ct FAM Ct VIC Ct TR (IAC) >32 >32 <32 PSTVd, TCDVd, MPVd and PCFVd not detected >32 <32 <32 PSTVd, TCDVd and MPVd not detected PCFVd detected <32 >32 n.a. PSTVd and/or TCDVd and/or MPVd detected* PCFVd not detected <32 <32 n.a. PSTVd and or TCDVd and/or MPVd detected* PCFVd detected >32 >32 >32 Not valid/repeat (check other IACs) *if desired, perform sequence analysis to identify the specific pospiviroid Table 6b. Decision matrix for PCR mix 4B: CEVd, CLVd (FAM) and DLVd (IAC)(TR) Ct FAM Ct TR (IAC) >32 <32 <32 n.a. >32 >32 CEVd and CLVd not detected CEVd and/or CLVd detected Not valid/repeat (check other IACs) Table 6c. Decision matrix for PCR mix 4C: TPMVd (FAM) and Nad5 (TR) Ct FAM Ct TR (IAC) >32 <32 TPMVd not detected <32 n.a. >32 >32 Tabel 6d. Decision matrix for PCR mix 4D: TASVd (FAM) Ct FAM TASVd not detected >32 <32 TPMVd detected Check DLVd IACs (mix A and mix B) since IAC DLVd is more relevant. Check with responsible person. TASVd detected 7. Literature and instructions Literature: Boonham, N., L.. González-Pérez,,M.S. Mendez, E. Lilia Peralta, A. Blockley, K. Walsh, I. Barker & R.A. Mumford (2004) Development of a real-time RT-PCR assay for the detection of Potato spindle tuber viroid. Journal of Virological Methods 116: Botermans, M., van de Vossenberg, B. T. L. H., Verhoeven, J. Th. J.,Roenhorst, J. W., Hooftman, M., Dekter, R. & Meekes, E. T. M. (2013) Development and validation of a real-time RT-PCR assay for generic detection of pospiviroids. J. Virol. Methods 187, Koenraadt, H., Jodlowska, A., van Vliet, A. & Verhoeven, K. (2009) Detection of TCDVd and PSTVd in seeds of tomato. Phytopathology 99, S66. Menzel, W., Jelkmann, W., and Maiss, E. (2002) Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mrna as internal control. J. Virol. Methods 99: Monger, W., Tomlinson, J., Boonham, N., Marn, M.V., Plesko, I.M., Molinero-Demilly,V., Tassus, X., Meekes, E., Toonen, M., Papayiannis, L., Perez-Egusquiza, Z., Mehle, N., Jansen, C., Nielsen, S.L., (2010) Development and interlaboratory evaluation of real-time PCR assays for the detection of pospiviroids. J. Virol. Methods 169, Naktuinbouw 6/9 SPN-V044e v1.1

7 Mumford, R.A., A.L. Skelton, N. Boonham, K.I. Posthuma, M.J. Kirby, & A.N. Adams (2001) The Improved Detection of Strawberry Crinkle Virus Using Real-Time RT-PCR (TaqMan ). Acta Horticulturae 656: Manuals: TaqMan RNA-to-CT 1-Step Kit Protocol RNeasy plant mini kit (Qiagen) 8. History and revisions Version Protocol based on ISO17025 accredited PSTVd/ TCDVd seed assay (SPN-V003, version 3.1) for tomato. Overnight soaking of seeds was reduced to minutes to limit break down of viroid. Introduction of DLVd spike as an internal amplification control (IAC) in multiplex RT Taqman to replace endogenous Nad5 target since amount of Nad5 RNA is highly variable (14-40) in the seed matrix. Use of GH+ extraction buffer instead of PN1 extraction buffer (LGC) since degradation in GH+ RNA extraction buffer is much less than in PN1 extraction buffer leading to a higher PSTVd sensitivity. Use of several new multiplex RT Taqmans to detect additional Pospiviroidae as CEVd, CLVD, PCFVd, TASVd and TPMVd Version Correction numbering primer sets in appendices. 201d instead 201c, at 349 / mc instead of 249 at / c and 350a, 350b instead 250a, 250b. Naktuinbouw 7/9 SPN-V044e v1.1

8 9. Appendices GH+ extraction buffer (6M) Adjust to 1 liter with water guanidine-hydrochloride (harmful) 573 g NaAC-buffer (4M) 50 ml EDTA (di-natrium) 9.3 g PVP g NaAc buffer (4M) Adjust to 1 liter with water NaAC (CH3COONa) 328 g Check/adjust ph to 5.2 DLVd spike Take a leaf from a DLVd infected Dahlia plant and make an leaf extract. Dilute the extract experimentally to a Ct value of 25. Store aliquots at -80 C. After thawing store aliquot at -20 C for up to one week. Primer No. Naktuinbouw primer collection Sequence PSTV-231F1 201a GCCCCCTTTGCGCTGT 1 PSTV-296R 201b AAGCGGTTCTCGGGAGCTT 1 PSTV-251T-probe 201d 6FAM-CAGTTGTTTCCACCGGGTAGTAGCCGA-BHQ1 1 DaVd1-FT 320a GCTCCGCTCCTTGTAGCTTT 2 DaVd1-RT 320b AGGAGGTGGAGACCTCTTGG 2 DaVd1-P 320c Texas red-ctgactcgaggacgcgaccg-bhq2 2 TPMVd-F1 350a AAAAAAGAATTGCGGCCAAA 3 TPMVd-R 350b GCGACTCCTTCGCCAGTTC 3 puccr2 307i 6FAM-CCGGGGAAACCTGGA-NFQ-MGB 4 CLVd-F 279a GGTTCACACCTGACCCTGCAG 5 CLVd-F2 279b AAACTCGTGGTTCCTGTGGTT 5 CLVd-R 279c CGCTCGGTCTGAGTTGCC 5 CLVd-P 279d 6FAM-AGCGGTCTCAGGAGCCCCGG-BHQ1 5 CEVd-F a CTCCACATCCGRTCGTCGCTGA 6 CEVd-R b TGGGGTTGAAGCTTCAGTTGT 6 CEVd-P c 6FAM-CCCTCGCCCGGAGCTTCTCTCTG-BHQ1 6 TASVd-F a CKGGTTTCCWTCCTCTCGC 7 TASVd-R b CGGGTAGTCTCCAGAGAGAAG 7 TASVd-P c 6FAM-TCTTCGGCCCTCGCCCGR-BHQ 7 PCFVd-F 349a TCTTCTAAGGGTGCCTGTGG 8 PCFVd-R 349b GCTTGCTTCCCCTTTCTTTT 8 PCFVd-Probe 349c VIC-CTCCCCCGAAGCCCGCTTAG-BHQ1 8 nad5 F 151a GATGCTTCTTGGGGCTTCTTGTT 9 nad5 R 151b CTCCAGTCACCAACATTGGCATAA 9 nad5-probe 151d Texas red-aggatccgcatagccctcgatttatgtg-bhq2 9 1: Boonham et al. (2004), 2, 3, 8 and 9: R&D Naktuinbouw, 4: Botermans et al. (2011), 5: Monger et al. (2010), 6 and 7: FERA. Lit. ref. Naktuinbouw 8/9 SPN-V044e v1.1

9 Composition primer and probe mixes A, B and C (10 µm each) 351a Pospi primermix A 201a, 201b, 349a, 349b, 320a, 320b 351b Pospi primermix A 201d, 349c, 320c 352a Pospi primermix B 280a, 280b, 279a, 279b, 279c, 320a, 320b 352b Pospi primermix B 280c, 279d, 320c 353a Pospi primermix C 350a, 350b, 151a, 151b 353b Pospi primermix C 307i, 151d Naktuinbouw 9/9 SPN-V044e v1.1

REFERENCE PROTOCOL NAKTUINBOUW

REFERENCE PROTOCOL NAKTUINBOUW REFERENCE PROTOCOL NAKTUINBOUW Real-time RT-PCR (RT TaqMan PCR) for pospiviroids (CEVd, CLVd, MPVd, PCFVd, PSTVd, TASVd, TCDVd and TPMVd) on seeds of tomato (Solanum lycopersicum) Protocol number: SPN-V043e

More information

RealLine HCV PCR Qualitative - Uni-Format

RealLine HCV PCR Qualitative - Uni-Format Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

FastLine cell cdna Kit

FastLine cell cdna Kit 1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents

More information

Genomic DNA detection assay

Genomic DNA detection assay Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

Detection of PepMV and ringtest results

Detection of PepMV and ringtest results Detection of PepMV and ringtest results HJ (Joe) Vetten (on behalf of the PEPEIRA consortium) JKI, Institute for Epidemiology and Pathogen Diagnostics, Braunschweig, Germany www.jki.bund.de Outline Ringtest

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Quantitative Real Time PCR Protocol. Stack Lab

Quantitative Real Time PCR Protocol. Stack Lab Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO)

EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO) EXPERIMENT 6 RNA ISOLATION AND RT-PCR ANALYSIS (GENE TWO) Purpose: To determine the mrna accumulation pattern of the gene of interest in wild type and mutant Arabidopsis siliques. OVERVIEW OF RT-PCR STRATEGY

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Procedure for RNA isolation from human muscle or fat

Procedure for RNA isolation from human muscle or fat Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe

More information

Reconstituting and Diluting Primers and TaqMan Probes

Reconstituting and Diluting Primers and TaqMan Probes Reconstituting and Diluting Primers and TaqMan Probes Introduction TaqMan primers are commonly shipped in a lyophilized state. TaqMan probes are sometimes shipped in the lyophilized state, but more often

More information

Human Herpes Virus 4 (Epstein Barr)

Human Herpes Virus 4 (Epstein Barr) Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein

More information

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of

More information

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)

RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr) RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep

More information

Taqman TCID50 for AAV Vector Infectious Titer Determination

Taqman TCID50 for AAV Vector Infectious Titer Determination Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through

More information

Path-ID Multiplex One-Step RT-PCR Kit

Path-ID Multiplex One-Step RT-PCR Kit USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907

More information

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory

More information

Quantification of Mycobacterium Tuberculosis. 150 tests

Quantification of Mycobacterium Tuberculosis. 150 tests Quantification of Mycobacterium Tuberculosis rep 13E12 For general laboratory and research use only 150 tests Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium that

More information

qpcr Quantification Protocol Guide

qpcr Quantification Protocol Guide qpcr Quantification Protocol Guide FOR RESEARCH USE ONLY Topics 3 Introduction 5 User-Supplied Consumables and Equipment 7 Select Template 8 Dilute qpcr Template 9 Dilute Libraries 10 Prepare Reaction

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07

Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07 Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf Life... 3

More information

MMLV High Performance Reverse Transcriptase

MMLV High Performance Reverse Transcriptase MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).

More information

AffinityScript QPCR cdna Synthesis Kit

AffinityScript QPCR cdna Synthesis Kit AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this

More information

PNA BRAF Mutation Detection Kit

PNA BRAF Mutation Detection Kit - PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit

More information

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Blood Collection and Processing SOP

Blood Collection and Processing SOP Brisbane Breast Bank Blood Collection and Processing SOP Breast Pathology Laboratory University of Queensland Centre for Clinical Research Blood Collection We collect 30ml of blood from patients who have

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010

Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Recommended Procedures for the Extraction of RNA Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 RNA Extraction Isolates RNA from other cellular components in the

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Plant Genomic DNA Extraction using CTAB

Plant Genomic DNA Extraction using CTAB Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

Human Free Testosterone(F-TESTO) ELISA Kit

Human Free Testosterone(F-TESTO) ELISA Kit Human Free Testosterone(F-TESTO) ELISA Kit Catalog Number. MBS700040 For the quantitative determination of human free testosterone(f-testo) concentrations in serum, plasma. This package insert must be

More information

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100 RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems Technical Manual Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems INSTRUCTIONS FOR USE OF PRODUCTS A4011, A4021, A4031, A4041, A4051 AND

More information

Detailed protocol: Combined method for RNA isolation. from cartilage

Detailed protocol: Combined method for RNA isolation. from cartilage Detailed protocol: Combined method for RNA isolation from cartilage REAGENTS - chloroform - DNase (RNase-free DNase Set, cat.no. 79254, Qiagen, Hilden, Germany) - 80 % Ethanol (in DEPC-treated water) -

More information

How To Make A Tri Reagent

How To Make A Tri Reagent TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient

More information

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

All-in-One mirna qrt-pcr Detection System Handbook

All-in-One mirna qrt-pcr Detection System Handbook All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)

More information

HBV PCR detection Kit USER MANUAL

HBV PCR detection Kit USER MANUAL For professional use only HBV PCR detection Kit (PREP-NA DNA/RNA Extraction Kit included) USER MANUAL "DNA-Technology, Research & Production" LLC Russia, 142281, Moscow Region, Protvino, 2 Zheleznodorozhnaya

More information

RayBio Creatine Kinase (CK) Activity Colorimetric Assay Kit

RayBio Creatine Kinase (CK) Activity Colorimetric Assay Kit RayBio Creatine Kinase (CK) Activity Colorimetric Assay Kit User Manual Version 1.0 May 28, 2014 RayBio Creatine Kinase Activity Colorimetric Assay (Cat#: 68CL-CK-S100) RayBiotech, Inc. We Provide You

More information

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.

Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests. TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

Concert Plant RNA Reagent

Concert Plant RNA Reagent General Information Concert Plant RNA Reagent Catalog no. 12322-012 Description Invitrogen s Concert Plant RNA Reagent is a proprietary RNA isolation reagent that allows isolation of high quality total

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Transformation Protocol

Transformation Protocol To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic

More information

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07 Techne qpcr test Lyme Disease RecA gene 150 tests For general laboratory and research use only 1 Introduction to Lyme Disease Lyme disease is an infectious disease caused mainly by three species of bacteria

More information

UltraClean Forensic DNA Isolation Kit (Single Prep Format)

UltraClean Forensic DNA Isolation Kit (Single Prep Format) UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...

More information

Aurora Forensic Sample Clean-up Protocol

Aurora Forensic Sample Clean-up Protocol Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]

More information

QuantiNova Reverse Transcription Kit Handbook

QuantiNova Reverse Transcription Kit Handbook June 2015 QuantiNova Reverse Transcription Kit Handbook For cdna synthesis with integrated removal of genomic DNA contamination For use in real-time two-step RT PCR Sample to Insight Contents Kit Contents...

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

QIAGEN Supplementary Protocol

QIAGEN Supplementary Protocol QIAGEN Supplementary Protocol Isolation of Peripheral Blood Mononuclear Cells (PBMC) and Purification of Total RNA from PBMC Using the RNeasy Micro or Mini Kit This protocol describes how to isolate PBMC

More information

Applied Biosystems KRAS Mutation Analysis Reagents. Protocol

Applied Biosystems KRAS Mutation Analysis Reagents. Protocol Applied Biosystems KRAS Mutation Analysis Reagents Protocol For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change

More information

Quantification of Propionibacterium acnes. Standard kit 150 tests

Quantification of Propionibacterium acnes. Standard kit 150 tests Primerdesign TM Ltd Quantification of Propionibacterium acnes Recombinase A (reca) gene For general laboratory and research use only Standard kit 150 tests Introduction to Propionibacterium acnes Propionibacterium

More information

Quantification of Hepatitis B Virus. Core Protein Region. 150 tests

Quantification of Hepatitis B Virus. Core Protein Region. 150 tests Quantification of Hepatitis B Virus Core Protein Region For general laboratory and research use only 150 tests Introduction to Hepatitis B Virus Originally known as serum hepatitis, hepatitis B has only

More information

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient

More information

Klebsiella oxytoca. Outer membrane protein II (ompa) gene. 150 tests. Quantification of Klebsiella oxytoca genomes. Advanced kit handbook HB10.03.

Klebsiella oxytoca. Outer membrane protein II (ompa) gene. 150 tests. Quantification of Klebsiella oxytoca genomes. Advanced kit handbook HB10.03. Techne qpcr test Klebsiella oxytoca Outer membrane protein II (ompa) gene 150 tests For general laboratory and research use only 1 Introduction to Klebsiella oxytoca Klebsiella oxytoca is a Gram-negative,

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System 5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing

More information

Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit

Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit Catalog Number. CSB-E14405r For the quantitative determination of rat creatine kinase MM isoenzyme (CK-MM) concentrations in serum, plasma and tissue

More information

Sanger Sequencing: Sample Preparation Guide

Sanger Sequencing: Sample Preparation Guide Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation

More information

One Shot TOP10 Competent Cells

One Shot TOP10 Competent Cells USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd.

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd. TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction

More information

User Bulletin #2 ABI PRISM 7700 Sequence Detection System

User Bulletin #2 ABI PRISM 7700 Sequence Detection System User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 (updated 10/2001) SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

HighPure Maxi Plasmid Kit

HighPure Maxi Plasmid Kit HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer

More information

Creatine Kinase Activity Assay Kit (Colorimetric)

Creatine Kinase Activity Assay Kit (Colorimetric) ab155901 Creatine Kinase Activity Assay Kit (Colorimetric) Instructions for Use For the sensitive and accurate measurement of Creatine Kinase activity in various samples. This product is for research use

More information

Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610

Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Kevin Bogart and Justen Andrews Extraction of Total RNA from Drosophila CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Bogart K and Andrews J. 2006. Extraction of Total RNA from Drosophila. CGB

More information