Metodologie di sequenziamemento

Size: px
Start display at page:

Download "Metodologie di sequenziamemento"

Transcription

1 Metodologie di sequenziamemento di DNA ed RNA Metzker et al Sequencing technologies the next generation. Nature Reviews Genetics, vol. 11, p. 31 Stranneheim and Lundeberg Stepping stones in DNA sequencing. Biotechnol. J., vol. 7, p Head et al Library construction for next-generation sequencing: Overviews and challenges. BioTechniques 56:61-77 Jenny Wu;Introduction To Next Generation Sequencing (NGS) Data Analysis; online pptx presentation

2 Stranneheim and Lundeberg 2012

3 Un po di storia 25 Aprile 1953 James D. Watson e Francis Crick pubblicano la struttura del DNA (Watson JD, Crick FHC "A Structure for Deoxyribose Nucleic Acid", Nature vol. 171, pp ; 1953) fondando il campo della genetica molecolare. Premio Nobel nel Metà degli anni 50: Arthur Kornberg inizia a studiare il meccanismo di replicazione del DNA. Nel 1957 identifica la prima DNA polimerasi. L enzima copia in una sola direzione e richiede degli inneschi preesistenti (primer) per iniziare a copiare il filamento. Premio Nobel nel All inizio degli anni 60 Gobind Khorana chiarisce molti aspetti del codice genetico. Successivamente inizia un progetto per la sintesi in vitro di un gene umano e in questi esperimenti getta le basi per l utilizzo di oligonucleotidi sintetici (usati sia come blocchi per la costruzione del gene, sia come inneschi per la DNA polimerasi) Premio Nobel per il suo lavoro sul codice genetico Thomas D. Brock isola un nuovo batterio dalle sorgenti calde dello Yellowstone National Park. Nel 1976 viene islata la DNA polimerasi di T. aquaticus (taq) in grado di mantenere la sua attività oltre i 75 C Frederick Sanger sviluppa un metodo per determinare la sequenza del DNA. (Sanger F, Nicklen S, Coulson AR "DNA sequencing with chain-terminating inhibitors" Proc Natl Acad Sci vol. 74(12) pp ; 1977). 1980: Premio Nobel. Nel 1980 tutti I componenti per fare un ampplificazione con PCR sono conosciuti dalla comunità scientifica

4 50-68 C

5 Elongation Strand Separation Primer Annealing Termination

6 Termination Standard Nucleotides Dye-labeled dideoxynucleotides ddntp incorporation leads to chain growth termination

7 Capillary Electrophoresis ABI 3730, 96-capillary Capillary Tube Laser Photo cell cromatogramma

8 NGS

9 Applications Espressione genica Caratterizzazione regioni di interazione DNA-proteine Epigenetica

10 Applications: genomes, exomes, transcriptomes

11 Applications: RNA seq (trascrittoma)

12 Applications:ChIP-Seq

13 Library preparation

14 library Frammentazione Legame adattatori Template preparation Serve a reggiungere una quantità di DNA stampo sufficiente per la lettura del sequenziamento sequencing Sequencing by synthesis Lettura del segnale

15 Preparazione del DNA o dell RNA in una forma utilizzabile dalla tecnologia di sequenziamento (lunghezza adeguata tipicamente poche centinaia di bp, dsdna, adattatori)

16 With the exception of Illumina s Nextera prep, library preparation generally entails: (i) Fragmentation, end-repair, phosphorylation of the 5 prime ends, A-tailing of the 3 ends to facilitate ligation to sequencing adapters (ii) ligation of adapters (iii) some number of PCR cycles to enrich for product that has adapters ligated to both ends The primary differences in an Ion Torrent workflow are the use of blunt-end ligation to different adapter sequences. (iv) To facilitate multiplexing, different barcoded adapters (index) can be used with each sample. Es. Illumina adaptors P5/ P7: binding sites to the flow cell Rd 1 SP: read1 sequencing primer Rd 2 SP: read2 sequencing primer

17 NGS Up to 250

18 Up to 250

19 Up to 250

20 MiSeq Sequencing Technology - one-lane flow cell Mill. reads - 150b/read => 4,6 Gb = 4600 Mb Genome sizes: human XX: 3194 Mbp E.coli: 4,7 Mbp HIV: 8000bp Amoeba proteos Mbp - library prep RNA: 320 DNA: sequencing MiSeq Run: 1020

21 Prima massive parallel sequencing technologies: 2003 Quasi in disuso a causa degli elevati costi di gestione, l emulsion PCR è stata ereditata da Ion Torrent (Life Technologies)

22

23 Ma che cosa abbiamo realmente sequenziato? Single end seq Paired end seq

24 M: milioni Gb: gigabasi:

25 Read: singola sequenza di basi, prodotto del sequenziamento Coverage: numero di volte in cui una base viene letta in una corsa di sequenziamento

26

27 Il numero di basi lette per read dipende dalla tecnologia e dalla chimica usate La lunghezza di questo inserto che non verrà sequenziato è molto importante per mappare le due estremità sulla sequenza di riferimento

28 Why Bioinformatics Informatics (wall.hms.harvard.edu)

29 Bioinformatics Challenges in NGS Data Analysis VERY large text files (thousands of millions of lines long) Can t do business as usual with familiar tools Impossible memory usage and execution time Manage, analyze, store, transfer and archive huge files Need for powerful computers and expertise Informatics groups must manage compute clusters New algorithms and software are required and often time they are open source Unix/Linux based. Collaboration of IT, bioinformaticians and biologists Jenny Wu

30 Terminology Coverage (depth): The number of nucleotides from reads that are mapped to a given position. Quality Score: Each called base comes with a quality score which measures the probability of base call error. Paired-End Sequencing: Both end of the DNA fragment is sequenced, allowing highly precise alignment. Multiplex Sequencing: "barcode" sequences are added to each sample so they can be distinguished in order to sequence large number of samples on one lane. Mapping: Align reads to reference to identify their origin. Assembly: Merging of fragments of DNA in order to reconstruct the original sequence. Duplicate reads: Reads that are identical. Multi-reads: Reads that can be mapped to multiple locations equally well. Jenny Wu

31 File Formats Reference sequences, reads: FASTQ FASTA Alignments: SAM BAM Features, annotation, scores: GFF/GTF BED/BigBed WIG/BigWig Jenny Wu

32 General Data Pipeline Jenny Wu

33 FASTA Format (Reference Seq) Jenny Wu

34 FASTQ Format (reads) Jenny Wu

35 FASTQ Format (Illumina Example) Read Record Header Flow Cell ID Lane Tile Tile Coordinates Barcode Separator (with optional repeated header) tile 1:N:0:AGTCAA CAGGAGTCTTCGTACTGCTTCTCGGCCTCAGCCTGATCAGTCACACCGTT + BCCFFFDFHHHHHIJJIJJJJJJJIJJJJJJJJJJIJJJJJJJJJIJJJJ Read 1:N:0:AG AAAACTCTTACTACATCAGTATGGCTTTTAAAACCTCTGTTTGGAGCCAG + Read Quality 1:N:0:AG CCTCCTGCTTAAAACCCAAAAGGTCAGAAGGATCGTGAGGCCCCGCTTTC 1:N:0:AG GAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGG + CCCFFFFFHHHHHGGIJJJIJJJJJJIJJIJJJJJGIJJJHIIJJJIJJJ NOTE: for paired-end runs, there is a second file with one-to-one corresponding headers and reads. (Passarelli, 2012)

36 Data Analysis Pipeline Sequence quality control (QC) and preprocessing Obtaining and preparing reference Sequence mapping Downstream analysis workflow and software

37 The UCSC Genome Browser Homepage General information Get genome annotation here! Get reference sequences here! Specific information new features, current status, etc. Jenny Wu

38 Getting reference sequences Jenny Wu

39 Getting Reference Annotation Jenny Wu

40 Sequence Mapping Challenges Alignment (Mapping) is the first steps once analysis-read reads are obtained. The task: to align sequencing reads against a known reference. Difficulties: high volume of data, size of reference genome, computation time, read length constraints, ambiguity caused by repeats and sequencing errors. Jenny Wu

41 Short Read Alignment Olson et al. Jenny Wu

42 Short Read Alignment Software Jenny Wu

43 Short Reads Mapping Software Jenny Wu

44 How to choose an aligner? There are many aligners and they vary a lot in performance(accuracy, memory usage, speed and flexibility etc). Factors to consider : application, platform, read length, downstream analysis, etc. Constant trade off between speed and sensitivity (e.g. MAQ vs. Bowtie) Guaranteed high accuracy will take longer. Jenny Wu

45 NGS Applications and Analysis Strategy:downstream analysis Name Nucleic acid population Brief analysis strategy RNA-Seq RNA (may be poly-a mrna or total RNA) Alignment of reads to genes ; variations for detecting splice junctions and quantifying abundance Small RNA sequencing Small RNA (often mirna) Alignment of reads to small RNA references (e.g. mirbase), then to the genome; quantify abundance ChIP-Seq DNA bound to protein, captured via antibody (ChIP = Chromatin ImmunoPrecipitation) Align reads to reference genome, identify peaks & motifs RIP-Seq RNA bound to protein, captured via antibody (RIP = RNA ImmunoPrecipitation) Align reads to reference genome and/or genes, identify peaks and motifs Methylation Analysis SNP calling/ discovery Structural Variation Analysis de novo Sequencing Select methylated genomic DNA regions, or convert methylated nucleotides to alternate forms All or some genomic DNA or RNA Genomic DNA, with two reads (mate-pair reads) per DNA template Genomic DNA (possibly with external data e.g. cdna, genomes of closely related species, etc.) Align reads to reference and either identify peaks or regions of methylation Either align reads to reference and identify statistically significant SNPs, or compare multiple samples to each other to identify SNPs Align mate-pairs to reference sequence and interpret structural variants Piece-together reads to assemble contigs, scaffolds, and (ideally) whole-genome sequence Metagenomics Entire RNA or DNA from a (usually microbial) community Phylogenetic analysis of sequences (Hunicke-Smith et al, 2010)

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda 24/04/2013 Next gen Sequencing technologies 1 2nd Gen Sequencing Summary of the short course Next Gen Sequencing

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics

Next Generation Sequencing I: Technologies. Jim Noonan Department of Genetics Next Generation Sequencing I: Technologies Jim Noonan Department of Genetics Sequence as the readout for biological processes Determining the biological state of cells, tissues and organisms requires the

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

COURSE OF BIOINFORMATICS

COURSE OF BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2015-2016 Bioinformatic Analysis of Next Generation Sequencing Data What is massively parallel sequencing? Next-generation sequencing (NGS), also known as high-throughput

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

CHALLENGES IN NEXT-GENERATION SEQUENCING

CHALLENGES IN NEXT-GENERATION SEQUENCING CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture

More information

Introduction to Illumina Next Generation Sequencing Technology

Introduction to Illumina Next Generation Sequencing Technology The Nancy and Stephen Grand Israel National Center for Personalized Medicine (G-INCPM) Introduction to Illumina Next Generation Sequencing Technology Shmulik Motola, PhD March 2016 DNA Sequencing a process

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician

Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician Next generation sequencing (NGS) Bioinformatics Challenges and strategies Urmi Trivedi Lead Bioinformatician urmi.trivedi@ed.ac.uk Major Bottlenecks Data volume Data complexity Data noise Overview Solutions

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 http://dayhoff.anu.edu.au/~sf/next_gen_seq 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina im411@cam.ac.uk Head of Computational Biology Lab HPC Service, University of Cambridge, UK EMBL-EBI Scientific collaborator Genome Campus, Hinxton, Cambridge,

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

DNA Sequencing: The Past, the Present and the Future

DNA Sequencing: The Past, the Present and the Future STARS Mini-Symposium 9/12/2016 DNA Sequencing: The Past, the Present and the Future Ralf Kittler, Ph.D. McDermott Center for Human Growth and Development ralf.kittler@utsouthwestern.edu Outline DNA sequencing

More information

12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL

12/6/12. Dr. Sanjeeva Srivastava. IIT Bombay 2. Genomics Transcriptomics Why proteomics? Proteomics Course NPTEL Dr. Sanjeeva Srivastava IIT Bombay Genomics Transcriptomics Why proteomics? IIT Bombay 2 1 IIT Bombay 3 Genome: The entire sequence of an organism s hereditary information, including both coding and non-coding

More information

Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12

Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 What s Galaxy? Bringing Developers And Biologists Together. Reproducible Science Is Our Goal An open, web-based platform for data intensive

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Once sequenced the problem becomes computational Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

SOLUTIONS FOR NEXT-GENERATION SEQUENCING

SOLUTIONS FOR NEXT-GENERATION SEQUENCING SOLUTIONS FOR NEXT-GENERATION SEQUENCING GENOMICS CELL BIOLOGY PROTEOMICS AUTOMATION enabling next-generation research From Samples To Publication, Millennium Science Enables Your Next-Gen Sequencing Workflow

More information

Next Generation Sequencing. Tobias Österlund

Next Generation Sequencing. Tobias Österlund Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 12/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 25/2 08.00-09.45

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

NGS Data Analysis: An Intro to RNA-Seq

NGS Data Analysis: An Intro to RNA-Seq NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

TGC AT YOUR SERVICE. Taking your research to the next generation

TGC AT YOUR SERVICE. Taking your research to the next generation TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano

More information

Public Health Laboratory Workforce Development Bioinformatics

Public Health Laboratory Workforce Development Bioinformatics Public Health Laboratory Workforce Development Bioinformatics Templates for Course Development Contents Overview... 1 Going Beyond the Introductory Courses... 1 Course Templates... 3 Template 1: Introduction

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

-> Integration of MAPHiTS in Galaxy

-> Integration of MAPHiTS in Galaxy Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Sequencing power for every scale. Systems for every application, for every lab.

Sequencing power for every scale. Systems for every application, for every lab. Sequencing power for every scale. Systems for every application, for every lab. Proven sequencing technology. Accelerate your research. Achieve your next breakthrough. What started as novel Illumina chemistry,

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Written test: Analysis of data from high-throughput molecular biology experiments BB2490 (BIO) or DD2399 (CSC)

Written test: Analysis of data from high-throughput molecular biology experiments BB2490 (BIO) or DD2399 (CSC) Written test: Analysis of data from high-throughput molecular biology experiments BB2490 (BIO) or DD2399 (CSC) Name: Pnr: Wednesday the 18th of February, 13.00-15.00, Albanova FB52 Instructions: The test

More information

RNA-Seq Data Analysis. I-Hsuan Lin

RNA-Seq Data Analysis. I-Hsuan Lin RNA-Seq Data Analysis I-Hsuan Lin LSL Next-Generation Sequencing Workshop (Day 3) 19 Nov 2015 Transcriptome 2 The complete set of RNA species in a cell and their quantities Transcriptomics To catalogue

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

Buyer s Guide: Next-Generation Sequencing Systems

Buyer s Guide: Next-Generation Sequencing Systems Buyer s Guide: Next-Generation Sequencing Systems Covering All the Bases: What to Consider Before Making Your NGS System Purchase. This is an exciting time for biological research. Meaningful discovery

More information

Next Generation Sequencing for Invertebrate Virus Discovery

Next Generation Sequencing for Invertebrate Virus Discovery Next Generation Sequencing for Invertebrate Virus Discovery -a practical approach Sijun Liu & Bryony C. Bonning Iowa State University, USA 8-14-2013 SIP Pittsburgh Outline Introduction: Why use NGS? Traditional

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the

More information

Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation

Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation D. Puthier. laboratoire INSERM, Aix-Marseille Université, TAGC/INSERM U928, Parc Scientifique de Luminy case 928 Outline

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

Deep Sequencing Data Analysis

Deep Sequencing Data Analysis Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

The MiniSeq System. Explore the possibilities.

The MiniSeq System. Explore the possibilities. The MiniSeq System. Explore the possibilities. Discover demonstrated NGS workflows for molecular biology applications. Let your work flow with Illumina NGS. The MiniSeq System delivers powerful and cost-effective

More information

Sample Preparation. Module 1: Overview

Sample Preparation. Module 1: Overview Sample Preparation Module 1: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Library Preparation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

Ion Torrent Amplicon Sequencing

Ion Torrent Amplicon Sequencing APPLICATION NOTE Amplicon Sequencing Ion Torrent Amplicon Sequencing Introduction The ability to sequence a genome or a portion of a genome has enabled researchers to begin to understand how the genetic

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Understanding the Microbiome: Metatranscriptomics. Marcus Claesson APC Microbiome Symposium 2015

Understanding the Microbiome: Metatranscriptomics. Marcus Claesson APC Microbiome Symposium 2015 Understanding the Microbiome: Metatranscriptomics Marcus Claesson APC Microbiome Symposium 2015 Metatranscriptomics Definition (genetics, ecology) A branch of transcriptomics that studies and correlates,

More information

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013 Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA 2012-2013 martedì 30 ottobre 2012 1 Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012 martedì

More information

Bioinformatics Unit Department of Biological Services. Get to know us

Bioinformatics Unit Department of Biological Services. Get to know us Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

FAQs of Differential Gene Expression using RNA-Seq A collection of questions about RNA-Seq

FAQs of Differential Gene Expression using RNA-Seq A collection of questions about RNA-Seq FAQs of Differential Gene Expression using RNA-Seq A collection of questions about RNA-Seq July 18, 2013 Jyothi Thimmapuram jyothit@purdue.edu Bioinformatics Core bioinformatics@purdue.edu Strategies for

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

RNA-Seq Software, Tools, and Workflows

RNA-Seq Software, Tools, and Workflows RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 2016 Workshop Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Data Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information