Metodologie di sequenziamemento

Size: px
Start display at page:

Download "Metodologie di sequenziamemento"

Transcription

1 Metodologie di sequenziamemento di DNA ed RNA Metzker et al Sequencing technologies the next generation. Nature Reviews Genetics, vol. 11, p. 31 Stranneheim and Lundeberg Stepping stones in DNA sequencing. Biotechnol. J., vol. 7, p Head et al Library construction for next-generation sequencing: Overviews and challenges. BioTechniques 56:61-77 Jenny Wu;Introduction To Next Generation Sequencing (NGS) Data Analysis; online pptx presentation

2 Stranneheim and Lundeberg 2012

3 Un po di storia 25 Aprile 1953 James D. Watson e Francis Crick pubblicano la struttura del DNA (Watson JD, Crick FHC "A Structure for Deoxyribose Nucleic Acid", Nature vol. 171, pp ; 1953) fondando il campo della genetica molecolare. Premio Nobel nel Metà degli anni 50: Arthur Kornberg inizia a studiare il meccanismo di replicazione del DNA. Nel 1957 identifica la prima DNA polimerasi. L enzima copia in una sola direzione e richiede degli inneschi preesistenti (primer) per iniziare a copiare il filamento. Premio Nobel nel All inizio degli anni 60 Gobind Khorana chiarisce molti aspetti del codice genetico. Successivamente inizia un progetto per la sintesi in vitro di un gene umano e in questi esperimenti getta le basi per l utilizzo di oligonucleotidi sintetici (usati sia come blocchi per la costruzione del gene, sia come inneschi per la DNA polimerasi) Premio Nobel per il suo lavoro sul codice genetico Thomas D. Brock isola un nuovo batterio dalle sorgenti calde dello Yellowstone National Park. Nel 1976 viene islata la DNA polimerasi di T. aquaticus (taq) in grado di mantenere la sua attività oltre i 75 C Frederick Sanger sviluppa un metodo per determinare la sequenza del DNA. (Sanger F, Nicklen S, Coulson AR "DNA sequencing with chain-terminating inhibitors" Proc Natl Acad Sci vol. 74(12) pp ; 1977). 1980: Premio Nobel. Nel 1980 tutti I componenti per fare un ampplificazione con PCR sono conosciuti dalla comunità scientifica

4 50-68 C

5 Elongation Strand Separation Primer Annealing Termination

6 Termination Standard Nucleotides Dye-labeled dideoxynucleotides ddntp incorporation leads to chain growth termination

7 Capillary Electrophoresis ABI 3730, 96-capillary Capillary Tube Laser Photo cell cromatogramma

8 NGS

9 Applications Espressione genica Caratterizzazione regioni di interazione DNA-proteine Epigenetica

10 Applications: genomes, exomes, transcriptomes

11 Applications: RNA seq (trascrittoma)

12 Applications:ChIP-Seq

13 Library preparation

14 library Frammentazione Legame adattatori Template preparation Serve a reggiungere una quantità di DNA stampo sufficiente per la lettura del sequenziamento sequencing Sequencing by synthesis Lettura del segnale

15 Preparazione del DNA o dell RNA in una forma utilizzabile dalla tecnologia di sequenziamento (lunghezza adeguata tipicamente poche centinaia di bp, dsdna, adattatori)

16 With the exception of Illumina s Nextera prep, library preparation generally entails: (i) Fragmentation, end-repair, phosphorylation of the 5 prime ends, A-tailing of the 3 ends to facilitate ligation to sequencing adapters (ii) ligation of adapters (iii) some number of PCR cycles to enrich for product that has adapters ligated to both ends The primary differences in an Ion Torrent workflow are the use of blunt-end ligation to different adapter sequences. (iv) To facilitate multiplexing, different barcoded adapters (index) can be used with each sample. Es. Illumina adaptors P5/ P7: binding sites to the flow cell Rd 1 SP: read1 sequencing primer Rd 2 SP: read2 sequencing primer

17 NGS Up to 250

18 Up to 250

19 Up to 250

20 MiSeq Sequencing Technology - one-lane flow cell Mill. reads - 150b/read => 4,6 Gb = 4600 Mb Genome sizes: human XX: 3194 Mbp E.coli: 4,7 Mbp HIV: 8000bp Amoeba proteos Mbp - library prep RNA: 320 DNA: sequencing MiSeq Run: 1020

21 Prima massive parallel sequencing technologies: 2003 Quasi in disuso a causa degli elevati costi di gestione, l emulsion PCR è stata ereditata da Ion Torrent (Life Technologies)

22

23 Ma che cosa abbiamo realmente sequenziato? Single end seq Paired end seq

24 M: milioni Gb: gigabasi:

25 Read: singola sequenza di basi, prodotto del sequenziamento Coverage: numero di volte in cui una base viene letta in una corsa di sequenziamento

26

27 Il numero di basi lette per read dipende dalla tecnologia e dalla chimica usate La lunghezza di questo inserto che non verrà sequenziato è molto importante per mappare le due estremità sulla sequenza di riferimento

28 Why Bioinformatics Informatics (wall.hms.harvard.edu)

29 Bioinformatics Challenges in NGS Data Analysis VERY large text files (thousands of millions of lines long) Can t do business as usual with familiar tools Impossible memory usage and execution time Manage, analyze, store, transfer and archive huge files Need for powerful computers and expertise Informatics groups must manage compute clusters New algorithms and software are required and often time they are open source Unix/Linux based. Collaboration of IT, bioinformaticians and biologists Jenny Wu

30 Terminology Coverage (depth): The number of nucleotides from reads that are mapped to a given position. Quality Score: Each called base comes with a quality score which measures the probability of base call error. Paired-End Sequencing: Both end of the DNA fragment is sequenced, allowing highly precise alignment. Multiplex Sequencing: "barcode" sequences are added to each sample so they can be distinguished in order to sequence large number of samples on one lane. Mapping: Align reads to reference to identify their origin. Assembly: Merging of fragments of DNA in order to reconstruct the original sequence. Duplicate reads: Reads that are identical. Multi-reads: Reads that can be mapped to multiple locations equally well. Jenny Wu

31 File Formats Reference sequences, reads: FASTQ FASTA Alignments: SAM BAM Features, annotation, scores: GFF/GTF BED/BigBed WIG/BigWig Jenny Wu

32 General Data Pipeline Jenny Wu

33 FASTA Format (Reference Seq) Jenny Wu

34 FASTQ Format (reads) Jenny Wu

35 FASTQ Format (Illumina Example) Read Record Header Flow Cell ID Lane Tile Tile Coordinates Barcode Separator (with optional repeated header) tile 1:N:0:AGTCAA CAGGAGTCTTCGTACTGCTTCTCGGCCTCAGCCTGATCAGTCACACCGTT + BCCFFFDFHHHHHIJJIJJJJJJJIJJJJJJJJJJIJJJJJJJJJIJJJJ Read 1:N:0:AG AAAACTCTTACTACATCAGTATGGCTTTTAAAACCTCTGTTTGGAGCCAG + Read Quality 1:N:0:AG CCTCCTGCTTAAAACCCAAAAGGTCAGAAGGATCGTGAGGCCCCGCTTTC 1:N:0:AG GAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGG + CCCFFFFFHHHHHGGIJJJIJJJJJJIJJIJJJJJGIJJJHIIJJJIJJJ NOTE: for paired-end runs, there is a second file with one-to-one corresponding headers and reads. (Passarelli, 2012)

36 Data Analysis Pipeline Sequence quality control (QC) and preprocessing Obtaining and preparing reference Sequence mapping Downstream analysis workflow and software

37 The UCSC Genome Browser Homepage General information Get genome annotation here! Get reference sequences here! Specific information new features, current status, etc. Jenny Wu

38 Getting reference sequences Jenny Wu

39 Getting Reference Annotation Jenny Wu

40 Sequence Mapping Challenges Alignment (Mapping) is the first steps once analysis-read reads are obtained. The task: to align sequencing reads against a known reference. Difficulties: high volume of data, size of reference genome, computation time, read length constraints, ambiguity caused by repeats and sequencing errors. Jenny Wu

41 Short Read Alignment Olson et al. Jenny Wu

42 Short Read Alignment Software Jenny Wu

43 Short Reads Mapping Software Jenny Wu

44 How to choose an aligner? There are many aligners and they vary a lot in performance(accuracy, memory usage, speed and flexibility etc). Factors to consider : application, platform, read length, downstream analysis, etc. Constant trade off between speed and sensitivity (e.g. MAQ vs. Bowtie) Guaranteed high accuracy will take longer. Jenny Wu

45 NGS Applications and Analysis Strategy:downstream analysis Name Nucleic acid population Brief analysis strategy RNA-Seq RNA (may be poly-a mrna or total RNA) Alignment of reads to genes ; variations for detecting splice junctions and quantifying abundance Small RNA sequencing Small RNA (often mirna) Alignment of reads to small RNA references (e.g. mirbase), then to the genome; quantify abundance ChIP-Seq DNA bound to protein, captured via antibody (ChIP = Chromatin ImmunoPrecipitation) Align reads to reference genome, identify peaks & motifs RIP-Seq RNA bound to protein, captured via antibody (RIP = RNA ImmunoPrecipitation) Align reads to reference genome and/or genes, identify peaks and motifs Methylation Analysis SNP calling/ discovery Structural Variation Analysis de novo Sequencing Select methylated genomic DNA regions, or convert methylated nucleotides to alternate forms All or some genomic DNA or RNA Genomic DNA, with two reads (mate-pair reads) per DNA template Genomic DNA (possibly with external data e.g. cdna, genomes of closely related species, etc.) Align reads to reference and either identify peaks or regions of methylation Either align reads to reference and identify statistically significant SNPs, or compare multiple samples to each other to identify SNPs Align mate-pairs to reference sequence and interpret structural variants Piece-together reads to assemble contigs, scaffolds, and (ideally) whole-genome sequence Metagenomics Entire RNA or DNA from a (usually microbial) community Phylogenetic analysis of sequences (Hunicke-Smith et al, 2010)

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

CHALLENGES IN NEXT-GENERATION SEQUENCING

CHALLENGES IN NEXT-GENERATION SEQUENCING CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

TGC AT YOUR SERVICE. Taking your research to the next generation

TGC AT YOUR SERVICE. Taking your research to the next generation TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina

More information

NGS Data Analysis: An Intro to RNA-Seq

NGS Data Analysis: An Intro to RNA-Seq NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!

Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

-> Integration of MAPHiTS in Galaxy

-> Integration of MAPHiTS in Galaxy Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

Deep Sequencing Data Analysis

Deep Sequencing Data Analysis Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist

More information

Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation

Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation D. Puthier. laboratoire INSERM, Aix-Marseille Université, TAGC/INSERM U928, Parc Scientifique de Luminy case 928 Outline

More information

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office 2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline

More information

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing

GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Bioinformatics Unit Department of Biological Services. Get to know us

Bioinformatics Unit Department of Biological Services. Get to know us Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013

Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013 Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA 2012-2013 martedì 30 ottobre 2012 1 Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012 martedì

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively

More information

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines

Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

GenomeStudio Data Analysis Software

GenomeStudio Data Analysis Software GenomeStudio Data Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012 RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

Interaktionen von RNAs und Proteinen

Interaktionen von RNAs und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental

More information

mygenomatix - secure cloud for NGS analysis

mygenomatix - secure cloud for NGS analysis mygenomatix Speed. Quality. Results. mygenomatix - secure cloud for NGS analysis background information & contents 2011 Genomatix Software GmbH Bayerstr. 85a 80335 Munich Germany info@genomatix.de www.genomatix.de

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Early DNA Sequencing Technologies Early efforts at DNA sequencing were: o tedious o time consuming o labor intensive Frederick Sanger (Sanger

More information

High Performance Compu2ng Facility

High Performance Compu2ng Facility High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information

Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center

Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center Name: Kevin Shianna Age: 39 Position: Senior vice president, sequencing operations, New York Genome Center, since July 2012 Experience

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

Illumina TruSeq DNA Adapters De-Mystified James Schiemer 1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Bioanalyzer Applications for

Bioanalyzer Applications for Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information